ENGASE
gene geneOn this page
Also known as FLJ21865
Summary
ENGASE (endo-beta-N-acetylglucosaminidase, HGNC:24622) is a protein-coding gene on chromosome 17q25.3, encoding Cytosolic endo-beta-N-acetylglucosaminidase (Q8NFI3). Endoglycosidase that releases N-glycans from glycoproteins by cleaving the beta-1,4-glycosidic bond in the N,N’-diacetylchitobiose core.
This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides.
Source: NCBI Gene 64772 — RefSeq curated summary.
At a glance
- GWAS associations: 2
- Clinical variants (ClinVar): 171 total
- Druggable target: yes — 5 molecules with ChEMBL bioactivity
- MANE Select transcript:
NM_001042573
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:24622 |
| Approved symbol | ENGASE |
| Name | endo-beta-N-acetylglucosaminidase |
| Location | 17q25.3 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | FLJ21865 |
| Ensembl gene | ENSG00000167280 |
| Ensembl biotype | protein_coding |
| OMIM | 611898 |
| Entrez | 64772 |
Gene structure
Transcript identifiers
Ensembl transcripts: 15 — 7 protein_coding, 4 retained_intron, 2 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined
ENST00000300682, ENST00000311595, ENST00000577783, ENST00000578419, ENST00000579016, ENST00000579809, ENST00000583041, ENST00000583646, ENST00000584568, ENST00000585160, ENST00000903610, ENST00000903611, ENST00000903612, ENST00000945017, ENST00000945018
RefSeq mRNA: 5 — MANE Select: NM_001042573
NM_001042573, NM_001396052, NM_001396053, NM_001396054, NM_001396055
CCDS: CCDS42394
Canonical transcript exons
ENST00000579016 — 14 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001111713 | 79079489 | 79079637 |
| ENSE00001111730 | 79081898 | 79082063 |
| ENSE00003475281 | 79077663 | 79077864 |
| ENSE00003496822 | 79085234 | 79085342 |
| ENSE00003536864 | 79083020 | 79083123 |
| ENSE00003597902 | 79083761 | 79083951 |
| ENSE00003603548 | 79085933 | 79088599 |
| ENSE00003607773 | 79080925 | 79081073 |
| ENSE00003622219 | 79085620 | 79085734 |
| ENSE00003646266 | 79083482 | 79083590 |
| ENSE00003651250 | 79080207 | 79080364 |
| ENSE00003658448 | 79084538 | 79084686 |
| ENSE00003672628 | 79077430 | 79077497 |
| ENSE00003902292 | 79074824 | 79075090 |
Expression profiles
Bgee: expression breadth ubiquitous, 279 present calls, max score 95.77.
FANTOM5 (CAGE): breadth ubiquitous, TPM avg 23.9937 / max 885.0759, expressed in 1803 samples.
