EGFL7

Summary

EGFL7 (EGF like domain multiple 7, HGNC:20594) is a protein-coding gene on chromosome 9q34.3, encoding Epidermal growth factor-like protein 7 (Q9UHF1). Regulates vascular tubulogenesis in vivo.

This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 51162 — RefSeq curated summary.

At a glance

• GWAS associations: 5
• Clinical variants (ClinVar): 77 total
• Druggable target: yes
• MANE Select transcript: NM_016215

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20594
Approved symbol	EGFL7
Name	EGF like domain multiple 7
Location	9q34.3
Locus type	gene with protein product
Status	Approved
Aliases	ZNEU1
Ensembl gene	ENSG00000172889
Ensembl biotype	protein_coding
OMIM	608582
Entrez	51162

Gene structure

Transcript identifiers

Ensembl transcripts: 91 — 89 protein_coding, 2 protein_coding_CDS_not_defined

ENST00000308874, ENST00000371698, ENST00000371699, ENST00000406555, ENST00000490469, ENST00000492002, ENST00000492862, ENST00000893633, ENST00000893634, ENST00000893635, ENST00000893636, ENST00000893637, ENST00000893638, ENST00000893639, ENST00000893640, ENST00000893641, ENST00000893642, ENST00000893643, ENST00000893644, ENST00000893645, ENST00000893646, ENST00000893647, ENST00000893648, ENST00000893649, ENST00000893650, ENST00000893651, ENST00000893652, ENST00000893653, ENST00000893654, ENST00000893655, ENST00000893656, ENST00000893657, ENST00000893658, ENST00000893659, ENST00000893660, ENST00000893661, ENST00000893662, ENST00000893663, ENST00000893664, ENST00000893665, ENST00000893666, ENST00000893667, ENST00000893668, ENST00000893669, ENST00000893670, ENST00000893671, ENST00000893672, ENST00000893673, ENST00000893674, ENST00000893675, ENST00000917150, ENST00000917151, ENST00000917152, ENST00000917153, ENST00000917154, ENST00000965523, ENST00000965524, ENST00000965525, ENST00000965526, ENST00000965527, ENST00000965528, ENST00000965529, ENST00000965530, ENST00000965531, ENST00000965532, ENST00000965533, ENST00000965534, ENST00000965535, ENST00000965536, ENST00000965537, ENST00000965538, ENST00000965539, ENST00000965540, ENST00000965541, ENST00000965542, ENST00000965543, ENST00000965544, ENST00000965545, ENST00000965546, ENST00000965547, ENST00000965548, ENST00000965549, ENST00000965550, ENST00000965551, ENST00000965552, ENST00000965553, ENST00000965554, ENST00000965555, ENST00000965556, ENST00000965557, ENST00000965558

RefSeq mRNA: 2 — MANE Select: NM_016215 NM_016215, NM_201446

CCDS: CCDS7002

Canonical transcript exons

ENST00000308874 — 11 exons

Exon	Start	End
ENSE00001378975	136662916	136663108
ENSE00001389924	136664692	136664785
ENSE00001821302	136663408	136663623
ENSE00003459942	136670169	136670330
ENSE00003549489	136669914	136670009
ENSE00003618358	136670950	136671014
ENSE00003633771	136669606	136669721
ENSE00003791331	136668557	136668673
ENSE00003890216	136671926	136672088
ENSE00003893180	136668241	136668362
ENSE00003894609	136672264	136672678

Expression profiles

Bgee: expression breadth ubiquitous, 250 present calls, max score 98.74.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 45.7239 / max 2004.1625, expressed in 1548 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
99525	38.2703	458
99527	6.7085	1494
99528	0.3832	229
99531	0.1393	93
99526	0.1141	52
99529	0.0872	40
99522	0.0214	8

