DOC2B

Summary

DOC2B (double C2 domain beta, HGNC:2986) is a protein-coding gene on chromosome 17p13.3, encoding Double C2-like domain-containing protein beta (Q14184). Calcium sensor which positively regulates SNARE-dependent fusion of vesicles with membranes.

There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2B is expressed ubiquitously and is suggested to be involved in Ca(2+)-dependent intracellular vesicle trafficking in various types of cells.

Source: NCBI Gene 8447 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 67 total
• GTEx eGene: eQTL in 34 tissues, sQTL in 7 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.37 (unconstrained)
• MANE Select transcript: NM_003585
• Notable: 67 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2986
Approved symbol	DOC2B
Name	double C2 domain beta
Location	17p13.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000272636
Ensembl biotype	protein_coding
OMIM	604568
Entrez	8447

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 5 protein_coding, 1 retained_intron, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000613549

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 3: 2

ENST00000613549, ENST00000343572, ENST00000609727, ENST00000697390, ENST00000930528, ENST00000952977, ENST00001142539

RefSeq mRNA: 1 — MANE Select: NM_003585 NM_003585

CCDS: CCDS73934

Canonical transcript exons

ENST00000496357 — 0 exons

Expression profiles

Bgee: expression breadth ubiquitous, 131 present calls, max score 93.35.

FANTOM5 (CAGE): breadth broad, TPM avg 6.6634 / max 475.9939, expressed in 697 samples.

Highest expression (Bgee): hemisphere of cerebellum, cerebellum, cerebellar cortex, cerebellar hemisphere, cortical plate.

Genetic regulation across tissues (GTEx eQTL / sQTL)

DOC2B is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 34 tissues and its splicing (sQTL) in 7 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 41 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Whole Blood	eqtl	1.6e-45	+0.50	17:184074:T:C
Nerve Tibial	eqtl	3.2e-35	-0.58	17:253493:A:G
Skin Not Sun Exposed Suprapubic	eqtl	1.6e-23	-0.34	17:185933:C:G
Adipose Subcutaneous	eqtl	3.8e-22	-0.44	17:253493:A:G
Skin Sun Exposed Lower leg	eqtl	7.2e-21	-0.36	17:184415:A:G
Brain Cerebellar Hemisphere	sqtl	4.3e-16	+0.83	17:164217:G:C
Thyroid	eqtl	1.6e-15	+0.27	17:198893:G:A
Pituitary	eqtl	6.6e-14	+0.67	17:336021:CAGGGCGACAGGGAGGAGATGGGGTTTAGAGGAGGGAAAAGAAGCTGGGACAAACATAAAAGA:C
Brain Cerebellar Hemisphere	eqtl	5.0e-13	+0.43	17:280815:C:G
Testis	eqtl	9.4e-12	-0.59	17:193378:T:C
Artery Tibial	eqtl	2.0e-11	-0.24	17:253493:A:G
Esophagus Mucosa	eqtl	1.0e-10	+0.22	17:185723:A:C
Muscle Skeletal	eqtl	1.2e-10	-0.31	17:253493:A:G
Adipose Visceral Omentum	eqtl	1.6e-10	+0.29	17:177477:G:C
Adipose Subcutaneous	sqtl	1.9e-10	+0.52	17:147688:C:T
Brain Cerebellum	sqtl	2.7e-10	+0.79	17:161952:A:G
Brain Cerebellum	eqtl	7.0e-09	+0.32	17:280815:C:G
Lung	eqtl	1.9e-08	+0.29	17:199584:T:C
Testis	sqtl	5.2e-08	+0.57	17:189040:G:C
Breast Mammary Tissue	eqtl	7.4e-08	-0.30	17:260788:A:G

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
163593	5.0674	540
163592	1.2034	346
163591	0.2080	102
163590	0.1845	121

