E2F4

Summary

E2F4 (E2F transcription factor 4, HGNC:3118) is a protein-coding gene on chromosome 16q22.1, encoding Transcription factor E2F4 (Q16254). Transcription activator that binds DNA cooperatively with DP proteins through the E2 recognition site, 5’-TTTC[CG]CGC-3’ found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication.

The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer.

Source: NCBI Gene 1874 — RefSeq curated summary.

At a glance

• GWAS associations: 6
• Clinical variants (ClinVar): 67 total
• GTEx eGene: eQTL in 15 tissues, sQTL in 18 (q < 0.05)
• Drug target: yes — 1 via a complex or family
• Constraint (gnomAD): pLI 0.36 (intermediate), LOEUF 0.61 (unconstrained)
• Transcription factor: yes — 274 downstream targets (CollecTRI)
• MANE Select transcript: NM_001950
• Notable: 67 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3118
Approved symbol	E2F4
Name	E2F transcription factor 4
Location	16q22.1
Locus type	gene with protein product
Status	Approved
Aliases	E2F-4
Ensembl gene	ENSG00000205250
Ensembl biotype	protein_coding
OMIM	600659
Entrez	1874

Gene structure

Transcript identifiers

Ensembl transcripts: 40 — 18 nonsense_mediated_decay, 14 protein_coding, 7 retained_intron, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000379378

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 5, TSL 3: 6, TSL 5: 1

ENST00000379378, ENST00000561904, ENST00000563238, ENST00000564718, ENST00000565226, ENST00000565849, ENST00000566368, ENST00000567007, ENST00000567228, ENST00000568485, ENST00000568693, ENST00000568839, ENST00000569573, ENST00000902238, ENST00000902239, ENST00000914909, ENST00000914910, ENST00000914911, ENST00000914912, ENST00000914914, ENST00000957227, ENST00000957228, ENST00000991660, ENST00000991661, ENST00000991662, ENST00000991664, ENST00000991665, ENST00001033616, ENST00001033617, ENST00001033618, ENST00001033619, ENST00001033621, ENST00001033622, ENST00001033623, ENST00001075657, ENST00001075658, ENST00001075660, ENST00001075662, ENST00001075663, ENST00001134526

RefSeq mRNA: 1 — MANE Select: NM_001950 NM_001950

CCDS: CCDS32464

Canonical transcript exons

ENST00000379378 — 10 exons

Exon	Start	End
ENSE00001480731	67198008	67198918
ENSE00001480751	67192155	67192362
ENSE00003474413	67194686	67194980
ENSE00003484374	67192761	67192870
ENSE00003533534	67197599	67197646
ENSE00003580299	67195782	67196006
ENSE00003613703	67193009	67193170
ENSE00003630514	67194398	67194459
ENSE00003631198	67197867	67197911
ENSE00003664622	67193472	67193515

Expression profiles

Bgee: expression breadth ubiquitous, 182 present calls, max score 98.17.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 13.5337 / max 248.4952, expressed in 1800 samples.

Highest expression (Bgee): pancreatic ductal cell, ileal mucosa, granulocyte, uterine tube, adenohypophysis.

Genetic regulation across tissues (GTEx eQTL / sQTL)

E2F4 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 15 tissues and its splicing (sQTL) in 18 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 33 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Esophagus Mucosa	sqtl	7.5e-18	-1.03	16:67195583:T:G
Lung	sqtl	1.4e-13	-0.88	16:67182207:C:T
Skin Sun Exposed Lower leg	sqtl	2.7e-10	-0.72	16:67182207:C:T
Thyroid	sqtl	4.0e-10	-0.63	16:67182207:C:T
Skin Not Sun Exposed Suprapubic	sqtl	1.3e-09	-0.76	16:67195583:T:G
Cells EBV-transformed lymphocytes	sqtl	3.1e-09	-1.05	16:67178129:GAGCCCCGCCCCTCGCCCGA:G
Cells Cultured fibroblasts	sqtl	2.8e-08	-0.80	16:67182207:C:T
Breast Mammary Tissue	sqtl	8.2e-08	-1.02	16:67182207:C:T
Muscle Skeletal	sqtl	2.4e-06	-0.69	16:67182207:C:T
Nerve Tibial	sqtl	5.5e-06	-0.67	16:67182207:C:T
Adipose Visceral Omentum	sqtl	5.9e-06	-1.11	16:67344309:G:T
Brain Cerebellar Hemisphere	eqtl	1.0e-05	-0.17	16:67199363:A:C
Cells Cultured fibroblasts	eqtl	1.6e-05	-0.11	16:67220516:A:G
Pancreas	sqtl	5.0e-05	-1.43	16:66928364:C:T
Prostate	sqtl	1.4e-04	-1.15	16:67195583:T:G
Heart Left Ventricle	sqtl	1.7e-04	-0.78	16:67195583:T:G
Colon Transverse	sqtl	2.6e-04	-0.61	16:67180020:C:T
Lung	eqtl	7.4e-04	-0.13	16:67178909:A:AC
Brain Cerebellum	eqtl	9.7e-04	-0.18	16:67199363:A:C
Adipose Subcutaneous	sqtl	1.4e-03	-0.58	16:67182207:C:T

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
154596	13.4583	1800
154599	0.0694	16
154600	0.0060	2

