DOK1

Summary

DOK1 (docking protein 1, HGNC:2990) is a protein-coding gene on chromosome 2p13.1, encoding Docking protein 1 (Q99704). DOK proteins are enzymatically inert adaptor or scaffolding proteins.

The protein encoded by this gene is part of a signal transduction pathway downstream of receptor tyrosine kinases. The encoded protein is a scaffold protein that helps form a platform for the assembly of multiprotein signaling complexes. Several transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 1796 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 222 total — 1 pathogenic
• MANE Select transcript: NM_001381

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2990
Approved symbol	DOK1
Name	docking protein 1
Location	2p13.1
Locus type	gene with protein product
Status	Approved
Aliases	p62dok
Ensembl gene	ENSG00000115325
Ensembl biotype	protein_coding
OMIM	602919
Entrez	1796

Gene structure

Transcript identifiers

Ensembl transcripts: 20 — 10 protein_coding, 6 protein_coding_CDS_not_defined, 3 retained_intron, 1 nonsense_mediated_decay

ENST00000233668, ENST00000340004, ENST00000409429, ENST00000429631, ENST00000464613, ENST00000474924, ENST00000475191, ENST00000480318, ENST00000482206, ENST00000485132, ENST00000488613, ENST00000489958, ENST00000496966, ENST00000854199, ENST00000854200, ENST00000854201, ENST00000854202, ENST00000854203, ENST00000915539, ENST00000946611

RefSeq mRNA: 6 — MANE Select: NM_001381 NM_001197260, NM_001318866, NM_001318867, NM_001318868, NM_001318869, NM_001381

CCDS: CCDS1954, CCDS56125, CCDS82474

Canonical transcript exons

ENST00000233668 — 5 exons

Exon	Start	End
ENSE00001254734	74554720	74554814
ENSE00001872726	74556308	74557551
ENSE00003532296	74555894	74556078
ENSE00003598083	74555154	74555453
ENSE00003657021	74555575	74555668

Expression profiles

Bgee: expression breadth ubiquitous, 269 present calls, max score 97.87.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 9.1548 / max 72.4901, expressed in 1692 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
21063	8.3967	1552
21061	0.7580	387

Top tissues by expression

286 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
tendon of biceps brachii	UBERON:0008188	97.87	gold quality
pancreatic ductal cell	CL:0002079	96.02	gold quality
monocyte	CL:0000576	94.80	gold quality
mononuclear cell	CL:0000842	94.45	gold quality
leukocyte	CL:0000738	94.26	gold quality
granulocyte	CL:0000094	93.42	gold quality
vena cava	UBERON:0004087	92.65	silver quality
blood	UBERON:0000178	91.46	gold quality
body of tongue	UBERON:0011876	89.39	silver quality
medial globus pallidus	UBERON:0002477	89.02	gold quality
spleen	UBERON:0002106	88.71	gold quality
globus pallidus	UBERON:0001875	88.16	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	88.15	silver quality
pylorus	UBERON:0001166	88.11	gold quality
olfactory bulb	UBERON:0002264	88.03	gold quality
parotid gland	UBERON:0001831	87.85	gold quality
cardia of stomach	UBERON:0001162	87.69	gold quality
pericardium	UBERON:0002407	87.68	gold quality
tongue	UBERON:0001723	87.51	silver quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.35	gold quality
lymph node	UBERON:0000029	87.33	gold quality
buccal mucosa cell	CL:0002336	87.24	silver quality
nipple	UBERON:0002030	87.14	gold quality
inferior vagus X ganglion	UBERON:0005363	87.06	gold quality
oocyte	CL:0000023	86.97	gold quality
saphenous vein	UBERON:0007318	86.68	gold quality
pharyngeal mucosa	UBERON:0000355	86.48	gold quality
ventral tegmental area	UBERON:0002691	86.39	silver quality
superior surface of tongue	UBERON:0007371	86.31	gold quality
synovial joint	UBERON:0002217	86.19	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.02