Top tissues by expression

showing 100 of 132 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	93.35	gold quality
cerebellum	UBERON:0002037	92.87	gold quality
cerebellar cortex	UBERON:0002129	92.85	gold quality
cerebellar hemisphere	UBERON:0002245	92.81	gold quality
cortical plate	UBERON:0005343	91.70	gold quality
nucleus accumbens	UBERON:0001882	87.85	gold quality
Ammon’s horn	UBERON:0001954	87.56	gold quality
anterior cingulate cortex	UBERON:0009835	86.83	gold quality
putamen	UBERON:0001874	85.79	gold quality
right frontal lobe	UBERON:0002810	84.94	gold quality
subcutaneous adipose tissue	UBERON:0002190	84.78	gold quality
superior frontal gyrus	UBERON:0002661	84.60	gold quality
adipose tissue	UBERON:0001013	84.15	gold quality
cerebral cortex	UBERON:0000956	84.04	gold quality
brain	UBERON:0000955	83.99	gold quality
frontal cortex	UBERON:0001870	83.68	gold quality
omental fat pad	UBERON:0010414	83.48	gold quality
caudate nucleus	UBERON:0001873	83.07	gold quality
temporal lobe	UBERON:0001871	82.94	gold quality
hypothalamus	UBERON:0001898	82.92	gold quality
amygdala	UBERON:0001876	82.88	gold quality
prefrontal cortex	UBERON:0000451	82.78	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	82.63	gold quality
Brodmann (1909) area 9	UBERON:0013540	80.91	gold quality
esophagus mucosa	UBERON:0002469	79.96	gold quality
thoracic mammary gland	UBERON:0005200	79.57	gold quality
apex of heart	UBERON:0002098	78.52	gold quality
body of pancreas	UBERON:0001150	77.66	gold quality
mucosa of stomach	UBERON:0001199	77.45	gold quality
esophagus	UBERON:0001043	77.37	gold quality
bone marrow	UBERON:0002371	77.21	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	77.00	gold quality
left uterine tube	UBERON:0001303	76.60	gold quality
myometrium	UBERON:0001296	76.01	gold quality
metanephros cortex	UBERON:0010533	75.80	gold quality
substantia nigra	UBERON:0002038	75.16	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	74.85	gold quality
pituitary gland	UBERON:0000007	74.74	gold quality
lower esophagus muscularis layer	UBERON:0035833	74.70	gold quality
lower esophagus	UBERON:0013473	74.66	gold quality
lower esophagus mucosa	UBERON:0035834	74.51	gold quality
pancreas	UBERON:0001264	74.13	gold quality
vermiform appendix	UBERON:0001154	74.01	gold quality
ectocervix	UBERON:0012249	73.77	gold quality
adenohypophysis	UBERON:0002196	73.70	gold quality
kidney	UBERON:0002113	73.51	gold quality
adult mammalian kidney	UBERON:0000082	73.41	gold quality
tibial nerve	UBERON:0001323	73.35	gold quality
smooth muscle tissue	UBERON:0001135	73.26	gold quality
hindlimb stylopod muscle	UBERON:0004252	73.07	gold quality
vagina	UBERON:0000996	73.06	gold quality
muscle layer of sigmoid colon	UBERON:0035805	72.99	gold quality
bone marrow cell	CL:0002092	72.95	gold quality
sural nerve	UBERON:0015488	72.92	gold quality
lymph node	UBERON:0000029	72.91	gold quality
uterine cervix	UBERON:0000002	72.86	gold quality
skin of abdomen	UBERON:0001416	72.67	gold quality
body of uterus	UBERON:0009853	72.63	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	72.55	gold quality
fallopian tube	UBERON:0003889	72.43	gold quality
zone of skin	UBERON:0000014	72.38	gold quality
skin of leg	UBERON:0001511	72.37	gold quality
endocervix	UBERON:0000458	72.15	gold quality
gall bladder	UBERON:0002110	72.05	gold quality
heart left ventricle	UBERON:0002084	71.94	gold quality
placenta	UBERON:0001987	71.88	gold quality
multicellular organism	UBERON:0000468	71.73	gold quality
urinary bladder	UBERON:0001255	71.55	gold quality
gastrocnemius	UBERON:0001388	71.53	gold quality
cortex of kidney	UBERON:0001225	71.44	gold quality
tonsil	UBERON:0002372	71.25	gold quality
left coronary artery	UBERON:0001626	71.19	gold quality
muscle of leg	UBERON:0001383	71.04	gold quality
adrenal gland	UBERON:0002369	70.88	gold quality
heart	UBERON:0000948	70.58	gold quality
left adrenal gland cortex	UBERON:0035825	70.52	gold quality
colon	UBERON:0001155	70.21	gold quality
left adrenal gland	UBERON:0001234	70.21	gold quality
upper lobe of left lung	UBERON:0008952	70.17	gold quality
small intestine Peyer’s patch	UBERON:0003454	69.95	gold quality
intestine	UBERON:0000160	69.80	gold quality
body of stomach	UBERON:0001161	69.77	gold quality
small intestine	UBERON:0002108	69.77	gold quality
right coronary artery	UBERON:0001625	69.64	gold quality
muscle tissue	UBERON:0002385	69.52	gold quality
fundus of stomach	UBERON:0001160	69.47	gold quality
stomach	UBERON:0000945	69.38	gold quality
right adrenal gland	UBERON:0001233	69.17	gold quality
right atrium auricular region	UBERON:0006631	68.85	gold quality
transverse colon	UBERON:0001157	68.68	gold quality
skeletal muscle tissue	UBERON:0001134	68.40	gold quality
spleen	UBERON:0002106	68.18	gold quality
lung	UBERON:0002048	68.15	gold quality
primary visual cortex	UBERON:0002436	68.12	gold quality
right lobe of thyroid gland	UBERON:0001119	68.01	gold quality
prostate gland	UBERON:0002367	67.72	gold quality
left lobe of thyroid gland	UBERON:0001120	67.57	gold quality
thyroid gland	UBERON:0002046	67.45	gold quality
right lung	UBERON:0002167	67.42	gold quality
right adrenal gland cortex	UBERON:0035827	67.04	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.34