Top tissues by expression

showing 100 of 276 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	98.17	silver quality
ileal mucosa	UBERON:0000331	96.72	silver quality
granulocyte	CL:0000094	96.34	gold quality
left uterine tube	UBERON:0001303	96.14	gold quality
adenohypophysis	UBERON:0002196	95.97	gold quality
transverse colon	UBERON:0001157	95.86	gold quality
mucosa of transverse colon	UBERON:0004991	95.78	gold quality
metanephros cortex	UBERON:0010533	95.73	gold quality
small intestine Peyer’s patch	UBERON:0003454	95.62	gold quality
apex of heart	UBERON:0002098	95.51	gold quality
body of stomach	UBERON:0001161	95.49	gold quality
tibialis anterior	UBERON:0001385	95.41	silver quality
right lobe of thyroid gland	UBERON:0001119	95.24	gold quality
upper lobe of left lung	UBERON:0008952	95.09	gold quality
body of uterus	UBERON:0009853	95.01	gold quality
lower esophagus mucosa	UBERON:0035834	95.01	gold quality
lower esophagus	UBERON:0013473	94.89	gold quality
lower esophagus muscularis layer	UBERON:0035833	94.89	gold quality
right hemisphere of cerebellum	UBERON:0014890	94.85	gold quality
muscle layer of sigmoid colon	UBERON:0035805	94.83	gold quality
left lobe of thyroid gland	UBERON:0001120	94.82	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	94.78	gold quality
monocyte	CL:0000576	94.53	gold quality
left adrenal gland cortex	UBERON:0035825	94.53	gold quality
omental fat pad	UBERON:0010414	94.52	gold quality
left adrenal gland	UBERON:0001234	94.47	gold quality
peritoneum	UBERON:0002358	94.45	gold quality
leukocyte	CL:0000738	94.42	gold quality
mononuclear cell	CL:0000842	94.37	gold quality
right ovary	UBERON:0002118	94.33	gold quality
rectum	UBERON:0001052	94.32	gold quality
body of pancreas	UBERON:0001150	94.31	gold quality
right adrenal gland	UBERON:0001233	94.26	gold quality
right adrenal gland cortex	UBERON:0035827	94.25	gold quality
right testis	UBERON:0004534	94.23	gold quality
left coronary artery	UBERON:0001626	94.22	gold quality
cerebellar hemisphere	UBERON:0002245	94.15	gold quality
ectocervix	UBERON:0012249	94.15	gold quality
endocervix	UBERON:0000458	94.12	gold quality
left testis	UBERON:0004533	94.11	gold quality
esophagus	UBERON:0001043	94.06	gold quality
spleen	UBERON:0002106	93.99	gold quality
cerebellar cortex	UBERON:0002129	93.99	gold quality
right coronary artery	UBERON:0001625	93.82	gold quality
thoracic aorta	UBERON:0001515	93.80	gold quality
left ovary	UBERON:0002119	93.80	gold quality
esophagus mucosa	UBERON:0002469	93.78	gold quality
ascending aorta	UBERON:0001496	93.76	gold quality
pituitary gland	UBERON:0000007	93.70	gold quality
right lung	UBERON:0002167	93.68	gold quality
minor salivary gland	UBERON:0001830	93.64	gold quality
gall bladder	UBERON:0002110	93.63	gold quality
descending thoracic aorta	UBERON:0002345	93.41	gold quality
mucosa of stomach	UBERON:0001199	93.38	gold quality
gastrocnemius	UBERON:0001388	93.30	gold quality
stomach	UBERON:0000945	93.22	gold quality
right atrium auricular region	UBERON:0006631	93.18	gold quality
thyroid gland	UBERON:0002046	93.15	gold quality
small intestine	UBERON:0002108	93.13	gold quality
tibial nerve	UBERON:0001323	93.10	gold quality
adipose tissue of abdominal region	UBERON:0007808	93.10	gold quality
adrenal cortex	UBERON:0001235	93.07	gold quality
aorta	UBERON:0000947	93.03	gold quality
stromal cell of endometrium	CL:0002255	92.99	gold quality
coronary artery	UBERON:0001621	92.99	gold quality
muscle of leg	UBERON:0001383	92.83	gold quality
skin of abdomen	UBERON:0001416	92.83	gold quality
adrenal gland	UBERON:0002369	92.69	gold quality
popliteal artery	UBERON:0002250	92.68	gold quality
tibial artery	UBERON:0007610	92.68	gold quality
skin of leg	UBERON:0001511	92.45	gold quality
lymph node	UBERON:0000029	92.40	gold quality
right uterine tube	UBERON:0001302	92.38	gold quality
right lobe of liver	UBERON:0001114	92.35	gold quality
hindlimb stylopod muscle	UBERON:0004252	92.26	gold quality
right frontal lobe	UBERON:0002810	91.92	gold quality
pancreas	UBERON:0001264	91.80	gold quality
cerebellum	UBERON:0002037	91.54	gold quality
smooth muscle tissue	UBERON:0001135	91.49	gold quality
colon	UBERON:0001155	91.31	gold quality
upper lobe of lung	UBERON:0008948	91.25	gold quality
endometrium epithelium	UBERON:0004811	91.23	gold quality
testis	UBERON:0000473	91.17	gold quality
saliva-secreting gland	UBERON:0001044	91.13	gold quality
intestine	UBERON:0000160	91.10	gold quality
heart left ventricle	UBERON:0002084	90.99	gold quality
cardiac atrium	UBERON:0002081	90.81	gold quality
vagina	UBERON:0000996	90.77	gold quality
large intestine	UBERON:0000059	90.65	gold quality
cardiac ventricle	UBERON:0002082	90.40	gold quality
sigmoid colon	UBERON:0001159	90.37	gold quality
islet of Langerhans	UBERON:0000006	90.36	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	90.29	gold quality
mouth mucosa	UBERON:0003729	90.19	gold quality
heart	UBERON:0000948	90.03	gold quality
subcutaneous adipose tissue	UBERON:0002190	89.67	gold quality
vermiform appendix	UBERON:0001154	89.61	gold quality
fundus of stomach	UBERON:0001160	89.50	gold quality
cingulate cortex	UBERON:0003027	89.15	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	89.07	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-CURD-112	yes	41.16
E-ANND-3	yes	7.78

