DNASE2

Summary

DNASE2 (deoxyribonuclease 2, lysosomal, HGNC:2960) is a protein-coding gene on chromosome 19p13.13, encoding Deoxyribonuclease-2-alpha (O00115). Hydrolyzes DNA under acidic conditions with a preference for double-stranded DNA.

This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2L (low activity) and DNASE2H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record.

Source: NCBI Gene 1777 — RefSeq curated summary.

At a glance

• Gene–disease (curated): autoinflammatory-pancytopenia syndrome due to DNASE2 deficiency (Strong, GenCC)
• GWAS associations: 4
• Clinical variants (ClinVar): 201 total — 3 pathogenic
• GTEx eGene: eQTL in 12 tissues, sQTL in 3 (q < 0.05)
• Phenotypes (HPO): 24
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.20 (unconstrained)
• MANE Select transcript: NM_001375

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2960
Approved symbol	DNASE2
Name	deoxyribonuclease 2, lysosomal
Location	19p13.13
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000105612
Ensembl biotype	protein_coding
OMIM	126350
Entrez	1777

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 5 protein_coding, 4 retained_intron, 1 nonsense_mediated_decay

MANE Select: ENST00000222219

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 3

ENST00000222219, ENST00000586547, ENST00000588777, ENST00000592506, ENST00000698691, ENST00000698692, ENST00000698693, ENST00000880269, ENST00000951022, ENST00001134681

RefSeq mRNA: 1 — MANE Select: NM_001375 NM_001375

CCDS: CCDS12284

Canonical transcript exons

ENST00000222219 — 6 exons

Exon	Start	End
ENSE00000682693	12880972	12881152
ENSE00000682695	12880802	12880880
ENSE00000682697	12878382	12878579
ENSE00001184279	12875209	12876363
ENSE00002936594	12881290	12881449
ENSE00003620137	12878670	12878834

Expression profiles

Bgee: expression breadth ubiquitous, 256 present calls, max score 95.89.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 37.6113 / max 701.3361, expressed in 1798 samples.

Highest expression (Bgee): pancreatic ductal cell, stromal cell of endometrium, lateral globus pallidus, parotid gland, descending thoracic aorta.

Genetic regulation across tissues (GTEx eQTL / sQTL)

DNASE2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 12 tissues and its splicing (sQTL) in 3 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

15 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	eqtl	1.6e-72	-0.62	19:12883502:GATTTCGAAACCAGCCTGGCCAGC:G
Whole Blood	eqtl	1.6e-33	-0.43	19:12883502:GATTTCGAAACCAGCCTGGCCAGC:G
Brain Cerebellar Hemisphere	eqtl	9.0e-14	-0.41	19:12942311:T:C
Brain Cerebellum	eqtl	6.9e-09	-0.43	19:12919466:G:A
Muscle Skeletal	sqtl	1.2e-06	+0.33	19:12885926:A:G
Nerve Tibial	eqtl	1.8e-05	-0.38	19:12886115:T:G
Whole Blood	sqtl	2.5e-05	+0.33	19:12883502:GATTTCGAAACCAGCCTGGCCAGC:G
Nerve Tibial	sqtl	2.7e-03	+1.40	19:12783688:A:C
Colon Sigmoid	eqtl	3.0e-03	+0.94	19:13715482:G:A
Cells Cultured fibroblasts	eqtl	3.3e-03	-0.22	19:12854378:C:T
Artery Tibial	eqtl	4.9e-03	-0.10	19:12843200:GGA:G
Small Intestine Terminal Ileum	eqtl	1.2e-02	+0.26	19:12871461:G:T
Pituitary	eqtl	1.5e-02	+0.83	19:12087720:C:A
Testis	eqtl	1.8e-02	-0.34	19:13097723:C:T
Artery Coronary	eqtl	3.3e-02	+0.21	19:13578027:G:C

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
179413	15.7245	1751
179414	14.3891	1763
179412	6.2990	872
179411	1.1986	283