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

30 targeting DOK1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-7152-3P	99.97	67.47	849
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-1343-3P	99.89	66.78	1815
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-580-3P	99.67	69.23	1841
HSA-MIR-4470	99.66	69.35	1767
HSA-MIR-3128	99.50	67.85	1258
HSA-MIR-3692-5P	99.29	67.04	1421
HSA-MIR-6734-3P	99.15	66.27	1627
HSA-MIR-6815-3P	99.13	68.98	1530
HSA-MIR-6868-5P	99.06	65.69	1284
HSA-MIR-330-5P	98.73	67.63	1788
HSA-MIR-518C-5P	98.53	69.20	1640
HSA-MIR-4722-5P	98.46	66.34	1611
HSA-MIR-6764-3P	98.44	67.64	1153
HSA-MIR-6824-3P	98.44	67.62	1154
HSA-MIR-326	98.25	66.44	1565
HSA-MIR-450A-2-3P	97.91	67.56	1459
HSA-MIR-4799-3P	97.78	65.97	893
HSA-MIR-4720-5P	97.46	65.67	893
HSA-MIR-5588-5P	97.46	65.70	913
HSA-MIR-1913	97.07	66.20	1417
HSA-MIR-4256	96.22	67.70	669
HSA-MIR-11181-5P	96.12	67.46	665
HSA-MIR-4281	92.91	63.60	271

Literature-anchored findings (GeneRIF, showing 40)

