ELMO3

Summary

ELMO3 (engulfment and cell motility 3, HGNC:17289) is a protein-coding gene on chromosome 16q22.1, encoding Engulfment and cell motility protein 3 (Q96BJ8). Involved in cytoskeletal rearrangements required for phagocytosis of apoptotic cells and cell motility.

The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes.

Source: NCBI Gene 79767 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 161 total
• MANE Select transcript: NM_024712

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17289
Approved symbol	ELMO3
Name	engulfment and cell motility 3
Location	16q22.1
Locus type	gene with protein product
Status	Approved
Aliases	FLJ13824, CED12, ELMO-3, CED-12
Ensembl gene	ENSG00000102890
Ensembl biotype	protein_coding
OMIM	606422
Entrez	79767

Gene structure

Transcript identifiers

Ensembl transcripts: 19 — 17 protein_coding, 1 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000360833, ENST00000393997, ENST00000477898, ENST00000571587, ENST00000571638, ENST00000652269, ENST00000874716, ENST00000874717, ENST00000874718, ENST00000874719, ENST00000874720, ENST00000874721, ENST00000874722, ENST00000874723, ENST00000921645, ENST00000921646, ENST00000921647, ENST00000966543, ENST00000966544

RefSeq mRNA: 1 — MANE Select: NM_024712 NM_024712

CCDS: CCDS10833

Canonical transcript exons

ENST00000393997 — 20 exons

Exon	Start	End
ENSE00000565008	67202627	67202790
ENSE00000688697	67201742	67201873
ENSE00000688707	67202176	67202284
ENSE00000688728	67202397	67202533
ENSE00000688748	67202892	67203004
ENSE00000688750	67203119	67203223
ENSE00000853234	67201520	67201642
ENSE00000853235	67201977	67202078
ENSE00000853236	67203327	67203409
ENSE00000853237	67203497	67203583
ENSE00001647573	67199553	67199593
ENSE00003475147	67200451	67200550
ENSE00003481856	67199951	67200001
ENSE00003545817	67199684	67199756
ENSE00003549349	67200657	67200808
ENSE00003562948	67201385	67201435
ENSE00003624678	67200192	67200361
ENSE00003671583	67200890	67200968
ENSE00003841976	67199131	67199404
ENSE00003896054	67203665	67204004

Expression profiles

Bgee: expression breadth ubiquitous, 203 present calls, max score 95.22.

FANTOM5 (CAGE): breadth broad, TPM avg 3.4906 / max 142.7259, expressed in 407 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
154603	3.2170	390
154606	0.1064	59
154604	0.0924	43
154605	0.0748	38

Top tissues by expression

280 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
mucosa of transverse colon	UBERON:0004991	95.22	gold quality
body of pancreas	UBERON:0001150	92.18	gold quality
lower esophagus mucosa	UBERON:0035834	91.85	gold quality
skin of abdomen	UBERON:0001416	90.05	gold quality
adenohypophysis	UBERON:0002196	89.78	gold quality
skin of leg	UBERON:0001511	89.70	gold quality
pituitary gland	UBERON:0000007	89.68	gold quality
right uterine tube	UBERON:0001302	89.60	gold quality
metanephros cortex	UBERON:0010533	88.74	gold quality
esophagus mucosa	UBERON:0002469	88.03	gold quality
right lobe of thyroid gland	UBERON:0001119	87.93	gold quality
transverse colon	UBERON:0001157	87.63	gold quality
left lobe of thyroid gland	UBERON:0001120	87.38	gold quality
minor salivary gland	UBERON:0001830	87.03	gold quality
body of stomach	UBERON:0001161	86.99	gold quality
zone of skin	UBERON:0000014	86.83	gold quality
thyroid gland	UBERON:0002046	86.03	gold quality
small intestine Peyer’s patch	UBERON:0003454	85.66	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	85.25	gold quality
duodenum	UBERON:0002114	84.99	gold quality
saliva-secreting gland	UBERON:0001044	84.43	gold quality
mouth mucosa	UBERON:0003729	84.39	gold quality
small intestine	UBERON:0002108	84.28	gold quality
pancreas	UBERON:0001264	83.81	gold quality
ileal mucosa	UBERON:0000331	83.55	gold quality
stomach	UBERON:0000945	83.23	gold quality
adult mammalian kidney	UBERON:0000082	82.47	gold quality
granulocyte	CL:0000094	80.31	gold quality
jejunal mucosa	UBERON:0000399	80.25	gold quality
right lobe of liver	UBERON:0001114	79.85	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.14

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CDX2, DNMT1, SP1

miRNA regulators (miRDB)

6 targeting ELMO3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6762-3P	99.66	66.94	1188
HSA-MIR-3692-5P	99.29	67.04	1421
HSA-MIR-6728-3P	98.63	67.63	1534
HSA-MIR-4771	97.43	67.69	596
HSA-MIR-663B	97.40	62.91	664
HSA-MIR-6886-3P	96.96	66.36	844