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Bone marrow	tissue	92.8
Lymph node	tissue	45.3
Placenta	tissue	41.4
Tonsil	tissue	40.7
Thymus	tissue	39.6
Pituitary gland	tissue	38.2
Appendix	tissue	37.5
Urinary bladder	tissue	36.4
Vagina	tissue	32.0
Esophagus	tissue	30.7
Colon	tissue	30.7
Small intestine	tissue	30.3
Spleen	tissue	30.2
Duodenum	tissue	30.2
Rectum	tissue	30.1
Smooth muscle	tissue	29.7
Skeletal muscle	tissue	29.4
Adipose tissue	tissue	28.7
Putamen	tissue	28.3
Tongue	tissue	28.1
Parathyroid gland	tissue	27.4
Basal ganglia	tissue	27.4
Skin 1	tissue	27.1
Fallopian tube	tissue	26.3
Cerebral cortex	tissue	26.1
Occipital cortex	tissue	26.1
Seminal vesicle	tissue	26.0
Somatosensory cortex	tissue	25.9
Stomach 1	tissue	25.2
Pons	tissue	25.2
Superior colliculi	tissue	25.2
Thalamus	tissue	25.0
Prefrontal cortex	tissue	24.7
Motor cortex	tissue	24.7
Hypothalamus	tissue	24.7
Lung	tissue	24.7
Heart muscle	tissue	24.4
Cerebellum	tissue	24.3
Ovary	tissue	24.2
Medulla oblongata	tissue	23.9
Hippocampal formation	tissue	23.9
Midbrain	tissue	23.4
Spinal cord	tissue	23.3
Entorhinal cortex	tissue	23.3
Temporal cortex	tissue	23.1
Ventral forebrain	tissue	23.0
Postcentral gyrus	tissue	22.9
Corpus callosum	tissue	22.8
Salivary gland	tissue	22.6
Substantia nigra	tissue	22.6
Insular cortex	tissue	22.6
Gallbladder	tissue	22.2
Septum	tissue	22.2
Pancreas	tissue	22.0
Endometrium 1	tissue	22.0
Retrosplenial and cingulate cortex	tissue	21.9
Periaqueductal gray	tissue	21.8
Retrosplenial cortex	tissue	21.3
Epididymis	tissue	20.9
Cervix	tissue	20.6

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Blood vessel (34.7), Dorsal hippocampus (23.9), Dorsal spinal cord (23.3), Arcuate nucleus (22.8), White matter (22.8).

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

showing 30 of 274 targets:

Target	Regulation
ACTG1	Unknown
ACTR5	Unknown
ADARB1	Unknown
AKR7A2	Unknown
ALDH5A1	Unknown
ALG5
ANAPC15	Unknown
ANLN	Unknown
APRT	Unknown
AR	Unknown
ASF1B	Activation
AURKB	Unknown
BACH1	Unknown
BARD1	Unknown
BCL11A	Unknown
BIRC5	Unknown
BORA	Unknown
BRCA1	Activation
BUB3	Unknown
C5orf22
CALM1	Unknown
CALR	Unknown
CAV1	Unknown
CBX5	Unknown
CCNA2	Unknown
CCNB1	Unknown
CCNB2	Repression
CCND1	Unknown
CCNE1	Repression
CDC25A	Activation

JASPAR motifs

Motif	Name	Family
MA0470.1	E2F4	E2F
MA0470.2	E2F4	E2F
MA0470.3	E2F4	E2F

JASPAR matrix evidence (PMIDs): PMID:17908821, PMID:18836037

Upstream regulators (CollecTRI, top): HCFC1, RBL2, TFDP3, TP53, TRIM28, ZBTB7A

miRNA regulators (miRDB)

Targeting E2F4 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 32 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-12136	99.98	72.81	5713
HSA-LET-7C-3P	99.95	73.42	2862
HSA-MIR-4525	99.94	64.38	675
HSA-MIR-5010-5P	99.94	64.11	705
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-4799-5P	99.82	70.60	2663
HSA-MIR-1252-3P	99.55	67.71	2862
HSA-MIR-12123	99.52	71.79	2990
HSA-MIR-520F-5P	99.34	70.40	1632
HSA-MIR-190B-3P	99.33	68.29	1382
HSA-MIR-4667-3P	99.26	65.45	1608
HSA-MIR-548L	99.06	70.90	2560
HSA-MIR-4709-3P	98.88	68.04	1594
HSA-MIR-6889-3P	98.84	67.35	1198
HSA-MIR-760	98.81	66.65	1392
HSA-MIR-6529-3P	98.68	66.76	1020
HSA-MIR-6728-3P	98.63	67.63	1534
HSA-MIR-6868-3P	98.63	69.64	2259
HSA-MIR-4252	98.45	66.37	987
HSA-MIR-6804-5P	98.39	65.77	1084
HSA-MIR-8057	97.64	66.54	897
HSA-MIR-9851-5P	97.57	67.49	1067
HSA-MIR-4313	97.18	63.15	420
HSA-MIR-1913	97.07	66.20	1417
HSA-MIR-6822-3P	96.60	66.06	680

Functional genomics

gnomAD constraint: pLI 0.355, LOEUF 0.615, missense Z 0.24 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000379378 splits into 3 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
16:67,192,228–67,192,290	40 / 30.8	1.30	no
16:67,192,291–67,194,418	119 / 175.6	0.68	no
16:67,194,419–67,198,120	314 / 315.6	0.99	no

Literature-anchored findings (GeneRIF, showing 40)