FANTOM5 promoters (3 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 163171 | 21.7566 | 1803 |
| 163170 | 1.9611 | 562 |
| 163172 | 0.2760 | 79 |
Top tissues by expression
288 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| mucosa of transverse colon | UBERON:0004991 | 95.77 | gold quality |
| spleen | UBERON:0002106 | 95.41 | gold quality |
| transverse colon | UBERON:0001157 | 95.13 | gold quality |
| small intestine Peyer’s patch | UBERON:0003454 | 95.09 | gold quality |
| granulocyte | CL:0000094 | 94.85 | gold quality |
| pancreatic ductal cell | CL:0002079 | 94.55 | silver quality |
| tendon of biceps brachii | UBERON:0008188 | 94.11 | gold quality |
| sural nerve | UBERON:0015488 | 94.11 | gold quality |
| small intestine | UBERON:0002108 | 94.09 | gold quality |
| right lobe of thyroid gland | UBERON:0001119 | 93.56 | gold quality |
| left ovary | UBERON:0002119 | 93.54 | gold quality |
| right ovary | UBERON:0002118 | 93.45 | gold quality |
| body of stomach | UBERON:0001161 | 93.37 | gold quality |
| apex of heart | UBERON:0002098 | 93.29 | gold quality |
| right uterine tube | UBERON:0001302 | 93.09 | gold quality |
| endocervix | UBERON:0000458 | 92.94 | gold quality |
| right adrenal gland | UBERON:0001233 | 92.94 | gold quality |
| left uterine tube | UBERON:0001303 | 92.77 | gold quality |
| right adrenal gland cortex | UBERON:0035827 | 92.65 | gold quality |
| left adrenal gland cortex | UBERON:0035825 | 92.51 | gold quality |
| gastrocnemius | UBERON:0001388 | 92.50 | gold quality |
| left lobe of thyroid gland | UBERON:0001120 | 92.38 | gold quality |
| esophagogastric junction muscularis propria | UBERON:0035841 | 92.28 | gold quality |
| muscle of leg | UBERON:0001383 | 92.24 | gold quality |
| muscle layer of sigmoid colon | UBERON:0035805 | 92.24 | gold quality |
| body of uterus | UBERON:0009853 | 92.23 | gold quality |
| right atrium auricular region | UBERON:0006631 | 92.22 | gold quality |
| metanephros cortex | UBERON:0010533 | 92.22 | gold quality |
| thyroid gland | UBERON:0002046 | 92.16 | gold quality |
| left adrenal gland | UBERON:0001234 | 92.13 | gold quality |
Single-cell (SCXA)
Detected in 2 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 4.98 |
| E-MTAB-6386 | no | 789.75 |
Regulation
Is transcription factor: no
Literature-anchored findings (GeneRIF, showing 10)
- involved in processing of free oligosaccharides in the cytosol; identification of the gene encoding human cytosolic ENGase (PMID:12114544)
- endo-beta-n-acetylglucosaminidase present in the synovial fluid of rheumatoid arthritis patients, may contribute to the depletion of glycosaminoglycans from cartilage allowing the invasion of synovial cells (PMID:12905469)
- identification of O-GlcNAcase as a caspase-3 substrate with a novel caspase-3 cleavage site and provide insight about O-GlcNAcase regulation during apoptosis. (PMID:18586680)
- Data show that kinetic and X-ray crystallographic analyses of the binding modes with human/bacterial O-GlcNAcases identify some of these as competitive inhibitors. (PMID:20026047)
- O-GlcNAcase expression is increased in erythrocytes from both individuals with pre-diabetes and individuals with less well-controlled diabetes. (PMID:20413512)
- As the generation of the bulk of fOS is unaffected by co-down regulation of Ngly1p and Engase1p, alternative quantitatively important mechanisms must underlie the liberation of these fOS from either LLO or glycoproteins during protein N-glycosylation. (PMID:20668520)
- Serological N-acetyl-glucosaminidase, telomere length, and the UCP2-886G>A variant are independent risk factors for type 2 diabetes. (PMID:21873561)
- In patients with autosomal dominant polycystic kidney disease, urinary NAGase was correlated with urinary ET-1 which was inversely associated with eGFR and positively correlated with total kidney volume. (PMID:26923419)
- Transcriptome-wide association study reveals two genes that influence mismatch negativity. (PMID:33730571)
- N-acetyl-ss-D-glucosaminidase is predictive of mortality in chronic heart failure: a 10-year follow-up. (PMID:34397265)
Cross-species orthologs
5 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | engase | ENSDARG00000010035 |
| mus_musculus | Engase | ENSMUSG00000033857 |
| rattus_norvegicus | Engase | ENSRNOG00000027498 |
| drosophila_melanogaster | ENGase | FBGN0030839 |
| caenorhabditis_elegans | WBGENE00017164 |
Protein
Protein identifiers
Cytosolic endo-beta-N-acetylglucosaminidase — Q8NFI3 (reviewed: Q8NFI3)
All UniProt accessions (4): Q8NFI3, F8W925, J3QLG5, J9JID0
UniProt curated annotations — full annotation on UniProt →
Function. Endoglycosidase that releases N-glycans from glycoproteins by cleaving the beta-1,4-glycosidic bond in the N,N’-diacetylchitobiose core. Involved in the processing of free oligosaccharides in the cytosol.