• Phosphatidylinositol 3-kinase and Src family kinases are required for phosphorylation and membrane recruitment of Dok-1 in c-Kit signaling. (PMID:11825908)
• Dok-1 acts as an adaptor protein that links the activin receptors with the Smads, suggesting a novel function for Dok-1 in activin signaling leading to B-cell apoptosis. (PMID:11927552)
• DOK1 and DOK2 interact with the Tec protein tyrosine kinase. (PMID:14647425)
• Dok-1 plays an important role in SDF-1alpha/CXCL12-induced chemotaxis in T cells. (PMID:15345598)
• This result indicates that germline mutations in Dok1 are unlikely to cause an inherited predisposition to CLL. (PMID:15541476)
• DOK1 mediates SHP-2/beta3 association in response to IGF-I thereby mediating the effect of integrin ligand occupancy on IGF-IR-linked signaling in smooth muscle cells. (PMID:15546884)
• IKKbeta phosphorylates Dok1 S(439)S(443) and S(446)S(450) after TNF-alpha, IL-1, or gamma-radiation and implicate the critical Dok1 serines in Dok1 effects after tyrosine kinase activation (PMID:15574499)
• Phosphotyrosine-binding mediated oligomerization of Dok-1 and Dok-2 represents an essential step for Dok phosphorylation and function. (PMID:16177091)
• Data show that Dok1 expression and structure are affected in a subset of Burkitt’s lymphoma samples, suggesting its possible role in this type of cancer. (PMID:16338067)
• These data suggest a mechanistic basis for the inhibitory effect of Dok-1 on growth factor-induced mitogenesis and its role as a tumor suppressor. (PMID:16537894)
• The data provide evidence that DOK1 protein has a role in regulating cell proliferation and differentiation and is positive regulators of the MAPK signaling pathway in this context. (PMID:16823827)
• results demonstrate differential modes of regulation of Dok1 and Dok2 in platelets, and raise the possibility that Dok2 plays an important role in integrin outside-in signaling through a physical and functional interaction with integrin alphaIIbbeta3 (PMID:17092301)
• Upon phosphorylation of Tyr 747 in the beta3 integrin tail, however, Dok1 then binds much more strongly than talin. (PMID:18156175)
• These results suggest that engagement of different adaptor proteins by Ret results in very different downstream signaling and functions within neurons and that Dok recruitment leads to a rapid receptor relocation and formation of microspikes. (PMID:18353552)
• Dok-1/Dok-2 pleckstrin homology domains bind in vitro to the rare phosphoinositide species, phosphatidylinositol 5-phosphate (PMID:19299694)
• CD45 recruits adaptor DOK-1 to the proximal plasma membrane to serve as a downstream effector, resulting in negative regulation of the JAK/STAT signaling pathway. (PMID:19481264)
• Results identified an N-terminally truncated isoform of human Dok-1 with N-terminal acetylation as seen in the wild-type. (PMID:19481542)
• The novel platelet adapter Dok-1 is tyrosine phosphorylated in an Src kinase-independent manner downstream of alphaIIbbeta3 in human platelets, leading to an interaction with Grb2 and SHIP-1. (PMID:19682241)
• Identification of DOK genes as lung tumor suppressors. (PMID:20139980)
• Dok1 negatively regulates Dok2-mediated CD200R signaling through the recruitment of CrkL. (PMID:21078907)
• these data support a model in which proteasome- mediated degradation of Dok-1 is an important contributive step toward tumor development and/or progression driven by OTKs (PMID:21536658)
• Cav1 cooperated with the endogenous Ras/MAPK inhibitor docking protein 1 (Dok1) to promote the ligand-dependent transcriptional activity of PPARgamma and to inhibit cell proliferation (PMID:21690289)
• hypermethylation of DOK1 is a potentially critical event in human carcinogenesis. (PMID:21796618)
• These findings are suggestive for a possible tumor suppressor role of DOK1 in epithelial ovarian cancer. (PMID:21856257)
• Studies demonstrate DOK-1 regulates allergen-induced Th2 immune responses by selective stimulation and inhibition of STAT-4 and STAT-6 signaling pathways, respectively. (PMID:22514638)
• DNA methylation of the DOK1 core promoter region found in head and neck cancer cell lines hampered the recruitment of E2F1 to the DOK1 promoter and compromised DOK1 expression. (PMID:23028047)
• The unique N-terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1. (PMID:23822091)
• BRK has a role in targeting Dok1 for ubiquitin-mediated proteasomal degradation and in promoting cell proliferation and migration (PMID:24523872)
• Data implicate existence of alternate conformational states around the ligand binding pocket of the PTB domain of phosphoprotien Dok1 either in the native or in the near native conditions. (PMID:24587391)
• A crucial role for DOK1 in the regulation of PDGF-BB-mediated tumour cell motility through a p130Cas-Rap1 signalling pathway. (PMID:24762811)
• Deregulation of DOK1 gene expression by EBV and novel insights into the regulation of the DOK1 tumor suppressor in viral-related carcinogenesis. (PMID:24809689)
• Taken together, these results reveal that Dok1 and Dok2 proteins are involved in an intrinsic negative feedback loop downstream of natural killer-cell-activating receptors in mouse and human. (PMID:24963146)
• results support a model in which Dok1 phosphorylation normally suppresses localized Ras pathway activity in Crk-transformed cells via recruitment and/or activation of RasGAP (PMID:25043303)
• point mutations in DOK1 and DOK2 genes are detected with low frequency in chronic myelomonocytic leukemia but may have consequences for the function of the DOK2 PTB domain (PMID:25252871)
• Data show that residues Ser745 and Ser756 in the integrin beta2 tail, which are adjacent to the NxxF motif, are required for docking protein 1, docking protein 1, 62kDa (downstream of tyrosine kinase 1) (Dok1) interaction. (PMID:26108885)
• Results indicate that hypermethylation of tumor suppressor protein RASSF1A and docking protein 1 (DOK1) contributes to hepatocarcinogenesis and is associated to clinicopathological characteristics. (PMID:27078152)
• DOK3 expression was not altered much in HTLV-1-infected T cells. (PMID:27265473)
• DOK1 was identified as a prognostic factor for non-metastatic CRC, and, via its drugability by PPARgamma-agonist, may constitute a potential target for future cancer treatments. (PMID:27428427)
• Taken together, these results indicate that ATRA-enhanced expression of DOK1 activates PPARgamma leading to inhibition of cell proliferation and enhancement of cell apoptosis in MCF-7 cell. (PMID:28396148)
• Decreased DOK1/2 expressions associated with their promoter hypermethylations predict adverse prognosis in AML. (PMID:29150948)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	dok1a	ENSDARG00000078108
		ENSDARG00000114879
mus_musculus	Dok1	ENSMUSG00000068335
rattus_norvegicus	Dok1	ENSRNOG00000007412
drosophila_melanogaster	Dok	FBGN0029944
drosophila_melanogaster	CG13398	FBGN0032042
caenorhabditis_elegans		WBGENE00018819