• expression reduced in primary and metastatic breast carcinoma (PMID:11759817)
• regulation of expression of p130, p107 and E2F-4 in human cells (PMID:12006580)
• data point to Tat as an adaptor protein that recruits cellular factors such as E2F-4 to exert its multiple biological activities (PMID:12055184)
• Mutations in E2F-4 gene is associated with hereditary non-polyposis colorectal cancer (PMID:12148576)
• We investigated occupancy of ER-alpha promoter by pRb2/p130-E2F4/5-HDAC1-SUV39 H1-p300 and pRb2/p130-E2F4/5-HDAC1-SUV39H1-DNMT1 complexes, and provided a link between pRb2/p130 and chromatin-modifying enzymes in the regulation of ER-alpha transcription (PMID:12789259)
• EBV LMP1 blocks p16INK4 pathway by promoting nuclear export of E2F-4. (PMID:12860972)
• Increased E2F4/p130 complex formation seen after irradiation depended on increased nuclear E2F4, dissociation of p130 from Cdk2, and p130 dephosphorylation. E2F4 siRNA prevented p130/E2F4 formation and sensitized cells to radiation-induced apoptosis. (PMID:15231644)
• E2F-a and E2F-c binding sites are involved in the TCR-induced down-regulation of ICBP90 gene transcription (PMID:15964557)
• E2F4 is a transcriptional regulator of the cell cycle genes. (PMID:16135806)
• There were no significant changes of CDK4 and E2F-1/4 expression in benzo(a)pyrene treated embryo lung fibroblasts. (PMID:16758952)
• Hypoxia induces substantial p130 dephosphorylation and nuclear accumulation, leading to the formation of E2F4/p130 complexes and increased occupancy of E2F4 and p130 at the RAD51 and BRCA1 promoters. (PMID:17001309)
• in response to radiation, E2F4 becomes active in the nucleus, enforces a stable G(2) arrest by target gene repression, and thus provides increased cell survival ability by minimizing propagation of cells that have irreparable DNA damage (PMID:17043659)
• Wnt/beta-catenin signaling may contribute to colorectal carcinogenesis by reducing the level of the E2F4 cell cycle repressor via an antisense mechanism (PMID:17121828)
• By interacting with p130, E2F4 plays a key role in the maintenance of a stable G2 arrest. Increased E2F4 levels and its translocation to the nucleus following genotoxic stress result in downregulation of mitotic genes. (PMID:17507799)
• Evolutionarily conserved multisubunit protein complex that contains p130 and E2F4 mediates the repression of cell cycle-dependent genes in quiescence. (PMID:17531812)
• deregulated nuclear E2F4 expression induces apoptosis via multiple pathways in normal intestinal epithelial cells but not in colon cancer cells. (PMID:17656449)
• E2F4, binding sites are located within 2 kb of a transcription start site, in both normal and tumor cells (PMID:17908821)
• Cell cycle genes are the evolutionarily conserved targets of the E2F4 transcription factor (PMID:17957245)
• FBI-1 is the first transcriptional repressor shown to act as a dual regulator in adipogenesis exerting repressor activities on target genes by both, direct and indirect mechanisms. (PMID:18368381)
• E2F4, PHACTR3, PRAME family member and CDH12 most probably play important role in non-small-cell lung cancer geneses (PMID:19473719)
• E2F4 may be determinant in the promotion of proliferation of human intestinal epithelial crypt cells and colorectal cancer cells. (PMID:19562678)
• Our data indicate that E2F4 is required for cardiomyocyte proliferation and suggest a function for E2F4 in mitosis (PMID:19955219)
• Tamoxifen resistant tumors displayed enriched expression of genes related to cell cycle and proliferation, as well as elevated activity of E2F transcription factors. (PMID:21789246)
• Silica could induce the high expression of cyclin D1 and CDK4 and the low expression of E2F-4, resulting in the cell cycle changes by AP-1/cyclin D1 pathway in human embryonic lung fibroblasts. (PMID:22357515)
• data demonstrate that enforced E2F4 expression in Burkitt lymphoma (BL) cells not only diminishes E2F1 levels, but also reduces selectively the tumorigenic properties and proliferation of BL cells (PMID:22475873)
• The inverse immunohistochemical relationship between E2F1 and E2F4 indicates a possible mechanistic interlink in colorectal cancer. (PMID:22688350)
• the loss of CDH1/E2F4 may be associated with worse clinical and pathological findings in mammary ductal carcinoma. (PMID:23007606)
• Short alleles (<13 repeats) of (AGC)n in E2F4 were less frequent in women with breast cancer than in the control sample. (PMID:23015403)
• Trim28 regulates cell proliferation by bridging HDAC1 and E2F3 and E2F4 interactions. (PMID:23060449)
• In terminally differentiated cells, common KDM5A and E2F4 gene targets were bound by the pRB-related protein p130, a DREAM complex component. (PMID:23093672)
• E2F4 promoter occupancy is globally associated with p53-repression targets, but not with p53 activation targets. (PMID:24096481)
• cancer-associated E2F4 mutations enhance the capacity of colorectal cancer cells to grow without anchorage, thereby contributing to tumor progression. (PMID:24100580)
• Analysis data from a panel of cell cycle transcription factors (E2F1, E2F4, E2F6, and GABPA) finds that a set of core cell cycle genes regulated in both U2OS and HeLa cells are bound by multiple cell cycle transcription factors. (PMID:24109597)
• Authors show that BRCA1 and RAD17 genes, whose derived proteins play a pivotal role in DNA damage repair, are transcriptional targets of gain-of-function mutant p53 proteins. (PMID:25650659)
• Data suggest that aberrant cell cycle activation in Ewing sarcoma is due to the de-repression of transcription factor E2F targets of transcriptional induction and physical recruitment of E2F3 by fusion protein EWS-FLI1 replacing E2F4 on their promoters. (PMID:25712098)
• This study found evidence that the number of triplet AGC repeats in the E2F4 gene may play a role in the susceptibility to early-onset colorectal cancer. (PMID:26343152)
• cell cycle-dependent transcription of the TRAIP gene by E2F1, E2F2, and E2F4 and rapid protein degradation leads to cell cycle-dependent expression with a maximum in G2/M (PMID:26369285)
• PHF8 reduces the H3K9me2 level at the E2F4 transcriptional start site, demonstrating a direct function of PHF8 in endothelial E2F4 gene regulation (PMID:26751588)
• Integrative genomic analyses confirm that E2F4 or E2F1 expression level is high in liposarcoma patients which associate with unfavorable prognosis. (PMID:26856934)
• The authors found that phosphorylation of residues S650 and S975 in p107 weakens the E2F4 transactivation domain binding. (PMID:27567532)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	e2f4	ENSDARG00000101578
mus_musculus	E2f4	ENSMUSG00000014859
rattus_norvegicus	E2f4	ENSRNOG00000015708