Subcellular location. Cytoplasm. Cytosol.
Tissue specificity. Widely expressed. Expressed at higher level in thymus and spleen.
Similarity. Belongs to the glycosyl hydrolase 85 family.
Isoforms (3)
| UniProt ID | Names | Canonical? |
|---|---|---|
| Q8NFI3-1 | 1 | yes |
| Q8NFI3-2 | 2 | |
| Q8NFI3-3 | 3 |
RefSeq proteins (5): NP_001036038, NP_001382981, NP_001382982, NP_001382983, NP_001382984 (=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR001357 | BRCT_dom | Domain |
| IPR005201 | TIM_ENGase | Domain |
| IPR032979 | ENGase | Family |
| IPR057882 | ENGase_C | Domain |
Pfam: PF03644, PF25529
Enzyme classification (BRENDA):
- EC 3.2.1.96 — mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase (BRENDA: 59 organisms, 331 substrates, 58 inhibitors, 37 Km, 16 kcat entries)
Substrate kinetics (BRENDA)
25 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.
| Substrate | Km (mM) | Measurements |
|---|---|---|
| 4-NITROPHENYL-BETA-D-N-ACETYLGLUCOSAMINE | 3.5–77.4 | 5 |
| DANSYL ASIALOTRANSFERRIN GLYCOPEPTIDE | 0.68–2 | 2 |
| DANSYL-ASN-(GLCNAC)2(MAN)5 | 0.207–0.876 | 2 |
| FMOC-ASN(FUCALPHA(1->6)GLCNAC)-OH | 8.51–18.51 | 2 |
| FMOC-ASN(GLCNAC)-OH | 0.73–5.22 | 2 |
| MAN3GLCNAC-OXAZOLINE | 0.5–0.67 | 2 |
| (MAN)5(GLCNAC)2-PYRIDYLAMINO | 0.4 | 1 |
| (MAN)5(GLCNAC)2ASN-ACETYL | 0.2 | 1 |
| (MAN)6(GLCNAC)2-PYRIDYLAMIDATED | 0.025 | 1 |
| (MAN)6(GLCNAC)2-PYRIDYLAMINO | 0.25 | 1 |
| (MAN)9(GLCNAC)2-PYRIDYLAMINO | 0.32 | 1 |
| 4-METHYLUMBELLIFERYL DI-N-ACETYL-BETA-CHITOBIOSI | 0.0063 | 1 |
| 4-METHYLUMBELLIFERYL N,N’,N’’-TRIACETYL-BETA-D-G | 0.0204 | 1 |
| 9-FLUORENYLMETHYLOXYCARBONYL-LABELED ASPARAGINE- | 5.54 | 1 |
| ASN(GLCNAC)2-(MAN)5 | 0.25 | 1 |
Catalyzed reactions (Rhea), 1 shown:
- an N(4)-(oligosaccharide-(1->3)-[oligosaccharide-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)-alpha-D-GlcNAc)-L-asparaginyl-[protein] + H2O = an oligosaccharide-(1->3)-[oligosaccharide-(1->6)]-beta-D-Man-(1->4)-D-GlcNAc + N(4)-(N-acetyl-beta-D-glucosaminyl)-L-asparaginyl-[protein] (RHEA:73067)
UniProt features (14 total): splice variant 4, sequence variant 2, sequence conflict 2, modified residue 2, chain 1, domain 1, region of interest 1, compositionally biased region 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q8NFI3-F1 | 86.41 | 0.71 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Post-translational modifications (2): 1, 66
Function
Pathways and Gene Ontology
Reactome pathways
1 pathways
| ID | Pathway |
|---|---|
| R-HSA-532668 | N-glycan trimming in the ER and Calnexin/Calreticulin cycle |
MSigDB gene sets: 94 (showing top):