Paralogs (7): DOK5 (ENSG00000101134), DOK4 (ENSG00000125170), FRS3 (ENSG00000137218), DOK3 (ENSG00000146094), DOK2 (ENSG00000147443), FRS2 (ENSG00000166225), DOK6 (ENSG00000206052)

Protein

Protein identifiers

Docking protein 1 — Q99704 (reviewed: Q99704)

Alternative names: Downstream of tyrosine kinase 1, p62(dok), pp62

All UniProt accessions (2): Q99704, H7C093

UniProt curated annotations — full annotation on UniProt →

Function. DOK proteins are enzymatically inert adaptor or scaffolding proteins. They provide a docking platform for the assembly of multimolecular signaling complexes. DOK1 appears to be a negative regulator of the insulin signaling pathway. Modulates integrin activation by competing with talin for the same binding site on ITGB3.

Subunit / interactions. Interacts with ABL1. Interacts with RasGAP and INPP5D/SHIP1. Interacts directly with phosphorylated ITGB3. Interacts with SRMS (via the SH2 and SH3 domains).

Subcellular location. Cytoplasm. Nucleus Cytoplasm. Perinuclear region.

Tissue specificity. Expressed in pancreas, heart, leukocyte and spleen. Expressed in both resting and activated peripheral blood T-cells. Expressed in breast cancer.

Post-translational modifications. Constitutively tyrosine-phosphorylated. Phosphorylated by TEC. Phosphorylated by LYN. Phosphorylated on tyrosine residues by the insulin receptor kinase. Results in the negative regulation of the insulin signaling pathway. Phosphorylated on tyrosine residues by SRMS.

Domain organisation. The PTB domain mediates receptor interaction.

Miscellaneous. Produced by alternative initiation at Met-140 of isoform 1.

Similarity. Belongs to the DOK family. Type A subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
Q99704-1	1, p62Dok1	yes
Q99704-2	2, p22Dokdel
Q99704-3	3, p44Dok

RefSeq proteins (6): NP_001184189, NP_001305795, NP_001305796, NP_001305797, NP_001305798, NP_001372* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001849	PH_domain	Domain
IPR002404	IRS_PTB	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR037751	Dok1/2/3_PTB	Domain
IPR050996	Docking_Protein_DOK	Family

Pfam: PF00169, PF02174

UniProt features (40 total): modified residue 15, strand 7, splice variant 3, helix 3, region of interest 3, domain 2, mutagenesis site 2, compositionally biased region 2, chain 1, sequence conflict 1, turn 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2V76	X-RAY DIFFRACTION	1.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q99704-F1	68.24	0.35

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (15): 269, 291, 296, 337, 341, 362, 377, 398, 409, 416, 449, 460, 1, 1, 48

Mutagenesis-validated functional residues (2):

Position	Phenotype
362	no association with nck. no association with gap; when associated with f-398.
398	no association with gap; when associated with f-362.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-8849469	PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1
R-HSA-8853659	RET signaling

MSigDB gene sets: 233 (showing top): PID_BCR_5PATHWAY, GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_UP, MORF_RAGE, GGGACCA_MIR133A_MIR133B, DAVIES_MULTIPLE_MYELOMA_VS_MGUS_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GOBP_RESPONSE_TO_PEPTIDE, MODULE_45, MORF_ATRX, RIZKI_TUMOR_INVASIVENESS_3D_DN, MORF_ESR1, MODULE_16, BROWNE_HCMV_INFECTION_48HR_DN, MODULE_120, ATF1_Q6