Top tissues by expression

showing 100 of 280 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	95.89	silver quality
stromal cell of endometrium	CL:0002255	94.74	gold quality
lateral globus pallidus	UBERON:0002476	94.01	gold quality
parotid gland	UBERON:0001831	93.56	gold quality
descending thoracic aorta	UBERON:0002345	93.34	gold quality
cardia of stomach	UBERON:0001162	93.27	silver quality
monocyte	CL:0000576	93.23	gold quality
vena cava	UBERON:0004087	93.13	silver quality
mononuclear cell	CL:0000842	92.99	gold quality
leukocyte	CL:0000738	92.95	gold quality
lateral nuclear group of thalamus	UBERON:0002736	92.89	gold quality
substantia nigra pars compacta	UBERON:0001965	92.76	gold quality
pylorus	UBERON:0001166	92.74	gold quality
subthalamic nucleus	UBERON:0001906	92.65	silver quality
substantia nigra pars reticulata	UBERON:0001966	92.58	silver quality
lymph node	UBERON:0000029	92.52	gold quality
thoracic aorta	UBERON:0001515	92.52	gold quality
granulocyte	CL:0000094	92.48	gold quality
ventral tegmental area	UBERON:0002691	92.48	silver quality
gall bladder	UBERON:0002110	92.43	gold quality
ascending aorta	UBERON:0001496	92.42	gold quality
endometrium epithelium	UBERON:0004811	92.04	silver quality
superior surface of tongue	UBERON:0007371	91.98	gold quality
right coronary artery	UBERON:0001625	91.97	gold quality
aorta	UBERON:0000947	91.79	gold quality
inferior vagus X ganglion	UBERON:0005363	91.70	silver quality
nipple	UBERON:0002030	91.57	gold quality
renal medulla	UBERON:0000362	91.56	gold quality
popliteal artery	UBERON:0002250	91.25	gold quality
tibial artery	UBERON:0007610	91.23	gold quality
pericardium	UBERON:0002407	91.17	silver quality
tongue	UBERON:0001723	91.08	silver quality
pharyngeal mucosa	UBERON:0000355	91.02	silver quality
coronary artery	UBERON:0001621	90.97	gold quality
superior vestibular nucleus	UBERON:0007227	90.88	silver quality
pons	UBERON:0000988	90.84	silver quality
triceps brachii	UBERON:0001509	90.82	gold quality
left coronary artery	UBERON:0001626	90.76	gold quality
body of stomach	UBERON:0001161	90.74	gold quality
gluteal muscle	UBERON:0002000	90.73	gold quality
islet of Langerhans	UBERON:0000006	90.71	gold quality
saphenous vein	UBERON:0007318	90.63	gold quality
trigeminal ganglion	UBERON:0001675	90.62	silver quality
dorsal plus ventral thalamus	UBERON:0001897	90.46	silver quality
saliva-secreting gland	UBERON:0001044	90.45	gold quality
right adrenal gland	UBERON:0001233	90.38	gold quality
right adrenal gland cortex	UBERON:0035827	90.11	gold quality
fundus of stomach	UBERON:0001160	90.10	gold quality
dorsal root ganglion	UBERON:0000044	89.98	gold quality
left adrenal gland	UBERON:0001234	89.97	gold quality
layer of synovial tissue	UBERON:0007616	89.96	gold quality
minor salivary gland	UBERON:0001830	89.85	gold quality
right lung	UBERON:0002167	89.82	gold quality
adrenal cortex	UBERON:0001235	89.72	gold quality
smooth muscle tissue	UBERON:0001135	89.61	gold quality
synovial joint	UBERON:0002217	89.60	gold quality
right ovary	UBERON:0002118	89.51	gold quality
right lobe of thyroid gland	UBERON:0001119	89.47	gold quality
upper lobe of left lung	UBERON:0008952	89.43	gold quality
mucosa of stomach	UBERON:0001199	89.40	gold quality
left adrenal gland cortex	UBERON:0035825	89.40	gold quality
skin of leg	UBERON:0001511	89.32	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	89.28	gold quality
left lobe of thyroid gland	UBERON:0001120	89.25	gold quality
medulla oblongata	UBERON:0001896	89.20	silver quality
mouth mucosa	UBERON:0003729	89.12	gold quality
caecum	UBERON:0001153	88.99	gold quality
urethra	UBERON:0000057	88.98	gold quality
nasal cavity epithelium	UBERON:0005384	88.89	gold quality
penis	UBERON:0000989	88.86	gold quality
thyroid gland	UBERON:0002046	88.85	gold quality
sperm	CL:0000019	88.82	gold quality
rectum	UBERON:0001052	88.82	gold quality
stomach	UBERON:0000945	88.73	gold quality
left uterine tube	UBERON:0001303	88.73	gold quality
blood	UBERON:0000178	88.72	gold quality
right uterine tube	UBERON:0001302	88.72	gold quality
muscle layer of sigmoid colon	UBERON:0035805	88.72	gold quality
body of pancreas	UBERON:0001150	88.67	gold quality
skin of abdomen	UBERON:0001416	88.61	gold quality
left ovary	UBERON:0002119	88.57	gold quality
pancreas	UBERON:0001264	88.54	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	88.48	gold quality
nasal cavity mucosa	UBERON:0001826	88.43	gold quality
upper lobe of lung	UBERON:0008948	88.32	gold quality
male germ cell	CL:0000015	88.22	gold quality
buccal mucosa cell	CL:0002336	88.16	silver quality
lower esophagus muscularis layer	UBERON:0035833	88.04	gold quality
lower esophagus	UBERON:0013473	88.00	gold quality
transverse colon	UBERON:0001157	87.99	gold quality
apex of heart	UBERON:0002098	87.96	gold quality
right atrium auricular region	UBERON:0006631	87.94	gold quality
superficial temporal artery	UBERON:0001614	87.93	silver quality
body of uterus	UBERON:0009853	87.93	gold quality
adenohypophysis	UBERON:0002196	87.81	gold quality
peritoneum	UBERON:0002358	87.80	gold quality
omental fat pad	UBERON:0010414	87.79	gold quality
trachea	UBERON:0003126	87.70	silver quality
endothelial cell	CL:0000115	87.69	silver quality
zone of skin	UBERON:0000014	87.68	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-125970	yes	13.84
E-ANND-3	yes	7.77