GOBP_N_GLYCAN_PROCESSING, GOBP_PROTEIN_N_LINKED_GLYCOSYLATION, XU_HGF_TARGETS_REPRESSED_BY_AKT1_DN, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, GOBP_PROTEIN_MATURATION, BLALOCK_ALZHEIMERS_DISEASE_UP, GOBP_CARBOHYDRATE_DERIVATIVE_BIOSYNTHETIC_PROCESS, GOBP_PROTEIN_FOLDING, NIKOLSKY_BREAST_CANCER_17Q21_Q25_AMPLICON, PARENT_MTOR_SIGNALING_DN, GOBP_GLYCOPROTEIN_METABOLIC_PROCESS, OSMAN_BLADDER_CANCER_DN, GINESTIER_BREAST_CANCER_ZNF217_AMPLIFIED_DN, LAIHO_COLORECTAL_CANCER_SERRATED_DN, KEGG_OTHER_GLYCAN_DEGRADATION
GO Biological Process (2): protein folding (GO:0006457), N-glycan processing (GO:0006491)
GO Molecular Function (4): mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925), hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553), hydrolase activity (GO:0016787), hydrolase activity, acting on glycosyl bonds (GO:0016798)
GO Cellular Component (2): cytosol (GO:0005829), cytoplasm (GO:0005737)
Reactome top-level categories
Rollup of top-1 pathways:
| Category | Pathways |
|---|---|
| Asparagine N-linked glycosylation | 1 |
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular anatomical structure | 2 |
| cellular process | 1 |
| protein maturation | 1 |
| protein N-linked glycosylation | 1 |
| glycoprotein biosynthetic process | 1 |
| hydrolase activity, hydrolyzing O-glycosyl compounds | 1 |
| hydrolase activity, acting on glycosyl bonds | 1 |
| catalytic activity | 1 |
| hydrolase activity | 1 |
| cytoplasm | 1 |
| intracellular anatomical structure | 1 |
Protein interactions and networks
STRING
713 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| ENGASE | NGLY1 | Q96IV0 | 788 |
| ENGASE | MAN2C1 | Q9NTJ4 | 597 |
| ENGASE | GYG1 | P46976 | 541 |
| ENGASE | MAN1A1 | P33908 | 541 |
| ENGASE | NFE2L1 | Q14494 | 503 |
| ENGASE | FAM89A | Q96GI7 | 484 |
| ENGASE | SPEG | Q15772 | 473 |
| ENGASE | FUT8 | Q9BYC5 | 457 |
| ENGASE | MGAT1 | P26572 | 448 |
| ENGASE | DDI1 | Q8WTU0 | 427 |
| ENGASE | EIPR1 | Q53HC9 | 391 |
| ENGASE | AP1M2 | Q9Y6Q5 | 379 |
| ENGASE | MAN1B1 | Q9UKM7 | 376 |
| ENGASE | EPYC | Q99645 | 373 |
| ENGASE | ZNF70 | Q9UC06 | 363 |
IntAct
8 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| GNS | CLPX | psi-mi:“MI:0914”(association) | 0.530 |
| PEMT | FABP7 | psi-mi:“MI:0914”(association) | 0.350 |
| PLD5 | MACROH2A1 | psi-mi:“MI:0914”(association) | 0.350 |
| GNS | IGF2R | psi-mi:“MI:0914”(association) | 0.350 |
| EGFR | ILVBL | psi-mi:“MI:0914”(association) | 0.350 |
| ENGASE | uxuA | psi-mi:“MI:0915”(physical association) | 0.000 |
BioGRID (10): ENGASE (Affinity Capture-MS), ENGASE (Affinity Capture-RNA), ENGASE (Affinity Capture-MS), ENGASE (Affinity Capture-MS), ENGASE (Affinity Capture-MS), ENGASE (Affinity Capture-RNA), ENGASE (Proximity Label-MS), ENGASE (Proximity Label-MS), ENGASE (Affinity Capture-MS), ENGASE (Affinity Capture-RNA)