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Putamen	tissue	71.0
Hippocampus	tissue	65.4	low
Basal ganglia	tissue	62.1	low
Caudate putamen	tissue	55.9
Cerebellum	tissue	41.4	not detected
Retina	tissue	39.0
Locus coeruleus	tissue	34.0
Ventral forebrain	tissue	33.9
Nucleus accumbens	tissue	33.3
Postcentral gyrus	tissue	20.1
Hippocampal formation	tissue	16.7
Septum	tissue	16.5
Amygdala	tissue	14.5
Choroid plexus	tissue	12.9
Hypothalamus	tissue	12.1
Thalamus	tissue	10.4
Cerebral cortex	tissue	9.6	medium
Insular cortex	tissue	9.6
Frontal cortex	tissue	9.5
Pons	tissue	9.2
Medulla oblongata	tissue	8.9
Superior colliculi	tissue	8.9
Midbrain	tissue	8.4
Periaqueductal gray	tissue	8.3
Spinal cord	tissue	8.2
Prefrontal cortex	tissue	7.7
Temporal cortex	tissue	7.4
Substantia nigra	tissue	7.0
Motor cortex	tissue	6.6
Pituitary gland	tissue	6.4
Retrosplenial and cingulate cortex	tissue	6.0
Bone marrow	tissue	5.8	not detected
Entorhinal cortex	tissue	5.5
Somatosensory cortex	tissue	5.2
Adipose tissue	tissue	5.1	not detected
Retrosplenial cortex	tissue	5.1
Vagina	tissue	4.9	medium
Occipital cortex	tissue	4.7
Adrenal gland	tissue	4.3	low
Corpus callosum	tissue	3.5
Appendix	tissue	2.9	medium
Olfactory bulb	tissue	2.4
Tonsil	tissue	2.3	not detected
Spleen	tissue	1.6	not detected
Fallopian tube	tissue	1.6	medium
Smooth muscle	tissue	1.4	not detected
Endometrium 1	tissue	1.4	medium
Small intestine	tissue	1.4	medium
Kidney	tissue	1.4	high
Esophagus	tissue	1.3	low
Placenta	tissue	1.3	high
Lung	tissue	1.3	not detected
Lymph node	tissue	1.2	not detected
Stomach 1	tissue	1.0	not detected
Rectum	tissue	1.0	not detected
Prostate	tissue	1.0	low
Colon	tissue	0.8	medium
Thymus	tissue	0.8
Heart muscle	tissue	0.7	not detected
Skeletal muscle	tissue	0.7	medium

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Hippocampus, CA1 (63.8), Posterior cingulate cortex (61.5), Hippocampus, CA3 (59.0), Vermis (56.2), Flocculonodular lobe (55.6).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting DOC2B by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