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Lymph node	tissue	35.7	not detected
Parathyroid gland	tissue	34.4	not detected
Lung	tissue	31.6	not detected
Liver	tissue	31.4	medium
Thyroid gland	tissue	30.4	medium
Pancreas	tissue	29.9	not detected
Salivary gland	tissue	26.7	low
Ovary	tissue	26.5	not detected
Epididymis	tissue	26.5	medium
Spinal cord	tissue	25.9
Pituitary gland	tissue	23.9
Tonsil	tissue	23.0	low
Stomach 1	tissue	22.7	medium
Prostate	tissue	20.4	medium
Vagina	tissue	20.3	low
Appendix	tissue	20.0	medium
Gallbladder	tissue	19.7	medium
Fallopian tube	tissue	19.5	high
Skin 1	tissue	18.1	not detected
Seminal vesicle	tissue	18.0	low
Adrenal gland	tissue	18.0	medium
Urinary bladder	tissue	17.7	medium
Heart muscle	tissue	17.6	not detected
Thymus	tissue	17.3
Colon	tissue	16.9	medium
Cervix	tissue	16.8	low
Placenta	tissue	16.8	low
Rectum	tissue	16.7	medium
Duodenum	tissue	16.5	high
Smooth muscle	tissue	16.4	not detected
Superior colliculi	tissue	16.1
Spleen	tissue	16.1	not detected
Breast	tissue	15.7	low
Adipose tissue	tissue	15.5	not detected
Hypothalamus	tissue	15.3
Substantia nigra	tissue	15.3
Medulla oblongata	tissue	15.0
Choroid plexus	tissue	13.9
Endometrium 1	tissue	13.6	medium
Pons	tissue	13.2
Periaqueductal gray	tissue	12.4
Kidney	tissue	12.3	medium
Midbrain	tissue	12.2
Small intestine	tissue	12.0	medium
Skeletal muscle	tissue	11.9	not detected
Thalamus	tissue	11.9
Septum	tissue	11.8
Esophagus	tissue	11.7	not detected
Hippocampal formation	tissue	11.1
Putamen	tissue	10.4
Entorhinal cortex	tissue	10.3
Ventral forebrain	tissue	10.1
Tongue	tissue	10.0
Cerebral cortex	tissue	9.9	medium
Motor cortex	tissue	9.9
Corpus callosum	tissue	9.9
Basal ganglia	tissue	9.6	medium
Temporal cortex	tissue	9.4
Locus coeruleus	tissue	9.2
Prefrontal cortex	tissue	9.1

Brain sub-regions (HPA Brain Atlas): detected in 190; highest nTPM — Blood vessel (43.4), Dorsal spinal cord (25.9), Ventral spinal cord (22.5), Lateral funiculus (white matter) (19.6), Anterior funiculus (white matter) (14.4).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): KLF1, SP1, SP3

miRNA regulators (miRDB)

Targeting DNASE2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 37 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-450B-5P	99.92	71.48	3175
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-3680-3P	99.75	72.51	3095
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-3714	99.71	70.74	2671
HSA-MIR-378A-5P	99.65	66.33	1311
HSA-MIR-6848-3P	99.64	66.49	885
HSA-MIR-7150	99.62	66.80	1322
HSA-MIR-325	99.58	66.55	358
HSA-MIR-12122	99.56	69.33	1672
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-5683	99.36	68.59	2083
HSA-MIR-148A-5P	99.30	68.27	1141
HSA-MIR-1273H-3P	99.29	67.55	980
HSA-MIR-6843-3P	99.26	66.42	915
HSA-MIR-7151-3P	99.04	69.72	2370
HSA-MIR-628-3P	99.04	68.37	814
HSA-MIR-6506-5P	99.04	65.66	1386
HSA-MIR-4501	98.72	67.19	921
HSA-MIR-5187-5P	98.54	67.94	952
HSA-MIR-6773-3P	98.17	65.51	1213
HSA-MIR-4736	97.96	65.89	1287
HSA-MIR-6855-5P	97.51	66.03	830
HSA-MIR-597-5P	96.82	67.57	732

Functional genomics

gnomAD constraint: pLI 1.85e-08, LOEUF 1.2, missense Z 0.884 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000222219 — one region, missense o/e 0.91.

Literature-anchored findings (GeneRIF, showing 10)

• upregulation of expression during myelomonocytic differentiation of HL-60 and THP-1 cells (PMID:12147225)
• Sp1 and Sp3 are involved in up-regulation of this enzyme’s transcriptoin during cell differentiation of hl-60 cells. (PMID:12694199)
• the enzyme is a monomeric phospholipase D-family member with a pseudodimeric protein fold (PMID:17192590)
• The association of SNPs in the 5’-regulatory region of the DNA degrading enzyme DNASE2 with Rheumatoid Arthritis implies a role for this enzyme in the pathogenesis of this autoimmune disease. (PMID:18812394)
• study demonstrated the relationship of genotypes/haplotypes with the in vivo DNase II and promoter activities; significant correlations between genotype in each rheumatoid arthritis (RA)-related SNP and enzymatic activity levels were found; alleles associated with RA exhibited a reduction in serum DNase II activity. (PMID:23019102)
• 15 nonsynonymous human DNase II SNPs were genotyped in three ethnic groups including 16 different populations using the PCR-restriction fragment length polymorphism technique. (PMID:24242851)
• Single nucleotide polymorphisms producing a loss-of-function variant of the enzymes in DNASE1, DNASE1L3, and DNASE2, possibly serving as a genetic risk factor for autoimmune diseases, were confirmed. (PMID:27116004)
• DNase2 participate in the degradation of DNA during cornification in the interfollicular epidermis of mice.Cornification of epidermal keratinocytes depends on the cooperation of DNase1L2 and DNase2. (PMID:28743926)
• Study identifies biallelic mutations in DNASE2, associated with a loss of DNase II endonuclease activity causing type I interferonopathy in three patients from two unrelated families. (PMID:29259162)
• Study of the copy number variations (CNVs) for DNASE1L3 and DNASE2 in Japanese and German populations found that only 2 diploid copy numbers for these DNASE CNVs was distributed in both populations; no copy loss or gain was evident for any of the autoimmune-related DNase genes. These human autoimmune-related DNase genes show low genetic diversity of CNVs resulting in alterations of the in vivo levels of DNase activity. (PMID:31022206)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	dnase2	ENSDARG00000073893
mus_musculus	Dnase2a	ENSMUSG00000003812
rattus_norvegicus	Dnase2	ENSRNOG00000023830
drosophila_melanogaster	DNaseII	FBGN0000477
caenorhabditis_elegans		WBGENE00000799
caenorhabditis_elegans		WBGENE00003828
caenorhabditis_elegans		WBGENE00007056