Paralogs (7): E2F2 (ENSG00000007968), E2F1 (ENSG00000101412), E2F3 (ENSG00000112242), E2F8 (ENSG00000129173), E2F5 (ENSG00000133740), E2F7 (ENSG00000165891), E2F6 (ENSG00000169016)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:103012) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 55 distinct phenotype terms.

Mouse phenotype (MP)	Records
decreased hematocrit	2
macrocytosis	2
short snout	2
decreased body size	2
abnormal vocalization	2
anemia	2
increased number of Howell-Jolly bodies	2
postnatal lethality, incomplete penetrance	2
abnormal middle ear morphology	1
decreased granulocyte number	1
broad head	1
abnormal intestine morphology	1
abnormal intestinal epithelium morphology	1
abnormal crypts of Lieberkuhn morphology	1
abnormal small intestine morphology	1
abnormal intestinal mucosa morphology	1
decreased thymocyte number	1
spontaneous skin ulceration	1
decreased body weight	1
hyperresponsive	1
dehydration	1
thymus hypoplasia	1
increased susceptibility to otitis media	1
rhinitis	1
hemorrhage	1

+30 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	Q08DY6	93.0%	Diamond
Xenopus laevis	Q6DE14	66.5%	Diamond
Gallus gallus	Q90977	62.6%	Diamond
Arabidopsis thaliana	Q8RWL0	57.0%	Diamond
Caenorhabditis elegans	A5HWA8	50.7%	Diamond
Xenopus tropicalis	F6YVB9	49.6%	Diamond
Drosophila melanogaster	Q27368	44.8%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
EXOC3L1	protein-coding	283849
HSF4	protein-coding	3299
FBXL8	protein-coding	55336
MATCAP1	protein-coding	653319
NOL3	protein-coding	8996
MIR328	ncRNA	442901
ELMO3	protein-coding	79767
TMEM208	protein-coding	29100
FHOD1	protein-coding	29109
SLC9A5	protein-coding	6553
TRADD	protein-coding	8717

Protein

Protein identifiers

Transcription factor E2F4 — Q16254 (reviewed: Q16254)

All UniProt accessions (5): Q16254, H3BMP3, H3BTM3, H3BVE4, I3L1B6

UniProt curated annotations — full annotation on UniProt →

Function. Transcription activator that binds DNA cooperatively with DP proteins through the E2 recognition site, 5’-TTTC[CG]CGC-3’ found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The DRTF1/E2F complex functions in the control of cell-cycle progression from G1 to S phase. E2F4 binds with high affinity to RBL1 and RBL2. In some instances can also bind RB1. Specifically required for multiciliate cell differentiation: together with MCIDAS and E2F5, binds and activate genes required for centriole biogenesis.

Subunit / interactions. Component of the DRTF1/E2F transcription factor complex. Binds cooperatively with TFDP1/Dp-1 to E2F sites. The E2F4/TFDP1 dimer interacts preferentially with pocket protein RBL1, which inhibits the E2F transactivation domain. Lower affinity interaction has been found with retinoblastoma protein RB1. Interacts with TRRAP, which probably mediates its interaction with histone acetyltransferase complexes, leading to transcription activation. Interacts with HCFC1. Component of the DREAM complex (also named LINC complex) at least composed of E2F4, E2F5, LIN9, LIN37, LIN52, LIN54, MYBL1, MYBL2, RBL1, RBL2, RBBP4, TFDP1 and TFDP2. The complex exists in quiescent cells where it represses cell cycle-dependent genes. It dissociates in S phase when LIN9, LIN37, LIN52 and LIN54 form a subcomplex that binds to MYBL2. Interacts with PML (isoform PML-1, isoform PML-2, isoform PML-3, isoform PML-4 and isoform PML-5). Interacts with CEBPA (when phosphorylated).

Subcellular location. Nucleus.

Tissue specificity. Found in all tissue examined including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas.

Post-translational modifications. Differentially phosphorylated in vivo.

Polymorphism. The poly-Ser region of E2F4 is polymorphic and the number of Ser varies in the population (from 8 to 17). The variation might be associated with tumorigenesis.

Similarity. Belongs to the E2F/DP family.