ESM2 similar proteins: A0A8C2MDK8, A7SLX5, A7YY46, D3ZEY4, D3ZX08, E9QAM5, O59713, O95822, P0C7A1, P48760, P52333, P52824, Q002B5, Q07071, Q14397, Q15477, Q2KI24, Q2M296, Q2NKY8, Q3SYT1, Q3T7C9, Q3U1Y4, Q3URQ7, Q4R380, Q52L34, Q567W6, Q568Y2, Q5I0I8, Q5NCQ5, Q5ZHX9, Q6GPQ5, Q6NZR5, Q6P5E8, Q8BUI3, Q8BX80, Q8C9A2, Q8NFF5, Q8NFI3, Q91X44, Q920F5
Diamond homologs: A1L251, F4JZC2, P0C7A1, Q8BX80, Q8NFI3, Q9SRL4, P60827, Q3T1I2, Q5XIG2, Q6IR41, Q9BXI9, Q9BXJ1, Q9QXP7
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
171 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 131 |
| Likely benign | 10 |
| Benign | 3 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
2474 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 17:79075038:G:GT | donor_gain | 1.0000 |
| 17:79075047:G:GT | donor_gain | 1.0000 |
| 17:79075084:G:GT | donor_gain | 1.0000 |
| 17:79075084:G:T | donor_gain | 1.0000 |
| 17:79075088:G:GT | donor_gain | 1.0000 |
| 17:79077404:A:AG | acceptor_gain | 1.0000 |
| 17:79077405:A:G | acceptor_gain | 1.0000 |
| 17:79077407:T:G | acceptor_gain | 1.0000 |
| 17:79077412:A:AG | acceptor_gain | 1.0000 |
| 17:79077413:A:G | acceptor_gain | 1.0000 |
| 17:79077428:A:AG | acceptor_gain | 1.0000 |
| 17:79077429:G:GA | acceptor_gain | 1.0000 |
| 17:79077429:GC:G | acceptor_gain | 1.0000 |
| 17:79077655:C:A | acceptor_gain | 1.0000 |
| 17:79077656:G:A | acceptor_gain | 1.0000 |
| 17:79077661:A:AG | acceptor_gain | 1.0000 |
| 17:79077662:G:GG | acceptor_gain | 1.0000 |
| 17:79077717:T:TA | acceptor_gain | 1.0000 |
| 17:79077860:GACAG:G | donor_gain | 1.0000 |
| 17:79077865:G:GA | donor_loss | 1.0000 |
| 17:79077865:G:GG | donor_gain | 1.0000 |
| 17:79079636:GG:G | donor_gain | 1.0000 |
| 17:79079637:GG:G | donor_gain | 1.0000 |
| 17:79080197:A:AG | acceptor_gain | 1.0000 |
| 17:79080198:T:G | acceptor_gain | 1.0000 |
| 17:79080202:CACAG:C | acceptor_loss | 1.0000 |
| 17:79080203:A:AG | acceptor_gain | 1.0000 |
| 17:79080203:ACAG:A | acceptor_gain | 1.0000 |
| 17:79080203:ACAGG:A | acceptor_gain | 1.0000 |
| 17:79080204:C:G | acceptor_gain | 1.0000 |
AlphaMissense
4797 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 17:79079562:T:C | F164L | 0.995 |
| 17:79079564:C:A | F164L | 0.995 |
| 17:79079564:C:G | F164L | 0.995 |
| 17:79080335:T:A | W232R | 0.994 |
| 17:79080335:T:C | W232R | 0.994 |
| 17:79083062:T:C | F361L | 0.994 |
| 17:79083064:T:A | F361L | 0.994 |
| 17:79083064:T:G | F361L | 0.994 |
| 17:79082019:T:C | F332L | 0.993 |
| 17:79082021:T:A | F332L | 0.993 |
| 17:79082021:T:G | F332L | 0.993 |
| 17:79079598:T:A | W176R | 0.992 |
| 17:79079598:T:C | W176R | 0.992 |
| 17:79079611:C:A | A180D | 0.990 |