Paralogs (1): DNASE2B (ENSG00000137976)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1329019) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 24 distinct phenotype terms.

Mouse phenotype (MP)	Records
anemia	3
increased nucleated erythrocyte cell number	2
abnormal thymus morphology	1
small thymus	1
thin diaphragm muscle	1
abnormal apoptosis	1
postnatal growth retardation	1
thymus hypoplasia	1
abnormal definitive hematopoiesis	1
abnormal macrophage morphology	1
decreased erythrocyte cell number	1
joint inflammation	1
rheumatoid arthritis	1
diaphragmatic hernia	1
increased circulating tumor necrosis factor level	1
increased circulating interleukin-18 level	1
abnormal cytokine level	1
abnormal blood homeostasis	1
perinatal lethality, complete penetrance	1
lethality during fetal growth through weaning, complete penetrance	1
increased synovial pannus formation	1
impaired erythropoiesis	1
impaired erythrocyte maturation	1
impaired fetal liver erythropoiesis	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Sus scrofa	O62855	82.6%	Diamond
Bos taurus	P56541	82.6%	Diamond
Acanthaster planci	Q75WF2	40.9%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
RNASEH2A	protein-coding	10535
RTBDN-AS1	ncRNA	105372281
KLF1	protein-coding	10661
MAST1	protein-coding	22983
RTBDN	protein-coding	83546
MIR6794	ncRNA	102466196
THSD8	protein-coding	111644133
SYCE2	protein-coding	256126
GCDH	protein-coding	2639
MIR5695	ncRNA	100847016
FARSA-AS1	ncRNA	106144598
FARSA	protein-coding	2193

Protein

Protein identifiers

Deoxyribonuclease-2-alpha — O00115 (reviewed: O00115)

Alternative names: Acid DNase, Deoxyribonuclease II alpha, Lysosomal DNase II, R31240_2

All UniProt accessions (3): A0A8V8TNK3, K7ENE5, O00115

UniProt curated annotations — full annotation on UniProt →

Function. Hydrolyzes DNA under acidic conditions with a preference for double-stranded DNA. Plays a major role in the clearance of nucleic acids generated through apoptosis, hence preventing autoinflammation. Necessary for proper fetal development and for definitive erythropoiesis in fetal liver and bone marrow, where it degrades nuclear DNA expelled from erythroid precursor cells.

Subcellular location. Lysosome.

Tissue specificity. Expressed in monocytes/macrophages (at protein level).

Post-translational modifications. Glycosylated. Genetic variations that affect N-glycosylation sites reduce activity, but enzymatic deglycosylation has no effect.

Disease relevance. Autoinflammatory-pancytopenia syndrome (AIPCS) [MIM:619858] An autosomal recessive disorder characterized by severe anemia and thrombocytopenia apparent from early infancy, hepatosplenomegaly, and recurrent fevers associated with a hyperinflammatory state. Additional systemic features may include chronic diarrhea, proteinuria with renal disease, liver fibrosis with elevated liver enzymes, deforming arthropathy, and vasculitic skin lesions. Some patients may have motor delay or learning difficulties associated with subcortical white matter lesions on brain imaging. The disease is caused by variants affecting the gene represented in this entry. The genetic variation producing the missense variant p.G116A, associated with AIPCS, has been shown to predominantly affect splicing, leading to in-frame deletion of exon 4, encoding amino acids 116 to 171. The protein resulting from this aberrant splicing may be unstable.

Similarity. Belongs to the DNase II family.