Top tissues by expression

282 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right lung	UBERON:0002167	98.74	gold quality
apex of heart	UBERON:0002098	98.70	gold quality
upper lobe of left lung	UBERON:0008952	98.57	gold quality
omental fat pad	UBERON:0010414	98.20	gold quality
peritoneum	UBERON:0002358	98.15	gold quality
right lobe of thyroid gland	UBERON:0001119	97.76	gold quality
body of uterus	UBERON:0009853	97.55	gold quality
upper lobe of lung	UBERON:0008948	97.42	gold quality
adipose tissue of abdominal region	UBERON:0007808	97.39	gold quality
left uterine tube	UBERON:0001303	97.37	gold quality
right atrium auricular region	UBERON:0006631	97.16	gold quality
spleen	UBERON:0002106	97.01	gold quality
left lobe of thyroid gland	UBERON:0001120	97.00	gold quality
endocervix	UBERON:0000458	96.99	gold quality
peripheral nervous system	UBERON:0000010	96.84	gold quality
tibial nerve	UBERON:0001323	96.84	gold quality
subcutaneous adipose tissue	UBERON:0002190	96.50	gold quality
right coronary artery	UBERON:0001625	96.44	gold quality
right frontal lobe	UBERON:0002810	96.33	gold quality
ectocervix	UBERON:0012249	96.32	gold quality
cardiac atrium	UBERON:0002081	96.20	gold quality
heart left ventricle	UBERON:0002084	96.18	gold quality
metanephros cortex	UBERON:0010533	96.07	gold quality
anterior cingulate cortex	UBERON:0009835	95.94	gold quality
cingulate cortex	UBERON:0003027	95.91	gold quality
cardiac ventricle	UBERON:0002082	95.86	gold quality
lower esophagus muscularis layer	UBERON:0035833	95.79	gold quality
lower esophagus	UBERON:0013473	95.76	gold quality
mucosa of stomach	UBERON:0001199	95.66	gold quality
thyroid gland	UBERON:0002046	95.31	gold quality

Single-cell (SCXA)

Detected in 40 experiment(s), a significant marker in 38.

Experiment	Marker?	Max mean expression
E-HCAD-24	yes	2751.44
E-MTAB-11268	yes	2609.60
E-MTAB-10042	yes	2061.02
E-HCAD-23	yes	1660.25
E-CURD-88	yes	1408.53
E-GEOD-131882	yes	1368.70
E-MTAB-8221	yes	1347.66
E-MTAB-6701	yes	1344.30
E-GEOD-135922	yes	1341.86
E-MTAB-8530	yes	1301.51
E-GEOD-114530	yes	1240.12
E-MTAB-9906	yes	1054.05
E-HCAD-11	yes	912.76
E-GEOD-124472	yes	824.10
E-MTAB-8410	yes	797.95

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CASZ1, ERG, GATA2

miRNA regulators (miRDB)

9 targeting EGFL7, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-3176	99.25	64.35	954
HSA-MIR-3922-3P	99.25	64.96	1136
HSA-MIR-6846-5P	98.81	65.86	1121
HSA-MIR-6848-5P	98.81	65.49	1126
HSA-MIR-423-5P	98.69	67.48	1522
HSA-MIR-3184-5P	98.56	67.13	1491
HSA-MIR-10400-5P	96.91	66.00	56

Literature-anchored findings (GeneRIF, showing 40)