19 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-1915-3P	99.58	66.79	1988
HSA-MIR-6833-5P	99.50	68.93	1161
HSA-MIR-6722-3P	99.45	67.62	1919
HSA-MIR-6744-3P	99.22	64.41	972
HSA-MIR-6510-5P	99.14	66.59	1081
HSA-MIR-4757-5P	99.12	64.51	981
HSA-MIR-1909-3P	99.03	66.56	1662
HSA-MIR-7113-3P	98.75	65.71	1120
HSA-MIR-5589-5P	98.34	64.82	1148
HSA-MIR-3665	97.73	65.08	975
HSA-MIR-296-5P	97.61	64.02	851
HSA-MIR-1226-5P	96.50	65.28	643
HSA-MIR-635	96.00	65.54	687
HSA-MIR-6774-5P	95.94	65.18	722
HSA-MIR-1268A	87.06	61.46	145
HSA-MIR-1268B	87.06	61.46	145

Functional genomics

gnomAD constraint: pLI 1.46e-06, LOEUF 1.37, missense Z -1.34 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000613549 — one region, missense o/e 0.91.

Literature-anchored findings (GeneRIF, showing 5)

• Study analyzed Doc2alpha and Doc2beta and found that Doc2 responds to changes in [Ca2+], with markedly slower kinetics as compared to the cytosolic domain of syt I (syt), and operates on a timescale consistent with asynchronous neurotransmitter release. (PMID:22036572)
• promoter hypermethylation and silencing of the DOC2B gene is an early and frequent event during cervical carcinogenesis and whose reduced expression due to DNA promoter methylation may lead to selective cervical tumor growth (PMID:24570007)
• Here the authors report that analogous ring-like oligomers assemble from the C2AB domains of other Syt isoforms (Syt2, Syt7, Syt9) as well as related C2 domain containing protein, Doc2B and extended Synaptotagmins (E-Syts). (PMID:27434670)
• Reduction of DOC2B is an early feature of T1 diabetes (T1D), and DOC2B abundance may serve as a valuable in vivo indicator of beta-cell mass and an early biomarker of T1D. (PMID:29506054)
• Double C-2 like domain beta (DOC2B) induces calcium dependent oxidative stress to promote lipotoxicity and mitochondrial dysfunction for its tumor suppressive function. (PMID:36913987)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	doc2b	ENSDARG00000088293
mus_musculus	Doc2b	ENSMUSG00000020848
rattus_norvegicus	Doc2b	ENSRNOG00000060054

Paralogs (31): SYT7 (ENSG00000011347), SYT13 (ENSG00000019505), SYT1 (ENSG00000067715), RPH3A (ENSG00000089169), SYTL4 (ENSG00000102362), SYT17 (ENSG00000103528), SYT10 (ENSG00000110975), SYT5 (ENSG00000129990), SYT11 (ENSG00000132718), SYT4 (ENSG00000132872), SYT6 (ENSG00000134207), SYTL2 (ENSG00000137501), SYT16 (ENSG00000139973), SYTL1 (ENSG00000142765), SYT14 (ENSG00000143469), SYT2 (ENSG00000143858), SYTL5 (ENSG00000147041), SYT8 (ENSG00000149043), DOC2A (ENSG00000149927), SYTL3 (ENSG00000164674), TC2N (ENSG00000165929), SYT9 (ENSG00000170743), SYT12 (ENSG00000173227), RPH3AL (ENSG00000181031), C2CD4C (ENSG00000183186), C2CD4A (ENSG00000198535), SYT15 (ENSG00000204176), C2CD4B (ENSG00000205502), SYT3 (ENSG00000213023), C2CD4D (ENSG00000225556), SYT15B (ENSG00000277758)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1100497) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 2 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal CNS synaptic transmission	1
abnormal inhibitory postsynaptic currents	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	P48018	99.8%	Diamond
Pongo abelii	Q5R4J5	99.8%	Diamond
Macaca fascicularis	Q60HC0	99.8%	Diamond
Anser cygnoides	A0A075F932	98.8%	Diamond
Gallus gallus	P47191	98.8%	Diamond
Xenopus laevis	Q5FWL4	94.4%	Diamond
Xenopus tropicalis	A4IJ05	88.2%	Diamond
Diplobatis ommata	P24505	85.5%	Diamond
Arabidopsis thaliana	Q9LP65	85.0%	Diamond
Drosophila melanogaster	P21521	75.2%	Diamond
Caenorhabditis elegans	P34693	73.1%	Diamond
Aplysia californica	P41823	70.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
RPH3AL-AS1	ncRNA	100506388
SCGB1C2	protein-coding	653486
RPH3AL	protein-coding	9501
LINC02887	ncRNA	105377826
LINC02091	ncRNA	100506371