RefSeq proteins (1): NP_001941* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003316	E2F_WHTH_DNA-bd_dom	Domain
IPR015633	E2F	Family
IPR032198	E2F_CC-MB	Domain
IPR036388	WH-like_DNA-bd_sf	Homologous_superfamily
IPR036390	WH_DNA-bd_sf	Homologous_superfamily
IPR037241	E2F-DP_heterodim	Homologous_superfamily

Pfam: PF02319, PF16421

UniProt features (37 total): strand 9, helix 7, region of interest 6, compositionally biased region 3, turn 3, short sequence motif 2, modified residue 2, sequence variant 2, initiator methionine 1, chain 1, DNA-binding region 1

Structure

Experimental structures (PDB)

2 structures by resolution:

PDB	Title	Method	Resolution (Å)
5TUU	Crystal structure of the E2F4-DP1 coiled coil and marked-box domains	X-RAY DIFFRACTION	2.25
1CF7	STRUCTURAL BASIS OF DNA RECOGNITION BY THE HETERODIMERIC CELL CYCLE TRANSCRIPTION FACTOR …	X-RAY DIFFRACTION	2.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q16254-F1	65.56	0.23

Human Protein Atlas

Protein class: Predicted intracellular proteins, Transcription factors, Helix-turn-helix domains

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm

Antibody reliability (HPA): IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2)

Type	Positions
N-acetylalanine	2
Phosphoserine	384

Function

Pathways and Gene Ontology

Reactome pathways

6 curated (TAS) of 25; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

25 pathways:

ID	Pathway	Evidence
R-HSA-69656	Cyclin A:Cdk2-associated events at S phase entry	curated
R-HSA-69231	Cyclin D associated events in G1	curated
R-HSA-69202	Cyclin E associated events during G1/S transition	curated
R-HSA-1538133	G0 and Early G1	curated
R-HSA-2173796	SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription	curated
R-HSA-6804114	TP53 Regulates Transcription of Genes Involved in G2 Cell Cycle Arrest	curated
R-HSA-1640170	Cell Cycle	—
R-HSA-69278	Cell Cycle, Mitotic	—
R-HSA-69236	G1 Phase	—
R-HSA-69206	G1/S Transition	—
R-HSA-69205	G1/S-Specific Transcription	electronic
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-212436	Generic Transcription Pathway	—
R-HSA-453279	Mitotic G1 phase and G1/S transition	—
R-HSA-73857	RNA Polymerase II Transcription	—
R-HSA-69242	S Phase	—
R-HSA-162582	Signal Transduction	—
R-HSA-170834	Signaling by TGF-beta Receptor Complex	—
R-HSA-9006936	Signaling by TGFB family members	—
R-HSA-6791312	TP53 Regulates Transcription of Cell Cycle Genes	—
R-HSA-1362277	Transcription of E2F targets under negative control by DREAM complex	electronic
R-HSA-1362300	Transcription of E2F targets under negative control by p107 (RBL1) and p130 (RBL2) in complex with HDAC1	electronic
R-HSA-3700989	Transcriptional Regulation by TP53	—
R-HSA-2173793	Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer	—
R-HSA-9945556	Transcriptional regulation of multiciliogenesis	electronic

MSigDB gene sets: 189 (showing top): RNGTGGGC_UNKNOWN, GOBP_EPITHELIUM_DEVELOPMENT, REACTOME_G1_S_SPECIFIC_TRANSCRIPTION, REACTOME_SIGNALING_BY_TGF_BETA_RECEPTOR_COMPLEX, chr16q22, CCAWYNNGAAR_UNKNOWN, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOBP_EPITHELIAL_CELL_DEVELOPMENT, AP2_Q3, GOBP_REGULATION_OF_ANATOMICAL_STRUCTURE_SIZE, GOBP_ANIMAL_ORGAN_MORPHOGENESIS, GOBP_CENTRIOLE_ASSEMBLY, GGAANCGGAANY_UNKNOWN, GOBP_CILIUM_ORGANIZATION, GOBP_REGULATION_OF_CELL_SIZE

GO Biological Process (9): DNA-templated transcription (GO:0006351), regulation of DNA-templated transcription (GO:0006355), regulation of transcription by RNA polymerase II (GO:0006357), motile cilium assembly (GO:0044458), negative regulation of DNA-templated transcription (GO:0045892), positive regulation of transcription by RNA polymerase II (GO:0045944), centriole assembly (GO:0098534), multi-ciliated epithelial cell differentiation (GO:1903251), cell projection organization (GO:0030030)

GO Molecular Function (11): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), DNA binding (GO:0003677), DNA-binding transcription factor activity (GO:0003700), protein domain specific binding (GO:0019904), protein dimerization activity (GO:0046983), sequence-specific double-stranded DNA binding (GO:1990837), promoter-specific chromatin binding (GO:1990841), chromatin binding (GO:0003682), protein binding (GO:0005515)

GO Cellular Component (6): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), RNA polymerase II transcription regulator complex (GO:0090575), transcription regulator complex (GO:0005667)

Reactome top-level categories

14 top-level categories:

Category	Pathways
Mitotic G1 phase and G1/S transition	3
G0 and Early G1	2
G1/S Transition	2
Generic Transcription Pathway	2
Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer	1
TP53 Regulates Transcription of Cell Cycle Genes	1
G1 Phase	1
S Phase	1
Assembly of the 9+2 motile cilia	1
Signaling by TGFB family members	1
RNA Polymerase II Transcription	1
Signaling by TGF-beta Receptor Complex	1
Cell Cycle, Mitotic	1
Transcriptional Regulation by TP53	1

GO top-level categories

38 GO namespaces:

Category	Terms
regulation of DNA-templated transcription	3
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
cellular anatomical structure	3
DNA-templated transcription	2
transcription by RNA polymerase II	2
regulation of transcription by RNA polymerase II	2
protein binding	2
binding	2
gene expression	1
RNA biosynthetic process	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
cilium assembly	1
negative regulation of RNA biosynthetic process	1
positive regulation of DNA-templated transcription	1
microtubule organizing center organization	1
membraneless organelle assembly	1
columnar/cuboidal epithelial cell differentiation	1
cellular component organization	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
DNA-binding transcription factor activity, RNA polymerase II-specific	1
DNA-binding transcription activator activity	1
positive regulation of transcription by RNA polymerase II	1
nucleic acid binding	1
transcription cis-regulatory region binding	1
transcription regulator activity	1
double-stranded DNA binding	1
sequence-specific DNA binding	1
chromatin binding	1
chromosome	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
transcription regulator complex	1
nuclear protein-containing complex	1
protein-containing complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 12 of 26 annotations. The rest are phylogenetic / computational / electronic (IEA).