GO Biological Process (6): signal transduction (GO:0007165), cell surface receptor signaling pathway (GO:0007166), cell surface receptor protein tyrosine kinase signaling pathway (GO:0007169), Ras protein signal transduction (GO:0007265), macrophage colony-stimulating factor signaling pathway (GO:0038145), intracellular signal transduction (GO:0035556)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (4): nucleus (GO:0005634), cytoplasm (GO:0005737), cytosol (GO:0005829), perinuclear region of cytoplasm (GO:0048471)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Signaling by PTK6	1
Axon guidance	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
signal transduction	2
intracellular anatomical structure	2
cytoplasm	2
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
enzyme-linked receptor protein signaling pathway	1
small GTPase-mediated signal transduction	1
cytokine-mediated signaling pathway	1
cellular response to macrophage colony-stimulating factor stimulus	1
binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

476 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DOK1	RASA1	P20936	983
DOK1	CSK	P41240	884
DOK1	NCK1	P16333	844
DOK1	EVPL	Q92817	749
DOK1	ABL1	P00519	693
DOK1	KEAP1	Q14145	623
DOK1	NCK2	O43639	608
DOK1	CRK	P46108	596
DOK1	PLEK2	Q9NYT0	584
DOK1	PLEK	P08567	580
DOK1	SHC1	P29353	555
DOK1	AKT1	P31749	507
DOK1	FERMT3	Q86UX7	463
DOK1	EPHB2	P29323	459
DOK1	TLN1	Q9Y490	457

IntAct

36 interactions, top by confidence:

A	B	Type	Score
NCK2	SH3PXD2B	psi-mi:“MI:0914”(association)	0.640
DOK1	SRMS	psi-mi:“MI:0217”(phosphorylation reaction)	0.640
SRMS	DOK1	psi-mi:“MI:0915”(physical association)	0.640
DOK1	SRMS	psi-mi:“MI:0915”(physical association)	0.640
ORF	EIF3D	psi-mi:“MI:0914”(association)	0.560
EGFR	DOK1	psi-mi:“MI:0915”(physical association)	0.550
COLGALT2	COL1A1	psi-mi:“MI:0914”(association)	0.530
DOK1	Cbll1	psi-mi:“MI:0915”(physical association)	0.520
DOK1	ORF	psi-mi:“MI:0915”(physical association)	0.500
DOK1	DOK3	psi-mi:“MI:0915”(physical association)	0.490
DOK1	CRKL	psi-mi:“MI:0915”(physical association)	0.490
CRKL	DOK1	psi-mi:“MI:0915”(physical association)	0.490
DOK3	DOK1	psi-mi:“MI:0915”(physical association)	0.490
SH2D1A	DOK1	psi-mi:“MI:0914”(association)	0.460
DOK1	ERBB2	psi-mi:“MI:0407”(direct interaction)	0.440
DOK1	Dlg4	psi-mi:“MI:0407”(direct interaction)	0.440
	TBKBP1	psi-mi:“MI:0914”(association)	0.350
	AURKA	psi-mi:“MI:0914”(association)	0.350
NEK4	E2F8	psi-mi:“MI:0914”(association)	0.350
DOK1	Shc1	psi-mi:“MI:0914”(association)	0.350
DOK1	Mink1	psi-mi:“MI:0914”(association)	0.350

BioGRID (98): DOK1 (Affinity Capture-Western), INPP5D (Affinity Capture-Western), RASA1 (Affinity Capture-Western), DOK1 (Two-hybrid), DOK1 (Affinity Capture-MS), DOK3 (Two-hybrid), CRKL (Two-hybrid), DOK1 (PCA), DOK1 (Affinity Capture-Luminescence), DOK1 (Affinity Capture-MS), DOK1 (Affinity Capture-MS), TLN1 (Reconstituted Complex), ITGB1 (Reconstituted Complex), ITGB3 (Reconstituted Complex), ITGB7 (Reconstituted Complex)