• is the first identified inhibitor of mural cell migration specifically produced by endothelial cells. (PMID:14592969)
• Human EGFL7 may protect endothelial cell from hyperoxia-induced apoptosis by inhibition of mitochondria-dependent apoptosis pathway. (PMID:17934064)
• Intronic miRNAs from tissue-specific transcripts, or their natural absence, make cardinal contributions to cellular gene expression and phenotype. (PMID:18193184)
• The lack of association between expression of miRNA and its host gene EGFL7 suggests their regulation by independent stimuli in colon cancer. (PMID:18521848)
• Mature miR-126 can be generated from three different transcripts of EGFL7 with each one having its own promoter. (PMID:19116145)
• Egfl7 promotes metastasis of hepatocellular carcinoma (HCC) by enhancing cell motility through EGFR-dependent FAK phosphorylation. (PMID:19824075)
• miR-126 can inhibit proliferation of non-small cell lung cancer cells through one of its targets, EGFL7. (PMID:20034472)
• EGFL7 may be used as a predictive marker for glioma prognosis and as a potential therapeutic target for malignant glioma. (PMID:20213100)
• miR-126 can downregulate EGFL7 expression at the protein level in ECV-304 cells. (PMID:20423846)
• Epidermal growth factor-like domain 7 suppresses intercellular adhesion molecule 1 expression in response to hypoxia/reoxygenation injury in human coronary artery endothelial cells. (PMID:20837907)
• Studies indicate that two biologically active miRNAs miR-126 and its complement miR-126*, which are encoded by intron 7 of the egfl7 gene, have been described to mediate vascular functions. (PMID:20953557)
• Two angiogenesis-associated transcripts (Egfl7 and Acvrl1) showed lower expression in early-onset PE versus late-onset pre-eclampsia and versus gestational age-matched controls. (PMID:22013081)
• Heterogeneous methylation in the promoter region of EGFL7 was associated with cancer progression in non-small cell lung cancer. (PMID:22018271)
• Human breast cancer lesions expressing high levels of Egfl7. (PMID:22037871)
• Studies indicate that Egfl7 controls blood vessel development by promoting endothelial cell migration and proliferation. (PMID:22160377)
• Early-onset intrauterine growth restriction at 20-24 weeks’ gestation is associated with higher values of EGFL7 expression in maternal plasma. (PMID:23280513)
• Data indicate that EGFL7 and integrin alphavbeta3 integrin colocalized in vesicular structures in uman umbilical vein endothelial cells (HUVECs). (PMID:23386126)
• Egfl7 expression is thus associated with better prognosis factors and with the absence of lymph node invasion in human breast cancer lesions. (PMID:23404186)
• Egfl7 is significantly upregulated in human epithelial tumor tissues, suggesting Egfl7 to be a potential biomarker for human epithelial tumors, especially liver and breast cancer. (PMID:23558933)
• study provides clinical data indicating a relationship between miRNA-126 and the clinical outcome of metastatic colorectal cancer patients treated with chemotherapy combined with anti-VEGF-A, whereas the impact of EGFL7 is more speculative (PMID:23922111)
• The loss of EGFL7 expression play a role in the development and progression of systemic sclerosis. (PMID:24286167)
• egfl7 is initially expressed in all endothelial cells and then is progressively restricted to veins and to their neighbouring capillaries. (PMID:24595089)
• malignant glioma cells and glioma vascular endothelial cells highly express VE-statin/Egfl7, which is significantly correlated with the degree of malignancy. (PMID:24696719)
• demonstrate significantly reduced Egfl7 expression in pre-eclampsia placentas, concurrent with a downregulation of Notch target genes (PMID:24751645)
• EGFL7 promotes growth of Renal cell carcinoma by facilitating migration and tube formation of endothelial cells. These effects were produced by EGFL7-mediated focal adhesion kinase phosphorylation through combination with epidermal growth factor receptor. (PMID:24815445)
• EGFL7 enhances EGFR-AKT signaling, epithelial-mesenchymal transition, and metastasis of gastric cancer cells. (PMID:24945379)
• EGFL7 may predict response to first-line chemotherapy and bevacizumab in patients with metastatic colorectal cancer (PMID:25140000)
• The aim of the present descriptive study was to analyse the intra-tumoural expressions of epidermal growth factor-like domain 7 (EGFL7) and microRNA-126 (miRNA-126) in primary tumours from patients with stage II-IV colorectal cancer. (PMID:25592646)
• Endothelial cells control pancreatic cell fate at defined stages through EGFL7 signaling. (PMID:25601205)
• Data suggest that, in trophoblast cells, EGFL7 regulates cell migration and invasion/placentation by activating multiple signaling pathways via MAPK, PI3K (phosphatidylinositol 3-kinase), and NOTCH1 (translocation-associated notch protein 1). (PMID:25667199)
• EGFL7, OPN, and PGE2 may have a role in recurrence and metastasis of hepatocellular carcinoma (PMID:25730089)
• High EGFL7 expression promotes migration and Epithelial-Mesenchymal Transition in pancreatic Cancer. (PMID:25987088)
• EGFR mutational analysis is useful in the diagnosis of non-small-cell-lung cancer. (PMID:26288231)
• Loss of EGFL7 expression is associated with Malignant Pleural Mesothelioma. (PMID:26504055)
• The preferential expression of EGFL7 in less differentiated hepatocellular carcinoma compared to VEGF, suggests a possible important role of this angiogenic factor in a later oncogenic and infiltrative/metastatic phase. (PMID:26542361)
• By regulating endothelial cell adhesion, EGFL7 plays a key role in the regulation of glioma angiogenesis. (PMID:26722408)
• A gene expression study was conducted to investigate the levels of Egfl7 and miRNA126-5p in human carotid artery atherosclerotic plaques (PMID:26799121)
• Up-regulated MALAT1 promoted the invasion and metastasis of GC, and the increase of EGFL7 expression was a potential mechanism via altering its H3 histone acetylation level (PMID:27259812)
• In conclusion, miR-126 could inhibit tumor proliferation and angiogenesis of hepatocellular carcinoma by down-regulating EGFL7 expression (PMID:27611944)
• Egfl7 is thus an endogenous and constitutive repressor of blood vessel endothelial cell activation in normal and inflammatory conditions and participates in a loop of regulation of activation of these cells by pro-inflammatory cytokines. (PMID:27650497)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	egfl7	ENSDARG00000100657
mus_musculus	Egfl7	ENSMUSG00000026921
rattus_norvegicus	Egfl7	ENSRNOG00000019388