12 experimentally-supported GO terms:

GO term	NS	Evidence
positive regulation of transcription by RNA polymerase II	BP	direct assay
regulation of DNA-templated transcription	BP	direct assay
chromatin	CC	direct assay
cytoplasm	CC	direct assay
nucleoplasm	CC	direct assay
DNA binding	MF	mutant phenotype
DNA-binding transcription activator activity, RNA polymerase II-specific	MF	direct assay
DNA-binding transcription factor activity	MF	direct assay
RNA polymerase II cis-regulatory region sequence-specific DNA binding	MF	direct assay
promoter-specific chromatin binding	MF	direct assay
protein domain specific binding	MF	physical interaction
sequence-specific double-stranded DNA binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 1,540 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
E2F4	LIN54	Q6MZP7	836
E2F4	RBL2	Q08999	824
E2F4	LIN37	Q96GY3	799
E2F4	LIN9	Q5TKA1	797
E2F4	TFDP3	Q5H9I0	785
E2F4	TFDP1	Q14186	773
E2F4	LIN52	Q52LA3	760
E2F4	MYBL2	P10244	733
E2F4	MYC	P01106	726
E2F4	TP53	P04637	676
E2F4	CCND1	P24385	673
E2F4	CDC6	Q99741	663
E2F4	CDKN2A	P42771	662
E2F4	SMAD3	P84022	655
E2F4	CDKN1A	P38936	648

IntAct

Human interaction partners of E2F4 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

27 partners by confidence:

Partner	Interaction type	MIscore	Records
TFDP1	physical association	0.810	3
TFDP2	direct interaction	0.770	4
RB1	physical association	0.760	3
RBL2	physical association	0.750	2
LIN9	physical association	0.670	1
KAT5	physical association	0.560	3
PIN1	physical association	0.560	3
E7	physical association	0.560	1
BRAF	physical association	0.550	4
CDK4	physical association	0.530	2
LRRK2	direct interaction	0.440	1
MFHAS1	direct interaction	0.440	1
L3MBTL3	physical association	0.400	1
MYBL2	physical association	0.400	1
RBL1	physical association	0.400	1
TRRAP	physical association	0.400	1
AP3S2	physical association	0.370	1
CHMP2A	physical association	0.370	1
ID3	physical association	0.370	1
PCM1	physical association	0.370	1
POLR1D	physical association	0.370	1
PML	association	0.350	1
SMAD4	proximity	0.270	4
AKT1	proximity	0.270	1
EGFR	proximity	0.270	1
PTEN	proximity	0.270	1
PTPN11	proximity	0.270	1

BioGRID (606 interactions; top human partners by supporting records in a sample of 600 records): RBL2 (Affinity Capture-Western; 12 records), RBL1 (Affinity Capture-Western; 11 records), RB1 (Affinity Capture-Western; 9 records), TFDP1 (Affinity Capture-Western; 9 records), LIN9 (Affinity Capture-Western; 7 records), TFDP2 (Affinity Capture-MS; 6 records), USP2 (Affinity Capture-MS; 6 records), CTBP1 (Affinity Capture-Western; 4 records), HDAC1 (Affinity Capture-Western; 4 records), LIN37 (Affinity Capture-MS; 4 records), CCDC183 (Affinity Capture-MS; 3 records), CDK2 (Affinity Capture-MS; 3 records), DNMT3L (Reconstituted Complex; 3 records), LIN54 (Affinity Capture-Western; 3 records), TFDP3 (Affinity Capture-MS; 3 records)

SIGNOR signaling

3 signaling interactions:

A	Effect	B	Mechanism
E2F4	down-regulates	PPARG	“transcriptional regulation”
E2F4	“down-regulates quantity by repression”	PPARG	“transcriptional regulation”
E2F4	“down-regulates quantity by repression”	BIRC5	“transcriptional regulation”

Protein complexes (CORUM) (10)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

10 complexes by size:

Complex	Subunits	Members
dREAM-like complex	8	TFDP1, E2F4, LIN37, LIN52, LIN54, LIN9, RBBP4, RBL2
LINC complex, quiescent cells	7	LIN54, LIN9, RBBP4, RBL2, E2F4, LIN37, LIN52
SMAD3/4-E2F4/5-p107-DP1 complex	6	E2F5, RBL1, SMAD3, SMAD4, TFDP1, E2F4
★ RBL2 complex (DNMT1, E2F4, E2F5, HDAC1, RBL2, SUV39H1)	6	DNMT1, E2F4, E2F5, HDAC1, RBL2, SUV39H1
★ RBL2 complex (EP300, E2F4, E2F5, HDAC1, RBL2, SUV39H1)	6	E2F4, E2F5, EP300, HDAC1, RBL2, SUV39H1
SMAD3-E2F4/5-p107-DP1 complex	5	RBL1, SMAD3, TFDP1, E2F4, E2F5
E2F4-p107-cyclinA complex	3	CCNA2, E2F4, RBL1
E2F4-p107-cyclinE complex	3	CCNE1, E2F4, RBL1
RB1(hypophosphorylated)-E2F4 complex	2	E2F4, RB1
E2F4-p130 complex	2	RBL2, E2F4