Protein

Protein identifiers

Double C2-like domain-containing protein beta — Q14184 (reviewed: Q14184)

All UniProt accessions (2): A0A8V8TML1, Q14184

UniProt curated annotations — full annotation on UniProt →

Function. Calcium sensor which positively regulates SNARE-dependent fusion of vesicles with membranes. Binds phospholipids in a calcium-dependent manner and may act at the priming stage of fusion by modifying membrane curvature to stimulate fusion. Involved in calcium-triggered exocytosis in chromaffin cells and calcium-dependent spontaneous release of neurotransmitter in absence of action potentials in neuronal cells. Involved both in glucose-stimulated insulin secretion in pancreatic cells and insulin-dependent GLUT4 transport to the plasma membrane in adipocytes.

Subunit / interactions. Interacts with the SNARE (soluble N-ethylmaleimide-sensitive factor attached protein receptor) complex composed of SNAP25, STX1A and VAMP2; the interaction is calcium-dependent and competitive with SYT1. Interacts with STX4; the interaction is calcium-dependent, increased by insulin and glucose, and mediates vesicle fusion with plasma membrane in pancreatic cells and adipocytes. Interacts with STXBP3; the interaction is direct, occurs at the cell membrane and regulates glucose-stimulated insulin secretion. May interact with UNC13A; the interaction mediates targeting to the plasma membrane. Interacts with cytoplasmic dynein light chain DYNLT1.

Subcellular location. Cytoplasm. Cytoplasmic granule. Cell membrane.

Tissue specificity. Widely expressed with highest levels in brain and kidney. Expressed in pancreatic islet cells (at protein level).

Domain organisation. C2 domain 1 is involved in binding calcium and phospholipids. C2 domain 2 may also play a role in the calcium-dependent targeting to membranes.

RefSeq proteins (1): NP_003576* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000008	C2_dom	Domain
IPR001565	Synaptotagmin	Domain
IPR014638	Doc2	Family
IPR035892	C2_domain_sf	Homologous_superfamily
IPR043566	Rabphilin/DOC2/Noc2	Family
IPR047022	Rabphilin_Doc2_C2A	Domain

Pfam: PF00168

UniProt features (25 total): binding site 12, region of interest 4, compositionally biased region 3, domain 2, chain 1, modified residue 1, sequence variant 1, sequence conflict 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q14184-F1	79.21	0.61

Human Protein Atlas

Protein class: Predicted intracellular proteins

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (12)

Position	Role
157	Ca(2+)
163	Ca(2+)
218	Ca(2+)
220	Ca(2+)
297	Ca(2+)
303	Ca(2+)
357	Ca(2+)
359	Ca(2+)
365	Ca(2+)

Post-translational modifications (1)

Type	Positions
Phosphoserine	411

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 150 (showing top): RNGTGGGC_UNKNOWN, GOBP_REGULATION_OF_VESICLE_FUSION, GOBP_POSITIVE_REGULATION_OF_CALCIUM_ION_DEPENDENT_EXOCYTOSIS, PEREZ_TP63_TARGETS, GOBP_VESICLE_ORGANIZATION, GCANCTGNY_MYOD_Q6, GOBP_INSULIN_SECRETION, GOBP_MEMBRANE_FUSION, GOBP_POSITIVE_REGULATION_OF_PROTEIN_LOCALIZATION, GOBP_REGULATION_OF_EXOCYTOSIS, GOBP_REGULATION_OF_HORMONE_LEVELS, GOBP_NEUROTRANSMITTER_TRANSPORT, GOBP_HORMONE_TRANSPORT, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_POSITIVE_REGULATION_OF_ORGANELLE_ORGANIZATION

GO Biological Process (7): intracellular protein localization (GO:0008104), positive regulation of vesicle fusion (GO:0031340), positive regulation of insulin secretion (GO:0032024), positive regulation of calcium ion-dependent exocytosis (GO:0045956), calcium ion-regulated exocytosis of neurotransmitter (GO:0048791), calcium-dependent activation of synaptic vesicle fusion (GO:0099502), chemical synaptic transmission (GO:0007268)

GO Molecular Function (4): calcium ion binding (GO:0005509), calcium-dependent phospholipid binding (GO:0005544), syntaxin binding (GO:0019905), metal ion binding (GO:0046872)