Literature-anchored findings (GeneRIF, showing 6)

• The present study reports the first characterization of the ELMO3 promoter and suggests a significant role of CDX2 in the basal transcriptional regulation of the intestine-specific expression of ELMO3, possibly through interaction with SP1. (PMID:20127720)
• The over-expression of ELMO3 was a potential diagnostic and prognostic marker for non-small cell lung cancer. (PMID:26191257)
• the silencing of ELMO3 inhibited cell proliferation, invasion, metastasis, and F-actin polymerization, and induced Gap 1 (G1) phase cell cycle arrest, demonstrating that ELMO3 is involved in the processes of growth, invasion and metastasis of Colorectal Cancer (PMID:27999268)
• The purpose of this study was to asses ELMO3 expression in postoperatively irradiated head and neck squamous cell carcinoma patients. (PMID:28039609)
• the results indicate that ELMO3 participates in the processes of cell growth, invasion, and migration, and ELMO3 is expected to be a potential diagnostic and prognostic marker for gastric cancer. (PMID:30345300)
• ELMO3 might serve as a clinical prognostic marker of patients with minor salivary gland carcinoma (PMID:30374620)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	elmo3	ENSDARG00000042126
mus_musculus	Elmo3	ENSMUSG00000014791
rattus_norvegicus	Elmo3	ENSRNOG00000015800

Paralogs (5): ELMO2 (ENSG00000062598), ELMOD1 (ENSG00000110675), ELMOD3 (ENSG00000115459), ELMO1 (ENSG00000155849), ELMOD2 (ENSG00000179387)

Protein

Protein identifiers

Engulfment and cell motility protein 3 — Q96BJ8 (reviewed: Q96BJ8)

All UniProt accessions (3): Q96BJ8, F8W9E7, I3L4D1

UniProt curated annotations — full annotation on UniProt →

Function. Involved in cytoskeletal rearrangements required for phagocytosis of apoptotic cells and cell motility. Acts in association with DOCK1 and CRK. Was initially proposed to be required in complex with DOCK1 to activate Rac Rho small GTPases. May enhance the guanine nucleotide exchange factor (GEF) activity of DOCK1.

Subunit / interactions. Probably interacts directly with the SH3-domain of DOCK1 via its SH3-binding site. Part of a complex with DOCK1 and RAC1. Interacts with ADGRB3.

Subcellular location. Cytoplasm.

Isoforms (3)

UniProt ID	Names	Canonical?
Q96BJ8-1	2	yes
Q96BJ8-2	1
Q96BJ8-3	3

RefSeq proteins (1): NP_078988* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001849	PH_domain	Domain
IPR006816	ELMO_dom	Domain
IPR011989	ARM-like	Homologous_superfamily
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR016024	ARM-type_fold	Homologous_superfamily
IPR024574	ELMO_ARM	Domain
IPR050868	ELMO_domain-containing	Family

Pfam: PF04727, PF11841, PF16457

UniProt features (11 total): sequence variant 3, domain 2, sequence conflict 2, splice variant 2, chain 1, short sequence motif 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96BJ8-F1	89.04	0.68

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 114 (showing top): GOBP_REGULATION_OF_VASCULOGENESIS, chr16q22, JAEGER_METASTASIS_DN, GOBP_VESICLE_MEDIATED_TRANSPORT, CEBPB_01, CREB_Q4, PAX8_B, CHARAFE_BREAST_CANCER_BASAL_VS_MESENCHYMAL_UP, GOBP_ACTIN_FILAMENT_ORGANIZATION, IRF1_Q6, GOBP_BLOOD_VESSEL_MORPHOGENESIS, MARZEC_IL2_SIGNALING_UP, GOBP_VASCULOGENESIS, TATA_C, GFI1_01

GO Biological Process (4): phagocytosis (GO:0006909), apoptotic process (GO:0006915), actin filament organization (GO:0007015), cell motility (GO:0048870)

GO Molecular Function (2): SH3 domain binding (GO:0017124), protein binding (GO:0005515)

GO Cellular Component (1): cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
endocytosis	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
actin cytoskeleton organization	1
supramolecular fiber organization	1
cellular process	1
protein domain specific binding	1
binding	1
intracellular anatomical structure	1
cellular anatomical structure	1

Protein interactions and networks

STRING

682 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ELMO3	WDR35	Q9P2L0	993
ELMO3	DOCK1	Q14185	991
ELMO3	CRK	P46108	959
ELMO3	GULP1	Q9UBP9	908
ELMO3	IFT122	Q9HBG6	714
ELMO3	ADGRB1	O14514	689
ELMO3	RHOG	P35238	553
ELMO3	AKT1	P31749	546
ELMO3	MEGF10	Q96KG7	539
ELMO3	ELMOD3	Q96FG2	515
ELMO3	ELMOD2	Q8IZ81	489
ELMO3	ELMOD1	Q8N336	486
ELMO3	CTDSPL	O15194	479
ELMO3	LATS1	O95835	438
ELMO3	FEZ1	Q99689	434