Paralogs (5): CFC1 (ENSG00000136698), CFC1B (ENSG00000152093), CRIPTO3 (ENSG00000225366), CRIPTO (ENSG00000241186), EGFL8 (ENSG00000241404)

Protein

Protein identifiers

Epidermal growth factor-like protein 7 — Q9UHF1 (reviewed: Q9UHF1)

Alternative names: Multiple epidermal growth factor-like domains protein 7, NOTCH4-like protein, Vascular endothelial statin, Zneu1

All UniProt accessions (2): Q9UHF1, R4GMT3

UniProt curated annotations — full annotation on UniProt →

Function. Regulates vascular tubulogenesis in vivo. Inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cell adhesion to the extracellular matrix and angiogenesis.

Subunit / interactions. Interacts with ITGAV/ITGB3 in an RGD-dependent manner, increasing endothelial cell’s motility.

Subcellular location. Secreted. Extracellular space.

Miscellaneous. Endothelial cells depleted in EGFL7 by siRNAs display dramatic alterations in adhesion, morphology, and sprouting. The defects are in part due to diminished RhoA expression and impaired focal adhesion localization.

RefSeq proteins (2): NP_057299, NP_958854 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000742	EGF	Domain
IPR001881	EGF-like_Ca-bd_dom	Domain
IPR009030	Growth_fac_rcpt_cys_sf	Homologous_superfamily
IPR011489	EMI_domain	Domain
IPR013111	EGF_extracell	Domain
IPR018097	EGF_Ca-bd_CS	Conserved_site
IPR050969	Dev_Signal_Modulators	Family

Pfam: PF07546, PF07974, PF14670

UniProt features (21 total): disulfide bond 9, sequence variant 4, domain 3, signal peptide 1, chain 1, mutagenesis site 1, coiled-coil region 1, short sequence motif 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9UHF1-F1	76.11	0.32

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (9): 107–117, 111–123, 125–134, 141–152, 148–161, 163–176, 31–89, 56–62, 88–102

Mutagenesis-validated functional residues (1):