| 17:79079637:G:T | G189W | 0.990 |
| 17:79083074:T:A | W365R | 0.989 |
| 17:79083074:T:C | W365R | 0.989 |
| 17:79079565:A:C | S165R | 0.988 |
| 17:79079567:C:A | S165R | 0.988 |
| 17:79079567:C:G | S165R | 0.988 |
| 17:79081009:T:A | W270R | 0.988 |
| 17:79081009:T:C | W270R | 0.988 |
| 17:79081941:T:A | W306R | 0.988 |
| 17:79081941:T:C | W306R | 0.988 |
| 17:79083486:T:A | W383R | 0.988 |
| 17:79083486:T:C | W383R | 0.988 |
| 17:79080351:A:T | E237V | 0.987 |
| 17:79080346:C:A | N235K | 0.986 |
| 17:79080346:C:G | N235K | 0.986 |
| 17:79080352:G:C | E237D | 0.986 |
dbSNP variants (sampled 300 via entrez): RS1000197380 (17:79075982 G>A), RS1000225133 (17:79081369 G>T), RS1000225424 (17:79078570 G>A,T), RS1000448258 (17:79089088 G>A), RS1000728670 (17:79088904 T>C), RS1000830631 (17:79079759 C>T), RS1000991974 (17:79083403 T>A,G), RS1001014099 (17:79087606 G>GA,GC), RS1002110392 (17:79074813 G>C), RS1002141790 (17:79074632 T>C), RS1002161537 (17:79076615 T>G), RS1002353326 (17:79084170 T>G), RS1002691182 (17:79082414 G>A), RS1002722153 (17:79074670 CTGGACTCATAGCCAATGATGGGCAACA>C), RS1002753101 (17:79078055 C>G)
Disease associations
OMIM: gene MIM:611898 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
2 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST009391_1544 | Metabolite levels | 2.000000e-06 |
| GCST009391_314 | Metabolite levels | 6.000000e-06 |
EFO canonical traits (2, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0010511 | niacinamide measurement |
| EFO:0010430 | triacylglycerol 56:3 measurement |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: yes
ChEMBL targets (1): CHEMBL5172 (SINGLE PROTEIN)
Molecules with ChEMBL bioactivity
5 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 92,872 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).
| Molecule | Name | Phase | Patents |
|---|---|---|---|
| CHEMBL1201863 | DEXLANSOPRAZOLE | 4 | 1,583 |
| CHEMBL1219 | RABEPRAZOLE | 4 | 12,441 |
| CHEMBL1503 | OMEPRAZOLE | 4 | 52,284 |
| CHEMBL480 | LANSOPRAZOLE | 4 | 24,317 |
| CHEMBL1475252 | TENATOPRAZOLE | 2 | 2,247 |
PharmGKB: 1 entry (VIP=true, CPIC=false)
ChEMBL bioactivities
6 potent at pChembl≥5 of 10 total, top 6 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).
| pChembl | Type | Value | Unit | Molecule |
|---|---|---|---|---|
| 9.03 | Ki | 0.925 | nM | NAGSTATIN |
| 8.90 | Ki | 1.25 | nM | POCHONICINE |
| 8.74 | IC50 | 1.83 | nM | NAGSTATIN |
| 8.62 | IC50 | 2.39 | nM | POCHONICINE |
| 6.38 | IC50 | 420 | nM | CHEMBL259756 |
| 5.35 | IC50 | 4470 | nM | RABEPRAZOLE |
PubChem BioAssay actives
6 with measured affinity, of 63 total; 4 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.