ESM2 similar proteins: A3R064, A7MBB8, B2RYG7, D3ZZN9, E1BDF2, O60496, O70469, O94989, O95153, P97465, P97680, P98077, Q13671, Q14B98, Q1RMU7, Q3MIN7, Q3UR97, Q3UYI5, Q494U1, Q4QQV2, Q58EX7, Q5EA84, Q5FWH6, Q6ICB4, Q6PGG2, Q6ZW31, Q7L591, Q7TNF8, Q8BH49, Q8BWA8, Q8IW93, Q8IYJ3, Q8N878, Q8NAG6, Q8NFA2, Q91WA6, Q921Q7, Q92502, Q969H4, Q969T3

Diamond homologs: A3R064, A7MBB8, B2RYG7, O43559, O60496, O70469, P97465, Q4QQV2, Q52RG8, Q5EA84, Q7L591, Q8C180, Q8WU20, Q91WJ0, Q99704, Q9QZK7, Q5RA30, Q8TEW6, Q99KE3, Q2MHE5, Q6PKX4, Q91ZM9, Q9P104

SIGNOR signaling

41 interactions.

A	Effect	B	Mechanism
IKBKB	up-regulates	DOK1	phosphorylation
LCK	“up-regulates activity”	DOK1	phosphorylation
DOK1	“down-regulates activity”	ITGB1	binding
DOK1	“down-regulates activity”	“A1/b1 integrin”	binding
DOK1	“down-regulates activity”	“A2/b1 integrin”	binding
DOK1	“down-regulates activity”	“A3/b1 integrin”	binding
DOK1	“down-regulates activity”	“A4/b1 integrin”	binding
DOK1	“down-regulates activity”	“A5/b1 integrin”	binding
DOK1	“down-regulates activity”	“A6/b1 integrin”	binding
DOK1	“down-regulates activity”	“A8/b1 integrin”	binding
DOK1	“down-regulates activity”	“A9/b1 integrin”	binding
DOK1	“down-regulates activity”	“A10/b1 integrin”	binding
DOK1	“down-regulates activity”	“A11/b1 integrin”	binding
DOK1	“down-regulates activity”	ITGB2	binding
DOK1	“down-regulates activity”	“AL/b2 integrin”	binding
DOK1	“down-regulates activity”	“AM/b2 integrin”	binding
DOK1	“down-regulates activity”	“AX/b2 integrin”	binding
DOK1	“down-regulates activity”	“Av/b2 integrin”	binding
DOK1	“down-regulates activity”	“AD/b2 integrin”	binding
DOK1	“down-regulates activity”	“AIIB/b3 integrin”	binding
DOK1	“down-regulates activity”	ITGB3	binding
DOK1	“down-regulates activity”	“Av/b3 integrin”	binding
DOK1	“down-regulates activity”	ITGB4	binding
DOK1	“down-regulates activity”	“A6/b4 integrin”	binding
DOK1	“down-regulates activity”	ITGB5	binding
DOK1	“down-regulates activity”	“Av/b5 integrin”	binding
DOK1	“down-regulates activity”	ITGB6	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

222 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	139
Likely benign	67
Benign	2

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
1343102	NM_032603.5(LOXL3):c.594del (p.Gln199fs)	Pathogenic

SpliceAI

1324 predictions. Top by Δscore:

Variant	Effect	Δscore
2:74552317:CTCA:C	donor_loss	1.0000
2:74552318:TCAC:T	donor_loss	1.0000
2:74552319:CA:C	donor_loss	1.0000
2:74552321:C:CT	donor_loss	1.0000
2:74556303:CTTA:C	acceptor_loss	1.0000
2:74556304:TTA:T	acceptor_loss	1.0000
2:74552541:CCG:C	acceptor_gain	0.9900
2:74552542:C:CT	acceptor_gain	0.9900
2:74552542:C:T	acceptor_gain	0.9900
2:74552543:G:C	acceptor_gain	0.9900
2:74555153:GAGGT:G	acceptor_gain	0.9900
2:74555450:TCCGG:T	donor_loss	0.9900
2:74555451:CCGGT:C	donor_loss	0.9900
2:74555452:CGGTG:C	donor_loss	0.9900
2:74555453:GGTGA:G	donor_loss	0.9900
2:74555454:G:GG	donor_gain	0.9900
2:74555454:GTGA:G	donor_loss	0.9900
2:74555455:T:G	donor_loss	0.9900
2:74555665:G:GT	donor_gain	0.9900
2:74555665:G:T	donor_gain	0.9900
2:74555666:A:T	donor_gain	0.9900
2:74555695:G:T	donor_gain	0.9900
2:74556055:T:G	donor_gain	0.9900
2:74556074:ACAAG:A	donor_loss	0.9900
2:74556075:CAAG:C	donor_loss	0.9900
2:74556076:AAGGT:A	donor_loss	0.9900
2:74556077:AG:A	donor_loss	0.9900
2:74556078:GG:G	donor_loss	0.9900
2:74556079:GTGCA:G	donor_loss	0.9900
2:74556080:T:A	donor_loss	0.9900