Isoforms (2)

UniProt ID	Names	Canonical?
O00115-1	1	yes
O00115-2	2

RefSeq proteins (1): NP_001366* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004947	DNase_II	Family

Pfam: PF03265

Enzyme classification (BRENDA)

• EC 3.1.22.1 — deoxyribonuclease II (BRENDA: 30 organisms, 69 substrates, 60 inhibitors, 6 Km, 6 kcat entries)

Substrate kinetics (BRENDA)

1 substrates with measured Km, best-characterized 1. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
SUPERCOILED PLASMID DNA	—	6

UniProt features (31 total): mutagenesis site 13, sequence variant 6, glycosylation site 4, disulfide bond 3, signal peptide 1, chain 1, splice variant 1, active site 1, sequence conflict 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O00115-F1	91.52	0.84

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Hydrolases, Predicted intracellular proteins, Disease related genes, Potential drug targets, Human disease related genes, Primary immunodeficiency

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
295

Disulfide bonds (3)

Type	Positions
Disulfide bond	19–159, 267–347, 308–327

Glycosylation sites (4)

Type	Positions
N-linked (glcnac…) asparagine	86, 212, 266, 290

Mutagenesis-validated functional residues (13)

Position	Phenotype
19	loss of activity.
86	reduced n-glycosylation, complete loss of n-glycosylation; when associated with q-212; q-266 and q-290.
151	loss of activity.
159	loss of activity.
212	reduced n-glycosylation, complete loss of n-glycosylation; when associated with q-86; q-266 and q-290.
266	reduced n-glycosylation, complete loss of n-glycosylation; when associated with q-86; q-212 and q-290.
267	loss of activity.
290	reduced n-glycosylation, complete loss of n-glycosylation; when associated with q-86; q-212 and q-266.
295	loss of activity, but not of dna-binding.
299	no effect.
308	loss of activity.
327	loss of activity.
347	loss of activity.

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 4; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

4 pathways:

ID	Pathway	Evidence
R-HSA-432720	Lysosome Vesicle Biogenesis	curated
R-HSA-199991	Membrane Trafficking	—
R-HSA-5653656	Vesicle-mediated transport	—
R-HSA-199992	trans-Golgi Network Vesicle Budding	—

MSigDB gene sets: 0 (showing top):

GO Biological Process (5): apoptotic DNA fragmentation (GO:0006309), apoptotic cell clearance (GO:0043277), DNA metabolic process (GO:0006259), DNA catabolic process (GO:0006308), apoptotic process (GO:0006915)

GO Molecular Function (6): deoxyribonuclease II activity (GO:0004531), nuclease activity (GO:0004518), endonuclease activity (GO:0004519), DNA endonuclease activity (GO:0004520), protein binding (GO:0005515), hydrolase activity (GO:0016787)

GO Cellular Component (2): lysosome (GO:0005764), extracellular exosome (GO:0070062)

Reactome top-level categories

3 top-level categories:

Category	Pathways
trans-Golgi Network Vesicle Budding	1
Vesicle-mediated transport	1
Membrane Trafficking	1

GO top-level categories

18 GO namespaces:

Category	Terms
DNA nuclease activity	2
DNA catabolic process	1
apoptotic nuclear changes	1
phagocytosis	1
nucleic acid metabolic process	1
DNA metabolic process	1
nucleic acid catabolic process	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
DNA endonuclease activity, producing 3’-phosphomonoesters	1
catalytic activity, acting on a nucleic acid	1
nuclease activity	1
endonuclease activity	1
binding	1
catalytic activity	1
lytic vacuole	1
extracellular vesicle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 4 of 13 annotations. The rest are phylogenetic / computational / electronic (IEA).

4 experimentally-supported GO terms:

GO term	NS	Evidence
apoptotic cell clearance	BP	mutant phenotype
extracellular exosome	CC	high-throughput assay
lysosome	CC	direct assay
deoxyribonuclease II activity	MF	mutant phenotype

Protein interactions and networks

STRING

showing 15 of 803 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DNASE2	DFFB	O76075	841
DNASE2	DNASE1	P24855	778
DNASE2	DFFA	O00273	774
DNASE2	DNASE1L3	Q13609	649
DNASE2	IFNB1	P01574	579
DNASE2	DNASE1L2	Q92874	579
DNASE2	RNASEH2C	Q8TDP1	571
DNASE2	IFNA13	P01562	570
DNASE2	IFNA13	A0A087WWS6	550
DNASE2	CGAS	Q8N884	535
DNASE2	DNASE1L1	P49184	515
DNASE2	RNASEH2B	Q5TBB1	486
DNASE2	RNASEH2A	O75792	481
DNASE2	SKIC2	Q15477	470
DNASE2	TREX1	Q9NSU2	459

IntAct

Human interaction partners of DNASE2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

5 partners by confidence:

Partner	Interaction type	MIscore	Records
CANX	physical association	0.690	2
C1QL1	association	0.350	1
C1QTNF9B	association	0.350	1
RUVBL1	physical association	0.000	1
RUVBL2	physical association	0.000	1

BioGRID (26 interactions; top human partners by supporting records): CANX (Affinity Capture-MS; 2 records), APEX1 (Affinity Capture-RNA), DNAJB11 (Co-fractionation), DNASE2B (Negative Genetic), FBXO6 (Affinity Capture-MS), HNRNPH1 (Affinity Capture-RNA), OPA1 (Co-fractionation), RRM1 (Co-fractionation), RUVBL1 (Affinity Capture-MS), RUVBL2 (Affinity Capture-MS), SART3 (Affinity Capture-MS), SETD3 (Affinity Capture-MS), SUCLG2 (Affinity Capture-MS), TGOLN2 (Proximity Label-MS), TMEM192 (Affinity Capture-MS)

Disease & clinical

Genetic variants

Variant evidence for DNASE2: 201 ClinVar records (3 pathogenic / likely pathogenic); 4 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

201 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	0
Uncertain significance	93
Likely benign	87
Benign	6

Top pathogenic / likely-pathogenic (3)