GO Cellular Component (6): cytoplasm (GO:0005737), plasma membrane (GO:0005886), synapse (GO:0045202), presynapse (GO:0098793), membrane (GO:0016020), SNARE complex (GO:0031201)

GO top-level categories

27 GO namespaces:

Category	Terms
cellular anatomical structure	3
calcium-ion regulated exocytosis	2
synaptic vesicle exocytosis	2
macromolecule localization	1
vesicle fusion	1
positive regulation of organelle organization	1
regulation of vesicle fusion	1
positive regulation of transport	1
insulin secretion	1
positive regulation of protein secretion	1
regulation of insulin secretion	1
positive regulation of peptide hormone secretion	1
regulation of calcium ion-dependent exocytosis	1
positive regulation of regulated secretory pathway	1
positive regulation of synaptic vesicle fusion to presynaptic active zone membrane	1
anterograde trans-synaptic signaling	1
metal ion binding	1
phospholipid binding	1
SNARE binding	1
cation binding	1
intracellular anatomical structure	1
membrane	1
cell periphery	1
cell junction	1
synapse	1
cytoplasm	1
membrane protein complex	1

Protein interactions and networks

STRING

showing 15 of 670 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DOC2B	UNC13B	O14795	622
DOC2B	STX4	Q12846	582
DOC2B	STXBP3	O00186	570
DOC2B	VAMP2	P19065	548
DOC2B	UNC13A	Q9UPW8	503
DOC2B	STXBP1	P61764	459
DOC2B	STX1A	Q16623	454
DOC2B	VSTM2B	A6NLU5	446
DOC2B	VTI1A	Q96AJ9	439
DOC2B	SNAP23	O00161	421
DOC2B	STXBP2	Q15833	378
DOC2B	PPFIA3	O75145	370
DOC2B	RAB13	P51153	370
DOC2B	RPH3AL	Q9UNE2	369
DOC2B	GEMIN4	P57678	365

IntAct

Human interaction partners of DOC2B in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

2 partners by confidence:

Partner	Interaction type	MIscore	Records
DOC2A	association	0.530	2
POTEF	association	0.350	1

BioGRID (9 interactions; top human partners by supporting records): DOC2A (Affinity Capture-MS; 3 records), RPH3A (Affinity Capture-MS; 2 records), CHRNA3 (Affinity Capture-MS), POTEF (Affinity Capture-MS), RBM8A (Affinity Capture-MS), UNC13B (Affinity Capture-MS)

Disease & clinical

Genetic variants

Variant evidence for DOC2B: 67 ClinVar records (0 pathogenic / likely pathogenic).

ClinVar

67 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	59
Likely benign	4
Benign	1

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 47 predictions of 1,140):

Position(s)	Effect	Δscore	Sites
17:148171–148172	donor_loss	1.0000	4
17:148270–148271	acceptor_loss	1.0000	6
17:156218–156219	donor_loss	1.0000	3
17:156378–156379	acceptor_loss	1.0000	6
17:162079–162080	donor_loss	1.0000	4
17:162191–162192	acceptor_loss	1.0000	6
17:164128–164129	donor_loss	1.0000	5
17:164205–164206	acceptor_loss	1.0000	6
17:147578–147579	acceptor_loss	0.9900	6
17:148172	donor_loss	0.9900

HPA cancer prognostics

RNA cancer specificity: Cancer enhanced (Ovary Serous Cystadenocarcinoma, Stomach Adenocarcinoma)

Disease associations

OMIM: gene MIM:604568 | disease phenotypes:

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

24 total (human), top 24 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, increases methylation	2
sotorasib	affects cotreatment, decreases expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
benzo(e)pyrene	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	decreases reaction, increases expression	1
pinostrobin	increases phosphorylation	1
nutlin 3	affects cotreatment, increases expression	1
trametinib	affects cotreatment, decreases expression	1
(+)-JQ1 compound	decreases expression	1
NVP-BKM120	affects cotreatment, decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Copper	affects cotreatment, decreases expression	1
Dactinomycin	affects cotreatment, increases expression	1
Diethylhexyl Phthalate	decreases expression	1
Lead	affects expression	1
Lipopolysaccharides	increases expression, decreases reaction	1
Malathion	decreases expression	1
Methapyrilene	increases methylation	1
Oxygen	increases expression	1
Rotenone	increases expression	1
Tetrachlorodibenzodioxin	decreases expression	1
Triclosan	increases expression	1
1-Methyl-4-phenylpyridinium	increases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 75 trials:

NCT	Phase	Status	Title
NCT00417066	Phase 4	COMPLETED	Flexible GnRH Antagonist vs Flare up GnRH Agonist Protocol in Poor Responders
NCT00732693	Phase 4	COMPLETED	Evaluation of Physiologic and Standard Sex Steroid Replacement Regimens in Women With Premature Ovarian Failure
NCT00837616	Phase 4	COMPLETED	Estrogen Dosing in Turner Syndrome: Pharmacology and Metabolism
NCT01853501	Phase 4	UNKNOWN	Effects of ADSC Therapy in Women With POF
NCT02783937	Phase 4	COMPLETED	Filgrastim for Premature Ovarian Insufficiency
NCT03535480	Phase 4	UNKNOWN	Autologous Bone Marrow Stem Cell Ovarian Transplantation to Restore Ovarian Function in Premature Ovarian Failure
NCT00140998	Phase 3	COMPLETED	Estrogen Treatment (Oral vs. Patches) in Turner Syndrome
NCT00001951	Phase 2	COMPLETED	Hormone Replacement in Young Women With Premature Ovarian Failure
NCT00370019	Phase 2	WITHDRAWN	Effects of an Estrogen Replacement Therapy Skin Patch on Ovulation in Women With Premature Ovarian Failure
NCT00429494	Phase 2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03816852	Phase 2	SUSPENDED	The Safety and Efficiency Study of Mesenchymal Stem Cell (19#iSCLife®-POI) in Premature Ovarian Insufficiency
NCT04536467	Phase 2	UNKNOWN	Prevention of Chemotherapy-Induced Ovarian Failure With Goserelin in Premenopausal Lymphoma Patients
NCT06117982	Phase 2	COMPLETED	The Impact of Granulocyte Colony Stimulating Factor on Premature Ovarian Insufficiency
NCT02912104	Phase 1	COMPLETED	A Therapeutic Trial of Human Amniotic Epithelial Cells Transplantation for Primary Ovarian Failure
NCT03178695	Phase 1	COMPLETED	Inovium Ovarian Rejuvenation Trials
NCT04815213	Phase 1	ACTIVE_NOT_RECRUITING	The Use of Expandeded Mesenchymal Stromal Cells (MSC) in Premature Ovarian Failure (POF) in Adult Humans
NCT05138367	Phase 1	COMPLETED	Effects of UCA-PSCs in Women With POF
NCT06132542	Phase 1	UNKNOWN	Autologous ADMSC Transplantation in Patients With POI
NCT00948857	Phase 2/3	TERMINATED	Dehydroepiandrosterone (DHEA) Treatment and Premature Ovarian Failure (POF)
NCT04031456	Phase 2/3	RECRUITING	Autologous PRP Infusion May Restore Ovarian Function and May Promote Folliculogenesis in POI Patients
NCT02043743	Phase 1/2	UNKNOWN	Autologous Stem Cells Transplantation in Patients With Idiopathic and Drug Induced Premature Ovarian Failure
NCT02062931	Phase 1/2	UNKNOWN	Autologous Mesenchymal Stem Cells Transplantation In Women With Premature Ovarian Failure
NCT02151890	Phase 1/2	COMPLETED	Pregnancy After Stem Cell Transplantation in Premature Ovarian Failure
NCT02372474	Phase 1/2	COMPLETED	It is a Real The First Baby Of Autologous Stem Cell Therapy in Premature Ovarian Failure
NCT02603744	Phase 1/2	UNKNOWN	Autologous Adipose Derived Mesenchymal Stromal Cells Transplantation in Women With Premature Ovarian Failure (POF)
NCT02644447	Phase 1/2	COMPLETED	Transplantation of HUC-MSCs With Injectable Collagen Scaffold for POF
NCT03069209	Phase 1/2	UNKNOWN	Autologous Bone Marrow-Derived Stem Cell Transplantation in Patients With Premature Ovarian Failure (POF)
NCT03985462	Phase 1/2	WITHDRAWN	Very Small Embryonic-like Stem Cells for Ovary
NCT04009473	Phase 1/2	UNKNOWN	Stem Cell Therapy and Growth Factor Ovarian in Vitro Activation
NCT04071574	Phase 1/2	COMPLETED	Comparative Study on the Efficacy of Ovarian Stimulation Protocols on the Success Rate of ICSI in Female Infertility