| Compound | Assay | Type | Value | Unit |
|---|---|---|---|---|
| 2-[(5R,6S,7R,8S)-8-acetamido-6,7-dihydroxy-5-(hydroxymethyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyridin-2-yl]acetic acid | 453057: Competitive inhibition of human placenta beta-N-acetylglucosaminidase by pNP-GlcNAc substrate hydrolysis assay | ki | 0.0009 | uM |
| N-[[(1R,2S,3S,5S,7R,8S)-1,2,7-trihydroxy-5-(hydroxymethyl)-2,3,5,6,7,8-hexahydro-1H-pyrrolizin-3-yl]methyl]acetamide | 453052: Mixed type inhibition of human placenta beta-N-acetylglucosaminidase by pNP-GlcNAc substrate hydrolysis assay | ki | 0.0013 | uM |
| (2S,3S,4S,5S,6R)-2-[[(2R,3S,4S,5S,6S)-6-[[(2R,3R,4S,5S,6S)-6-[[(2R,3R,4S,5S,6S)-6-[[(3aS,5R,6S,7R,7aR)-7-hydroxy-5-(hydroxymethyl)-2-methyl-5,6,7,7a-tetrahydro-3aH-pyrano[3,2-d][1,3]thiazol-6-yl]oxy]-4-[(2S,3S,4S,5S,6R)-3-[(2S,3S,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,5-dihydroxyoxan-2-yl]methoxy]-4-[(2S,3S,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxyoxan-2-yl]methoxy]-3,4,5-trihydroxyoxan-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | 318993: Inhibition of human endo-beta-N-acetylglucosaminidase expressed in Hek293 cells after 3 mins | ic50 | 0.4200 | uM |
| Rabeprazole | 1453445: Inhibition of recombinant human C-MYC/DDK-tagged ENGase expressed in HEK293T cells using heat inactivated bovine ribonuclease B as substrate pretreated for 15 mins followed by substrate addition after 90 mins by SDS-PAGE analysis | ic50 | 4.4700 | uM |
CTD chemical–gene interactions
31 total (human), top 30 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| bisphenol A | decreases expression, decreases methylation | 2 |
| sodium arsenite | decreases expression | 2 |
| aristolochic acid I | increases expression | 1 |
| FR900359 | increases phosphorylation | 1 |
| 2,4,6-tribromophenol | decreases expression | 1 |
| methylmercuric chloride | decreases expression | 1 |
| deoxynivalenol | increases expression | 1 |
| decabromobiphenyl ether | decreases expression | 1 |
| beta-lapachone | decreases expression | 1 |
| perfluorooctanoic acid | decreases expression | 1 |
| benzo(e)pyrene | increases methylation | 1 |
| aflatoxin B2 | increases methylation | 1 |
| perfluorooctane sulfonic acid | decreases expression | 1 |
| perfluorohexanesulfonic acid | decreases expression | 1 |
| abrine | increases expression | 1 |
| 2,2’,4,4’-tetrabromodiphenyl ether | decreases expression | 1 |
| licochalcone B | increases expression | 1 |
| jinfukang | affects cotreatment, increases expression | 1 |
| PCI 5002 | affects cotreatment, increases expression | 1 |
| Arsenic | affects methylation | 1 |
| Benzo(a)pyrene | increases methylation | 1 |
| Cisplatin | affects cotreatment, increases expression | 1 |
| Methapyrilene | increases methylation | 1 |
| Smoke | decreases expression | 1 |
| Testosterone | decreases expression | 1 |
| Tobacco Smoke Pollution | decreases expression | 1 |
| Zinc | affects cotreatment, increases expression | 1 |
| Aflatoxin B1 | increases methylation | 1 |
| Antirheumatic Agents | increases expression | 1 |
| Cadmium Chloride | decreases expression | 1 |
ChEMBL screening assays
10 unique, capped per target: 10 binding
Representative assays (with source publication via chembl_document):
| Assay ID | Type | Description | Source paper |
|---|---|---|---|
| CHEMBL1041612 | Binding | Inhibition of human placenta beta-N-acetylglucosaminidase by pNP-GlcNAc substrate hydrolysis assay | Pochonicine, a polyhydroxylated pyrrolizidine alkaloid from fungus Pochonia suchlasporia var. suchlasporia TAMA 87 as a potent beta-N-acetylglucosaminidase inhibitor. — Bioorg Med Chem |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.