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 27 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Transcription of E2F targets under negative control by p107 (RBL1) and p130 (RBL2) in complex with HDAC1	6	156.8×	2e-10
Transcription of E2F targets under negative control by DREAM complex	5	118.2×	3e-08
G0 and Early G1	6	114.6×	8e-10
Cyclin E associated events during G1/S transition	7	86.9×	2e-10
Cyclin A:Cdk2-associated events at S phase entry	7	80.8×	2e-10
G1/S-Specific Transcription	5	77.6×	2e-07
Cyclin D associated events in G1	6	60.8×	3e-08
G1/S Transition	5	50.7×	2e-06

GO biological processes:

GO term	Partners	Fold	FDR
regulation of cell cycle	7	20.1×	1e-05

Disease & clinical

Genetic variants

Variant evidence for E2F4: 67 ClinVar records (0 pathogenic / likely pathogenic); 6 GWAS associations.

ClinVar

67 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	51
Likely benign	2
Benign	2

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 20 predictions of 1,072):

Position(s)	Effect	Δscore	Sites
16:67192381	donor_gain	1.0000
16:67192391	donor_gain	1.0000
16:67192822	donor_gain	1.0000
16:67193198	donor_gain	1.0000
16:67194396–67194397	acceptor_loss	1.0000	5
16:67194684–67194685	acceptor_loss	1.0000	3
16:67195839	acceptor_gain	1.0000
16:67197865–67197866	acceptor_loss	1.0000	5
16:67192360	donor_gain	0.9900
16:67192375	donor_gain	0.9900

AlphaMissense

1,201 missense substitutions predicted likely pathogenic (of 2,687 scored), across 240 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D60	8	1.000	1.000
N63	8	1.000	1.000
N77	8	1.000	1.000
S21	8	0.999	1.000
F29	8	0.999	1.000
D42	8	0.999	1.000
N127	8	0.984	0.998
D404	8	0.980	0.995
D407	8	0.980	0.996
F149	8	0.976	0.998
D48	8	0.975	0.998
S124	8	0.974	0.999
D391	8	0.974	0.996
D144	8	0.973	0.992
F406	8	0.968	0.999
N134	8	0.966	0.996
H18	8	0.964	0.997
F377	8	0.961	0.991
D38	8	0.955	0.996
S185	8	0.946	0.999

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	3.17e-05
Glioblastoma Multiforme (validation)	favorable	5.47e-05

Disease associations

OMIM: gene MIM:600659 | disease phenotypes:

GWAS associations

6 associations:

Study	Trait	p-value
GCST90002397_647	Mean spheric corpuscular volume	5e-27
GCST90002392_10	Mean corpuscular volume	1e-15
GCST90002396_388	Mean reticulocyte volume	8e-15
GCST90002397_646	Mean spheric corpuscular volume	5e-14
GCST90002390_264	Mean corpuscular hemoglobin	2e-12
GCST90002396_387	Mean reticulocyte volume	4e-10

EFO canonical traits (from GWAS)

2 canonical traits:

EFO ID	Trait name
EFO:0004527	mean corpuscular hemoglobin
EFO:0010701	mean reticulocyte volume

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4630726 (PROTEIN FAMILY)

Drugs acting on a complex or family that includes this protein

Curated ChEMBL mechanism-of-action drugs whose target is a protein complex or family of ≤10 members that includes E2F4 — the drug acts on the assembly or class, not necessarily on this subunit alone.

1 drugs via a complex or family:

Drug	Target (ChEMBL)	Members	Max phase
EDIFOLIGIDE SODIUM	E2F	8	3

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

50 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	4
Valproic Acid	affects expression, decreases expression, increases expression, increases methylation	4
Arsenic Trioxide	increases expression	2
Benzo(a)pyrene	affects methylation, increases methylation	2
Estradiol	increases expression, affects expression	2
Fluorouracil	affects binding, affects reaction, increases reaction, decreases expression	2
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
juglone	decreases reaction, increases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	affects expression	1
afimoxifene	decreases reaction, increases expression	1
cypermethrin	increases expression	1
3,4,5,3’,4’-pentachlorobiphenyl	affects expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
coptisine	affects binding, decreases reaction, decreases expression	1
cylindrospermopsin	increases expression	1
2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	increases expression, decreases reaction	1
ICG 001	increases expression	1
Rosiglitazone	decreases expression	1
Sunitinib	increases expression	1
Glyphosate	decreases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance, increases expression	1
Cadmium	increases abundance, increases expression	1
Caffeine	increases phosphorylation	1
Chelating Agents	affects binding, decreases expression	1
Copper	affects binding, decreases expression	1
Diazinon	decreases methylation	1
Dibutyl Phthalate	increases expression	1
Doxorubicin	decreases expression	1

Cellosaurus cell lines

7 cell lines: 3 embryonic stem cell, 3 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A1C4	SEES3-1V human E2F4, clone1	Embryonic stem cell	Male
CVCL_A1C5	SEES3-1V human E2F4, clone2	Embryonic stem cell	Male
CVCL_A1C6	SEES3-1V human E2F4, clone3	Embryonic stem cell	Male
CVCL_B2W6	Abcam HEK293T E2F4 KO	Transformed cell line	Female
CVCL_D8KK	Ubigene HCT 116 E2F4 KO	Cancer cell line	Male
CVCL_GZ79	K562 eGFP-E2F4	Cancer cell line	Female
CVCL_HA12	MCF-7 eGFP-E2F4	Cancer cell line	Female

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.