Showing all 3 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1686899	NM_001375.3(DNASE2):c.347G>C (p.Gly116Ala)	Pathogenic	no assertion criteria provided	1
1686900	NM_001375.3(DNASE2):c.362A>T (p.Asp121Val)	Pathogenic	no assertion criteria provided	1
1686901	NM_001375.3(DNASE2):c.284A>G (p.Tyr95Cys)	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore DNASE2’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 41 predictions of 297):

Position(s)	Effect	Δscore	Sites
19:12878380–12878381	donor_loss	1.0000	5
19:12878580–12878581	acceptor_loss	1.0000	5
19:12878589	acceptor_gain	1.0000
19:12881288–12881289	donor_loss	1.0000	5
19:12876364–12876365	acceptor_loss	0.9900	6
19:12878580	acceptor_loss	0.9900
19:12880970–12880971	donor_loss	0.9900	5
19:12881153–12881154	acceptor_loss	0.9900	6
19:12881162	acceptor_gain	0.9900
19:12880881–12880882	acceptor_loss	0.9800	6

AlphaMissense

604 missense substitutions predicted likely pathogenic (of 2,356 scored), across 156 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D294	8	0.937	0.976
N313	8	0.865	0.966
D237	8	0.840	0.917
H113	8	0.796	0.903
H295	8	0.788	0.883
H130	8	0.779	0.883
F30	7	0.939	0.987
C327	7	0.925	0.966
F135	7	0.923	0.977
C159	7	0.923	0.960
C308	7	0.910	0.945
W298	7	0.897	0.977
C19	7	0.891	0.944
W61	7	0.884	0.979
D97	7	0.873	0.926
F337	7	0.872	0.940
W146	7	0.865	0.960
F234	7	0.852	0.959
F228	7	0.849	0.953
F289	7	0.846	0.964

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	0.000542

Disease associations

OMIM: gene MIM:126350 | disease phenotypes: MIM:619858

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
autoinflammatory-pancytopenia syndrome due to DNASE2 deficiency	Strong	Autosomal recessive	2

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (2 panels, 2 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

2 panels:

Panel	Rating
COVID-19 research	green
Primary immunodeficiency or monogenic inflammatory bowel disease	green

Mondo (1): autoinflammatory-pancytopenia syndrome due to DNASE2 deficiency (MONDO:0800132)

HPO phenotypes

24 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000093	Proteinuria
HP:0000793	Membranoproliferative glomerulonephritis
HP:0001270	Motor delay
HP:0001395	Hepatic fibrosis
HP:0001433	Hepatosplenomegaly
HP:0001508	Failure to thrive
HP:0001510	Growth delay
HP:0001876	Pancytopenia
HP:0001945	Fever
HP:0001954	Recurrent fever
HP:0002028	Chronic diarrhea
HP:0002194	Delayed gross motor development
HP:0002611	Cholestatic liver disease
HP:0003040	Arthropathy
HP:0003577	Congenital onset
HP:0003623	Neonatal onset
HP:0009125	Lipodystrophy
HP:0009710	Chilblains
HP:0012156	Hemophagocytosis
HP:0031693	Severe Epstein Barr virus infection
HP:0032252	Granuloma
HP:0100651	Type I diabetes mellitus
HP:4000055	Intestinal inflammation

GWAS associations

4 associations:

Study	Trait	p-value
GCST006011_58	Mean corpuscular volume	4e-32
GCST006804_68	Red cell distribution width	5e-10
GCST004628_88	Immature fraction of reticulocytes	6e-9
GCST002595_9	Clozapine-induced agranulocytosis	1e-6

EFO canonical traits (from GWAS)

2 canonical traits:

EFO ID	Trait name
EFO:0007986	reticulocyte count
EFO:0009188	Red cell distribution width

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL1250342 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

1 measured of 1 human assays (1 total across all organisms); most potent 1 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
(2R,5S,8S,11S,14S,17S,20S,23S,26S,29S,32S,35R)-8,17-bis((1H-indol-3-yl)methyl)-35-amino-20-(3-amino-3-oxopropyl)-14-benzyl-29-(3-guanidinopropyl)-11,23,26,32-tetraisobutyl-36-mercapto-2-(mercaptomethyl)-5-methyl-4,7,10,13,16,19,22,25,28,31,34-undecaoxo-3,6,9,12,15,18,21,24,27,30,33-undecaazahexatriacontan-1-oic acid	KI	200 nM

ChEMBL bioactivities

1 potent at pChembl≥5 of 1 total, top 1 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.70	Ki	200	nM	CHEMBL1240687

PubChem BioAssay actives

1 with measured affinity, of 1 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(2R)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-5-amino-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2R)-2-amino-3-sulfanylpropanoyl]amino]-4-methylpentanoyl]amino]-5-(diaminomethylideneamino)pentanoyl]amino]-4-methylpentanoyl]amino]-4-methylpentanoyl]amino]-5-oxopentanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]-3-phenylpropanoyl]amino]-4-methylpentanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]propanoyl]amino]-3-sulfanylpropanoic acid	507758: Binding affinity to Dnase 2	ki	0.2000	uM