Position	Phenotype
131	disrupts rgd motif and results in a 79% loss of cell adhesion.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 132 (showing top): VERHAAK_AML_WITH_NPM1_MUTATED_DN, GOCC_CELL_SURFACE, GOBP_NEGATIVE_REGULATION_OF_NOTCH_SIGNALING_PATHWAY, HERNANDEZ_MITOTIC_ARREST_BY_DOCETAXEL_2_DN, VART_KSHV_INFECTION_ANGIOGENIC_MARKERS_UP, RANKIN_ANGIOGENIC_TARGETS_OF_VHL_HIF2A_DN, GOBP_BLOOD_VESSEL_MORPHOGENESIS, GOBP_REGULATION_OF_NOTCH_SIGNALING_PATHWAY, GOBP_VASCULOGENESIS, RYTTCCTG_ETS2_B, ELK1_01, GOBP_EPITHELIAL_CELL_PROLIFERATION, GATA4_Q3, GOMF_SIGNALING_RECEPTOR_BINDING, GOBP_POSITIVE_REGULATION_OF_ENDOTHELIAL_CELL_PROLIFERATION

GO Biological Process (7): angiogenesis (GO:0001525), blood vessel development (GO:0001568), vasculogenesis (GO:0001570), positive regulation of endothelial cell proliferation (GO:0001938), cell adhesion (GO:0007155), negative regulation of Notch signaling pathway (GO:0045746), cell differentiation (GO:0030154)

GO Molecular Function (3): signaling receptor binding (GO:0005102), calcium ion binding (GO:0005509), protein binding (GO:0005515)

GO Cellular Component (3): extracellular region (GO:0005576), cell surface (GO:0009986), extracellular matrix (GO:0031012)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
blood vessel morphogenesis	2
cellular anatomical structure	2
anatomical structure formation involved in morphogenesis	1
vasculature development	1
anatomical structure development	1
cell differentiation	1
endothelial cell proliferation	1
regulation of endothelial cell proliferation	1
positive regulation of epithelial cell proliferation	1
cellular process	1
Notch signaling pathway	1
regulation of Notch signaling pathway	1
negative regulation of signal transduction	1
cellular developmental process	1
protein binding	1
metal ion binding	1
binding	1
external encapsulating structure	1

Protein interactions and networks

STRING

1414 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
EGFL7	SPRED1	Q7Z699	808
EGFL7	NOTCH4	Q99466	770
EGFL7	EGF	P01133	625
EGFL7	ESAM	Q96AP7	580
EGFL7	JAG1	P78504	576
EGFL7	NOTCH3	Q9UM47	575
EGFL7	NOTCH2	Q04721	557
EGFL7	PIK3R2	O00459	533
EGFL7	JAG2	Q9Y219	514
EGFL7	EGFR	P00533	505
EGFL7	CEP85L	Q5SZL2	451
EGFL7	CRK	P46108	440
EGFL7	ADAMTS2	O95450	436
EGFL7	ADAMTS4	O75173	436
EGFL7	CCN3	P48745	423

IntAct

115 interactions, top by confidence:

A	B	Type	Score
HOXA1	EGFL7	psi-mi:“MI:0915”(physical association)	0.670
EGFL7	HOXA1	psi-mi:“MI:0915”(physical association)	0.670
VWCE	HSPA5	psi-mi:“MI:0914”(association)	0.640
HGS	EGFL7	psi-mi:“MI:0915”(physical association)	0.560
HEXIM2	EGFL7	psi-mi:“MI:0915”(physical association)	0.560
SPAG8	EGFL7	psi-mi:“MI:0915”(physical association)	0.560
HSD3B7	EGFL7	psi-mi:“MI:0915”(physical association)	0.560
EGFL7	MID2	psi-mi:“MI:0915”(physical association)	0.560
EGFL7	GNE	psi-mi:“MI:0915”(physical association)	0.560
RASSF10	EGFL7	psi-mi:“MI:0915”(physical association)	0.560
KLRG2	GXYLT2	psi-mi:“MI:0914”(association)	0.530
VWCE	ZNF316	psi-mi:“MI:0914”(association)	0.530
DLK1	TCAF2	psi-mi:“MI:0914”(association)	0.530
SPINT2	UPK3BL1	psi-mi:“MI:0914”(association)	0.530
PLA2G10	CHEK1	psi-mi:“MI:0914”(association)	0.530
PIGT	ZNF609	psi-mi:“MI:0914”(association)	0.530
ADAM33	LRP5	psi-mi:“MI:0914”(association)	0.530
ADAM21	PLXNA2	psi-mi:“MI:0914”(association)	0.530
EGFL8	MPO	psi-mi:“MI:0914”(association)	0.530
KCTD17	CBX4	psi-mi:“MI:0914”(association)	0.530
NEC1	EGFL7	psi-mi:“MI:0915”(physical association)	0.370
LMP1	EGFL7	psi-mi:“MI:0915”(physical association)	0.370

BioGRID (114): EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS), EGFL7 (Affinity Capture-MS)

ESM2 similar proteins: A0A5F4BST2, A0PJX4, A0RZB4, A1L515, A2A9Q0, A2BDG0, A6QQ85, A6XN32, A9JSM3, B0FP48, D3YZZ2, D4A2Q0, E5RIL1, F1SAM7, P01183, Q1RMK9, Q3UPR0, Q3ZCQ3, Q5BIV7, Q5BIV9, Q5BK01, Q5GH56, Q5GH64, Q5GH72, Q5SNT2, Q5T7M4, Q6IEE6, Q6PRD1, Q6UWJ8, Q70RD5, Q864V4, Q86UD0, Q8BWU1, Q8BX43, Q8CCB5, Q8IVY1, Q8K064, Q8K2Y3, Q8K5A9, Q8N9H8

Diamond homologs: A1A5Y0, A2VCU8, A4IGL7, A5A8Y8, A6QR11, B5DFC9, O75095, O88322, P07996, P10493, P14585, P35441, P35448, P82279, P98118, Q14112, Q20911, Q24025, Q28178, Q2PC93, Q2VWQ2, Q3MHH9, Q5FW85, Q5R3Z7, Q61220, Q62918, Q62919, Q6AZ60, Q6GUQ1, Q6MG84, Q75N90, Q7T3Q2, Q7ZXL5, Q80T14, Q8AVH7, Q8AWW5, Q8VHS2, Q90827, Q90ZD5, Q91X17

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
CASZ1	“up-regulates quantity”	EGFL7	“transcriptional regulation”
EGFL7	up-regulates	Neurogenesis
EGFL7	“down-regulates activity”	NOTCH	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

77 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	52
Likely benign	5
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

2006 predictions. Top by Δscore:

Variant	Effect	Δscore
9:136668553:GCA:G	acceptor_loss	1.0000
9:136668554:CAGC:C	acceptor_loss	1.0000
9:136668555:A:AG	acceptor_gain	1.0000
9:136668555:AGCC:A	acceptor_gain	1.0000
9:136668556:G:A	acceptor_loss	1.0000
9:136668556:G:GA	acceptor_gain	1.0000
9:136668556:GCC:G	acceptor_gain	1.0000
9:136668556:GCCG:G	acceptor_gain	1.0000
9:136668670:ACCGG:A	donor_loss	1.0000
9:136668671:CCG:C	donor_gain	1.0000
9:136668672:CG:C	donor_gain	1.0000
9:136668672:CGGT:C	donor_loss	1.0000
9:136668673:GG:G	donor_gain	1.0000
9:136668673:GGTG:G	donor_loss	1.0000
9:136668674:G:GG	donor_gain	1.0000
9:136668675:T:A	donor_loss	1.0000
9:136669913:GCA:G	acceptor_gain	1.0000
9:136670006:TCAGG:T	donor_loss	1.0000
9:136670007:CAGG:C	donor_loss	1.0000
9:136670009:GGTG:G	donor_loss	1.0000
9:136670011:T:A	donor_loss	1.0000
9:136670168:GAT:G	acceptor_gain	1.0000
9:136671011:GGAG:G	donor_gain	1.0000
9:136671012:GAGG:G	donor_gain	1.0000
9:136671015:G:GA	donor_loss	1.0000
9:136671016:T:G	donor_loss	1.0000
9:136671921:CACAG:C	acceptor_loss	1.0000
9:136671923:CA:C	acceptor_loss	1.0000
9:136671924:A:AG	acceptor_gain	1.0000
9:136671925:G:GA	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000037301 (9:136669195 T>C), RS1000070031 (9:136656892 A>G), RS1000178441 (9:136663399 C>T), RS1000338088 (9:136667919 C>T), RS1000743710 (9:136658962 C>A,T), RS1000760079 (9:136666404 CGCTGGGGGCACGGGGACCGGACT>C), RS1000795334 (9:136664067 C>T), RS1000829795 (9:136664254 T>C), RS1001165648 (9:136668112 G>A,T), RS1001306249 (9:136663639 C>T), RS1001428905 (9:136667979 C>T), RS1001443036 (9:136663901 G>A,C), RS1001633529 (9:136671337 G>A), RS1002128307 (9:136668188 C>A,T), RS1002197615 (9:136667338 C>T)

Disease associations

OMIM: gene MIM:608582 | disease phenotypes: MIM:213300

GenCC curated gene-disease

Mondo (1): Joubert syndrome (MONDO:0018772)

Orphanet (1): Isolated Joubert syndrome (Orphanet:475)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST006627_92	Diastolic blood pressure	4.000000e-17
GCST007680_2	Triiodothyronine levels and thyroxine levels	9.000000e-07
GCST008153_39	Lean body mass	8.000000e-06
GCST009391_2130	Metabolite levels	3.000000e-06
GCST90002396_474	Mean reticulocyte volume	5.000000e-10

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0006336	diastolic blood pressure
EFO:0008392	triiodothyronine measurement
EFO:0004995	lean body mass
EFO:0010376	phosphatidylcholine 34:2 measurement
EFO:0010701	mean reticulocyte volume

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL3712972 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects cotreatment, decreases methylation, increases expression	2
mercuric bromide	decreases expression, affects cotreatment	2
Decitabine	affects cotreatment, increases expression, affects reaction, affects expression	2
Benzo(a)pyrene	affects methylation, increases methylation	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Valproic Acid	affects expression, increases expression, increases methylation	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
Particulate Matter	decreases reaction, increases abundance, increases expression, decreases expression	2
aristolochic acid I	decreases expression	1
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
tris(2-butoxyethyl) phosphate	affects expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
benzo(e)pyrene	increases methylation	1
N,N,N’,N’-tetrakis(2-pyridylmethyl)ethylenediamine	increases expression	1
di-n-butylphosphoric acid	affects expression	1
4-phenylbutyric acid	increases expression, affects cotreatment	1
entinostat	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide	decreases reaction, decreases expression	1
dorsomorphin	decreases expression, affects cotreatment	1
Resveratrol	affects cotreatment, decreases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Air Pollutants	increases abundance, increases expression	1
Vehicle Emissions	decreases expression, decreases reaction	1
Caffeine	increases phosphorylation	1
Folic Acid	decreases expression	1
Lead	decreases expression	1
Methapyrilene	increases methylation	1
Nickel	decreases expression	1

Clinical trials (associated diseases)

3 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00873678	Not specified	COMPLETED	Assessment of the Prevalence of Genes AHI1, NPHP1 and CEP290 in Joubert Syndrome
NCT01401998	Not specified	RECRUITING	ARPKD Database Study
NCT04874909	Not specified	COMPLETED	Classification, Functional Stratification and Biomarkers in Ciliopathy (CILLICORIRCM)