NCT04922398	Phase 1/2	UNKNOWN	Ovarian Injection of PRP (Platelet -Rich Plasma) Vs Normal Saline in Premature Ovarian Insufficiency
NCT05462379	Phase 1/2	ACTIVE_NOT_RECRUITING	Autologous Heterotopic Fresh Ovarian Graft in Woman With LACC Eligible for Pelvic Radiotherapy Treatment.
NCT06202547	Phase 1/2	COMPLETED	Intra-ovarian Injection of MSC-EVs in Idiopathic Premature Ovarian Failure
NCT01129947	Early Phase 1	WITHDRAWN	The Use of DHEA in Women With Premature Ovarian Failure
NCT05522634	Early Phase 1	UNKNOWN	A Clinical Study of Chinese Herbal Compound TJAOA101 in the Treatment of Premature Ovarian Insufficiency
NCT07308327	Early Phase 1	ACTIVE_NOT_RECRUITING	The Influence of Gut Microbiota on Ovarian Function: A Single-center, Randomized,Double Blind, Parallel-controlled, Exploratory Clinical Trial
NCT00001275	Not specified	COMPLETED	Ovarian Follicle Function in Patients With Primary Ovarian Failure
NCT00001306	Not specified	COMPLETED	Steroid Therapy in Autoimmune Premature Ovarian Failure
NCT00006156	Not specified	COMPLETED	Feasibility Study for Development of an Early Test for Ovarian Failure
NCT00119925	Not specified	UNKNOWN	‘SPRING’-Study: Subfertility Guidelines: Patient Related Implementation in the Netherlands Among Gynaecologists
NCT00295087	Not specified	COMPLETED	X-Chromosome Inactivation Status and Premature Ovarian Failure
NCT00417157	Not specified	COMPLETED	Modified Natural Cycle Offers a Chance of Pregnancy in Patients With Poor Response and High Basal FSH
NCT00619333	Not specified	UNKNOWN	Inactive FSH in Galactosemia
NCT00780897	Not specified	UNKNOWN	Premature Ovarian Failure (Genetic and Physiopathologic Analysis)
NCT01187524	Not specified	TERMINATED	The Natural History of Reproductive and Overall Health in Girls and Women With a Pre-Mutation in the FMR1 Gene; Creation of a Patient Registry
NCT01411644	Not specified	UNKNOWN	Pheno- & Genotyping POF (WHO III)
NCT02086318	Not specified	UNKNOWN	A New Algorithm to Predict Ovarian Age
NCT02467231	Not specified	ACTIVE_NOT_RECRUITING	Ovarian Reserve After Cancer: Longitudinal Effects
NCT02696889	Not specified	COMPLETED	Rejuvenation of Premature Ovarian Failure With Stem Cells
NCT02779374	Not specified	TERMINATED	Autologous Bone Marrow Transplantation for Premature Ovarian Insufficiency
NCT03207412	Not specified	UNKNOWN	Human Amniotic Epithelial Cells Treatment for Ovarian Insufficiency
NCT03381300	Not specified	ACTIVE_NOT_RECRUITING	Preservation of Ovarian Cortex Tissue in Girls With Turner Syndrome
NCT03412487	Not specified	UNKNOWN	Ovarian Histopathology and Laparoscopic Assessment of Premature Ovarian Failure
NCT03474120	Not specified	UNKNOWN	Prospective Genetic Study in Patients With Ovarian Insufficiency
NCT03480412	Not specified	UNKNOWN	Second Step Protocol in Poor Ovarian Responder (POR)
NCT03840824	Not specified	COMPLETED	Blood Spot Self-administered Test and Assay
NCT03861715	Not specified	UNKNOWN	Single Follicular Dexarelix for LH Suppression During Ovarian Stimulation in Oocyte Donors.
NCT03924648	Not specified	COMPLETED	Endocan Levels in Women With Premature Ovarian Insufficiency
NCT04149028	Not specified	COMPLETED	Platelet Rich Plasma Injection Into Ovary of Patients With Premature Ovarian Insufficiency
NCT04189406	Not specified	UNKNOWN	Turner Syndrome Minipuberty Study