AlphaMissense

3083 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:74555157:T:A	W22R	0.999
2:74555157:T:C	W22R	0.999
2:74555159:G:C	W22C	0.999
2:74555159:G:T	W22C	0.999
2:74555212:T:A	L40H	0.999
2:74555212:T:C	L40P	0.999
2:74555359:T:C	F89S	0.999
2:74555421:T:A	W110R	0.999
2:74555421:T:C	W110R	0.999
2:74555423:G:C	W110C	0.999
2:74555423:G:T	W110C	0.999
2:74556040:T:A	W201R	0.999
2:74556040:T:C	W201R	0.999
2:74556056:T:C	L206S	0.999
2:74556058:C:A	R207S	0.999
2:74556315:T:C	F216S	0.999
2:74556366:T:C	F233S	0.999
2:74554776:G:A	G8R	0.998
2:74554776:G:C	G8R	0.998
2:74554776:G:T	G8W	0.998
2:74555448:T:C	F119L	0.998
2:74555450:T:A	F119L	0.998
2:74555450:T:G	F119L	0.998
2:74556042:G:C	W201C	0.998
2:74556042:G:T	W201C	0.998
2:74556062:G:C	R208P	0.998
2:74556064:T:G	Y209D	0.998
2:74556068:G:A	G210D	0.998
2:74556332:C:A	R222S	0.998
2:74556338:T:C	C224R	0.998

dbSNP variants (sampled 300 via entrez): RS1000411198 (2:74549094 G>A,T), RS1000548501 (2:74548678 T>C), RS1001007749 (2:74552979 G>A), RS1001111136 (2:74554942 G>A,T), RS1001411668 (2:74550549 T>C), RS1001517512 (2:74549934 C>G), RS1001669943 (2:74557823 A>T), RS1001809605 (2:74554421 T>TGGCTTTCACTCTGACGTCAC), RS1002131803 (2:74553321 G>A), RS1002446745 (2:74547245 T>C), RS1002520363 (2:74551413 T>C,G), RS1002559456 (2:74551715 G>A), RS1002684027 (2:74548968 G>C), RS1002779490 (2:74548764 C>A), RS1003244133 (2:74555029 T>TCG)

Disease associations

OMIM: gene MIM:602919 | disease phenotypes: MIM:619781

GenCC curated gene-disease

Mondo (1): myopia 28, autosomal recessive (MONDO:0030697)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST008839_527	Height	6.000000e-14
GCST011354_21	Bell’s palsy	5.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cisplatin	decreases expression, increases response to substance	2
Silicon Dioxide	decreases expression, increases expression	2
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
GSK-J4	decreases expression	1
triphenyl phosphate	affects expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
coumarin	increases phosphorylation	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	increases reaction, affects binding	1
Imatinib Mesylate	decreases phosphorylation	1
Sorafenib	decreases phosphorylation	1
Decitabine	increases expression	1
Sunitinib	decreases expression	1
Benzo(a)pyrene	increases expression	1
Caffeine	decreases phosphorylation	1
Diazinon	increases methylation	1
Doxorubicin	decreases expression	1
Smoke	decreases expression	1
Testosterone	increases expression	1
Valproic Acid	increases methylation	1
Vitamin E	increases expression	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.