CTD chemical–gene interactions

44 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression, increases expression	3
Cisplatin	affects expression, affects cotreatment, increases expression	3
Valproic Acid	affects expression, increases expression, increases methylation	3
sodium arsenite	increases expression	2
Tunicamycin	increases expression	2
bisphenol A	increases expression	1
arsenite	affects expression	1
cobaltous chloride	decreases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	increases expression, affects cotreatment	1
di-n-butylphosphoric acid	affects expression	1
yessotoxin	increases expression	1
entinostat	increases expression	1
pinostrobin	increases expression	1
ICG 001	increases expression	1
abrine	decreases expression	1
bisphenol S	increases expression	1
jinfukang	increases expression, affects cotreatment	1
(+)-JQ1 compound	decreases expression	1
PP242	decreases expression	1
bisphenol AF	increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Temozolomide	decreases expression	1
Decitabine	affects expression	1
Arsenic	affects methylation	1
Atrazine	increases expression	1
Cadmium	affects localization, decreases reaction	1
Coumestrol	affects cotreatment, increases expression	1
Doxorubicin	decreases expression	1
Ivermectin	decreases expression	1
Lead	affects expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1244651	Binding	Binding affinity to Dnase 2	Phage-encoded combinatorial chemical libraries based on bicyclic peptides. — *Nat Chem Biol*

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_E8F4	THP1-Dual KO-DNase2	Cancer cell line	Male
CVCL_F4JG	HyCyte THP-1 KO-hDNASE2	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 300 trials:

NCT	Phase	Status	Title
NCT00120887	Phase 4	COMPLETED	Lupus Atherosclerosis Prevention Study
NCT00125307	Phase 4	COMPLETED	Tacrolimus for the Treatment of Systemic Lupus Erythematosus With Membranous Nephritis
NCT00188188	Phase 4	UNKNOWN	Study of Endothelial Dysfunction in Systemic Lupus and Its Role in Heart Disease
NCT00371501	Phase 4	COMPLETED	Aspirin and Statins for Prevention of Atherosclerosis and Arterial Thromboembolism in Systemic Lupus Erythematosus
NCT00392093	Phase 4	COMPLETED	Effect of Hormone Replacement Therapy on Lupus Activity
NCT00413361	Phase 4	COMPLETED	The Reduction of Systemic Lupus Erythematosus Flares :Study PLUS
NCT00508898	Phase 4	WITHDRAWN	The Efficacy and Safety of Calcitriol for the Treatment of Lupus Nephritis and Persistent Proteinuria
NCT00668330	Phase 4	COMPLETED	Steroid Induced Osteoporosis in Patients With Systemic Lupus Erythematosus
NCT00739050	Phase 4	TERMINATED	Effect of Simvastatin on Endothelial Function in Premenopausal Women With Systemic Lupus Erythematosus (0733-271)(TERMINATED)
NCT00815282	Phase 4	COMPLETED	Immune Response After Human Papillomavirus Vaccination in Patients With Autoimmune Disease
NCT00828178	Phase 4	COMPLETED	Efficacy of Fish Oil in Lupus Patients
NCT00866229	Phase 4	UNKNOWN	Efficacy and Adverse Effect of Simvastatin Compare to Rosuvastatin in Systemic Lupus Erythematosus (SLE) Patients With Corticosteroid Therapy and High Low-Density Lipoprotein (LDL) Cholesterol Level
NCT00911521	Phase 4	COMPLETED	Immunogenicity and Safety of a Quadrivalent Human Papillomavirus (HPV) Vaccine in Patients With SLE: a Controlled Study
NCT01101802	Phase 4	COMPLETED	Mycophenolate Mofetil in Systemic Lupus Erythematosus (MISSILE)
NCT01112215	Phase 4	COMPLETED	Enteric-coated Mycophenolate Sodium Versus Azathioprine for the Extra-renal Lupus Manifestations
NCT01151644	Phase 4	UNKNOWN	Safety and Efficacy of Anti-Pandemic H1N1 Vaccination in Rheumatic Diseases
NCT01276782	Phase 4	WITHDRAWN	Levothyroxine in Pregnant SLE Patients
NCT01322308	Phase 4	COMPLETED	Effect of Pioglitazone on Endothelial Function in Premenopausal Women With Uncomplicated Systemic Lupus Erythematosus
NCT01359826	Phase 4	WITHDRAWN	The Effect of Milnacipran on Fatigue and Quality of Life in Lupus Patients
NCT01597492	Phase 4	COMPLETED	A Study to Evaluate the Effect of Belimumab on Vaccine Responses in Subjects With Systemic Lupus Erythematosus (SLE)
NCT01632241	Phase 4	COMPLETED	Efficacy and Safety of Belimumab in Black Race Patients With Systemic Lupus Erythematosus (SLE)
NCT01705977	Phase 4	COMPLETED	Belimumab Assessment of Safety in SLE
NCT01753401	Phase 4	COMPLETED	Acthar for the Treatment of Systemic Lupus Erythematosus (SLE) in Patients With a History of Persistently Active Disease
NCT02270970	Phase 4	UNKNOWN	Evaluation of Belimumab Impact on a BLyS Activity Signature Test in the Absence of Confounding Polypharmacy
NCT02477150	Phase 4	COMPLETED	Safety and Immunogenicity of a Zoster Vaccine in SLE
NCT02741960	Phase 4	COMPLETED	The Effect of Metformin on Reducing Lupus Flares
NCT02779153	Phase 4	WITHDRAWN	Acthar SLE (Systemic Lupus Erythematosus)
NCT02953821	Phase 4	COMPLETED	Acthar Gel for Active Systemic Lupus Erythematosus (SLE)
NCT03042260	Phase 4	UNKNOWN	Prophylactic Trimethoprim/Sulfamethoxazole to Prevent Severe Infections in Patients With Lupus Erythematous
NCT03098823	Phase 4	COMPLETED	A Crossover Study to Compare RAYOS to IR Prednisone to Improve Fatigue and Morning Symptoms for SLE
NCT03122431	Phase 4	COMPLETED	Relevance of Monitoring Blood and Salivar Levels of Drugs Used in Rheumatic Autoimmune Diseases
NCT03543839	Phase 4	RECRUITING	Trial of Belimumab in Early Lupus
NCT04447053	Phase 4	UNKNOWN	Sequential Belimumab and T-cell Based Therapy in SLE
NCT04515719	Phase 4	COMPLETED	Efficacy and Safety of Belimumab in SLE Patients
NCT04893161	Phase 4	UNKNOWN	A Model About the Response of Belimumab in SLE
NCT04908865	Phase 4	COMPLETED	Open-label Study of Belimumab Plus Standard Therapy in Chinese Pediatric Participants With Active Systemic Lupus Erythematosus (SLE)
NCT04956484	Phase 4	COMPLETED	Belimumab In Early Systemic Lupus Erythematosus
NCT05559671	Phase 4	RECRUITING	Safety of the Herpes Zoster Subunit Vaccine in Lupus
NCT05666336	Phase 4	UNKNOWN	Multi-omics Studies on the Efficacy of Telitacicept in Chinese SLE Patients
NCT05748925	Phase 4	COMPLETED	Cardio Renal Effects of SGLT2 Inhibitors Among Lupus Nephritis Patients
NCT05828147	Phase 4	UNKNOWN	Anti-CD20 Antibodies for Treatment of SLE-PAH
NCT05879419	Phase 4	ACTIVE_NOT_RECRUITING	Recombinant Herpes Zoster Vaccine in Patients With Autoimmune Rheumatic Diseases
NCT05899907	Phase 4	UNKNOWN	Efficacy and Safety of Telitacicept in Early SLE
NCT05916781	Phase 4	UNKNOWN	Effectiveness of Mycophenolate Mofetil Combined With Tacrolimus for Steroid Tapering in Systemic Lupus Erythematosus
NCT06411249	Phase 4	ACTIVE_NOT_RECRUITING	A Study Describing the Efficacy and Safety of Belimumab Administered in Adult Participants With Early Systemic Lupus Erythematosus (SLE)
NCT06594068	Phase 4	RECRUITING	Prospective Registry Investigating Maternal, Infant, and Lactation Outcomes in Anifrolumab Users
NCT06677801	Phase 4	ACTIVE_NOT_RECRUITING	Immune Cell Subsets in SLE Patients Treated with Telitacicept
NCT06763783	Phase 4	ENROLLING_BY_INVITATION	Vaccination Against Herpes Zoster in Patients With Inflammatory Rheumatic Diseases
NCT06875960	Phase 4	RECRUITING	A Study to Continue the Administration of Deucravacitinib in Participants With Systemic Lupus Erythematosus (SLE) or Discoid and/or Subacute Cutaneous Lupus Erythematosus (DLE/SCLE) Who Have Completed Study IM011074 or Study IM011132
NCT07077486	Phase 4	RECRUITING	Effects of Telitacicept vs Cyclophosphamide on Lupus Related Interstitial Lung Disease
NCT07087912	Phase 4	RECRUITING	Safety and Immunogenicity of the Live Attenuated Tetravalent Butantan-Dengue Vaccine in Autoimmune Rheumatic Diseases
NCT07381465	Phase 4	ACTIVE_NOT_RECRUITING	Efficacy and Safety of IL-1 Inhibitors in Mild to Moderate Systemic Lupus Erythematosus
NCT07611747	Phase 4	RECRUITING	Carotid Ultrasound-Based Strategy for Primary Prevention of Cardiovascular Events in Inflammatory Rheumatic Disease (PREVENER)
NCT07760480	Phase 4	RECRUITING	Assessing Residual Inflammation and Macrophage Presence in Lupus Nephritis After 3 Months of Intensified Treatment With Prednisolone, Mycofenolate Mofetil and Voclosporin as Compared to Mycofenolate Mofetil and Prednisolone
NCT00000419	Phase 3	TERMINATED	Safety of Estrogens in Lupus: Hormone Replacement Therapy
NCT00000420	Phase 3	COMPLETED	Safety of Estrogens in Lupus: Birth Control Pills
NCT00004662	Phase 3	COMPLETED	Phase III Randomized, Double-Blind, Placebo-Controlled Study of Dehydroepiandrosterone in Women With Active Systemic Lupus Erythematosus
NCT00005778	Phase 3	COMPLETED	High-Dose Intravenous (IV) Cyclophosphamide Versus Monthly IV Cyclophosphamide
NCT00025818	Phase 3	COMPLETED	Six Month Clinical Research Study for Patients With Moderate or Severe Dry Eye Syndrome
NCT00035308	Phase 3	COMPLETED	Safety and Efficacy Study of LJP 394 (Abetimus Sodium) to Treat Lupus Kidney Disease