IntAct

34 interactions, top by confidence:

A	B	Type	Score
ELMO1	DOCK1	psi-mi:“MI:0914”(association)	0.940
PCNA	POM121C	psi-mi:“MI:0914”(association)	0.550
SYMPK	CPSF4	psi-mi:“MI:0914”(association)	0.530
GRB2	ARHGEF35	psi-mi:“MI:0914”(association)	0.530
CRK	ARHGAP42	psi-mi:“MI:0914”(association)	0.530
FAM174A	BLTP3B	psi-mi:“MI:0914”(association)	0.530
CD244	MTX2	psi-mi:“MI:0914”(association)	0.530
ELMO3	H3-4	psi-mi:“MI:0915”(physical association)	0.400
Cry1	BMAL1	psi-mi:“MI:0914”(association)	0.350
Smchd1	SRRM1	psi-mi:“MI:0914”(association)	0.350
Rabep2	CDC42BPA	psi-mi:“MI:0914”(association)	0.350
VPS18	DNAJB5	psi-mi:“MI:0914”(association)	0.350
RBM7	ZC3H18	psi-mi:“MI:0914”(association)	0.350
Ccn1	SRGAP3	psi-mi:“MI:0914”(association)	0.350
KIF15	DMD	psi-mi:“MI:0914”(association)	0.350
UBE2S	RNF40	psi-mi:“MI:0914”(association)	0.350
Ptpn2	GOLIM4	psi-mi:“MI:0914”(association)	0.350
Mis12	CTNNB1	psi-mi:“MI:0914”(association)	0.350
SLC33A1	METTL8	psi-mi:“MI:0914”(association)	0.350
SYNCRIP	ARHGAP32	psi-mi:“MI:0914”(association)	0.350
	PLEKHG3	psi-mi:“MI:0914”(association)	0.350
	HLA-C	psi-mi:“MI:0914”(association)	0.350
ATG16L1	ESYT2	psi-mi:“MI:0914”(association)	0.350
FOXP2	DUSP14	psi-mi:“MI:0914”(association)	0.350
ELMO3	DOCK1	psi-mi:“MI:0914”(association)	0.350
LLGL2	ZNF316	psi-mi:“MI:0914”(association)	0.350
EEF1AKMT3	SMCHD1	psi-mi:“MI:0914”(association)	0.350
CAB39L	METTL15	psi-mi:“MI:0914”(association)	0.350

BioGRID (50): ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ELMO3 (Affinity Capture-MS), ARL4A (Affinity Capture-Western)

ESM2 similar proteins: A0A1D5PJB7, A0A1L8HX76, A6QR40, O08764, O60294, O95382, P10938, P70218, P97452, Q12851, Q14137, Q15334, Q16586, Q28686, Q32P44, Q3TJ91, Q499N3, Q499U2, Q4KLI9, Q561R2, Q562C2, Q5RBH8, Q5RCX2, Q61161, Q6AY79, Q6F5E8, Q6P1M3, Q6V7V2, Q7SZE3, Q7TMC8, Q80Y17, Q8BYZ7, Q8C3I8, Q8C6B2, Q8CHW4, Q8K4K5, Q8MKF0, Q8N0W3, Q8VC03, Q91WI7

Diamond homologs: A4FUD6, A6QR40, Q499U2, Q5RCC1, Q8BHL5, Q8BPU7, Q8BYZ7, Q92556, Q96BJ8, Q96JJ3, Q55GR7

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 56 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RAC1 GTPase cycle	7	11.2×	9e-04
CDC42 GTPase cycle	5	9.5×	9e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

161 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	135
Likely benign	8
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2808 predictions. Top by Δscore:

Variant	Effect	Δscore
16:67199592:GC:G	donor_gain	1.0000
16:67199594:G:GG	donor_gain	1.0000
16:67199753:GAAT:G	donor_gain	1.0000
16:67199757:G:GG	donor_gain	1.0000
16:67200002:G:GG	donor_gain	1.0000
16:67200303:G:T	donor_gain	1.0000
16:67200352:A:G	donor_gain	1.0000
16:67200360:GA:G	donor_gain	1.0000
16:67200362:G:GG	donor_gain	1.0000
16:67200547:G:GT	donor_gain	1.0000
16:67200548:A:T	donor_gain	1.0000
16:67200651:TTACA:T	acceptor_loss	1.0000
16:67200652:TACAG:T	acceptor_loss	1.0000
16:67200653:A:AG	acceptor_gain	1.0000
16:67200653:ACAGG:A	acceptor_loss	1.0000
16:67200654:CAGGT:C	acceptor_loss	1.0000
16:67200655:A:AC	acceptor_loss	1.0000
16:67200655:AGGT:A	acceptor_gain	1.0000
16:67200656:GGT:G	acceptor_gain	1.0000
16:67200656:GGTG:G	acceptor_gain	1.0000
16:67200763:TC:T	donor_gain	1.0000
16:67200804:CAGGT:C	donor_gain	1.0000
16:67200805:AGGT:A	donor_gain	1.0000
16:67200806:GGTG:G	donor_gain	1.0000
16:67200807:GT:G	donor_gain	1.0000
16:67200809:G:GG	donor_gain	1.0000
16:67200882:T:TA	acceptor_gain	1.0000
16:67200886:A:AG	acceptor_gain	1.0000
16:67200886:ATAG:A	acceptor_gain	1.0000
16:67200887:TA:T	acceptor_loss	1.0000

AlphaMissense

4700 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:67201865:G:C	G348R	0.999
16:67201866:G:A	G348D	0.999
16:67201868:T:C	F349L	0.999
16:67201869:T:C	F349S	0.999
16:67201870:T:A	F349L	0.999
16:67201870:T:G	F349L	0.999
16:67202017:G:A	G364D	0.999
16:67202225:C:A	A401D	0.999
16:67202233:A:C	S404R	0.999
16:67202235:C:A	S404R	0.999
16:67202235:C:G	S404R	0.999
16:67202243:T:C	L407P	0.999
16:67202495:T:A	W454R	0.999
16:67202495:T:C	W454R	0.999
16:67202496:G:C	W454S	0.999
16:67202497:G:C	W454C	0.999
16:67202497:G:T	W454C	0.999
16:67202505:T:C	M457T	0.999
16:67202506:G:A	M457I	0.999
16:67202506:G:C	M457I	0.999
16:67202506:G:T	M457I	0.999
16:67202511:C:A	A459D	0.999
16:67202522:G:C	D463H	0.999
16:67202523:A:G	D463G	0.999
16:67203674:T:A	W654R	0.999
16:67203674:T:C	W654R	0.999
16:67201863:T:C	L347P	0.998
16:67201866:G:T	G348V	0.998
16:67202222:T:C	F400S	0.998
16:67202246:C:A	T408K	0.998

dbSNP variants (sampled 300 via entrez): RS1000042920 (16:67198827 C>T), RS1000119091 (16:67201380 C>T), RS1000155738 (16:67198591 C>T), RS1000495378 (16:67197142 T>G), RS1000558856 (16:67202807 G>A), RS1000640201 (16:67199480 G>A,C), RS1000784133 (16:67203538 G>A,C), RS1001044535 (16:67197547 G>A), RS1001052752 (16:67202622 C>T), RS1001480494 (16:67198459 C>A,G,T), RS1001515701 (16:67203274 T>G), RS1001744347 (16:67198733 C>T), RS1001820445 (16:67204050 G>A), RS1001899399 (16:67202950 CTCCGCCTCTGTGAGGGGACGCTCT>C), RS1002042663 (16:67197528 A>G)

Disease associations

OMIM: gene MIM:606422 | disease phenotypes: MIM:254090

GenCC curated gene-disease

Mondo (1): Ullrich congenital muscular dystrophy 1A (MONDO:0009681)

Orphanet (1): Ullrich congenital muscular dystrophy (Orphanet:75840)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST006412_92	Intraocular pressure	1.000000e-07
GCST012228_509	Waist-hip index	4.000000e-08

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004695	intraocular pressure measurement
EFO:0007788	BMI-adjusted waist-hip ratio

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	3
Benzo(a)pyrene	affects methylation, decreases expression, decreases methylation, increases expression	3
Particulate Matter	decreases expression, increases abundance, affects cotreatment, increases expression	3
Air Pollutants	affects expression, increases abundance, decreases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
ferrous chloride	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	decreases expression	1
Sunitinib	increases expression	1
Ethanol	affects cotreatment, increases abundance, increases expression	1
Amiodarone	increases expression	1
Arsenic	increases expression, affects cotreatment, decreases expression, increases abundance	1
Gasoline	affects cotreatment, increases abundance, increases expression	1
Ozone	affects expression, increases abundance	1
Polycyclic Aromatic Hydrocarbons	affects cotreatment, increases abundance, increases expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Valproic Acid	decreases expression, increases methylation	1
Cyclosporine	increases expression	1
Aflatoxin B1	increases methylation	1
Paclitaxel	increases expression	1
Cadmium Chloride	decreases expression	1
1-Butanol	affects cotreatment, increases abundance, increases expression	1
S-Nitrosoglutathione	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.