EPOR

Summary

EPOR (erythropoietin receptor, HGNC:3416) is a protein-coding gene on chromosome 19p13.2, encoding Erythropoietin receptor (P19235). Receptor for erythropoietin, which mediates erythropoietin-induced erythroblast proliferation and differentiation.

This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 2057 — RefSeq curated summary.

At a glance

• Gene–disease (curated): primary familial polycythemia due to EPO receptor mutation (Strong, GenCC)
• GWAS associations: 2
• Clinical variants (ClinVar): 178 total — 2 pathogenic, 4 likely-pathogenic
• Phenotypes (HPO): 25
• Druggable target: yes
• MANE Select transcript: NM_000121

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3416
Approved symbol	EPOR
Name	erythropoietin receptor
Location	19p13.2
Locus type	gene with protein product
Status	Approved
Aliases	EPO-R
Ensembl gene	ENSG00000187266
Ensembl biotype	protein_coding
OMIM	133171
Entrez	2057

Gene structure

Transcript identifiers

Ensembl transcripts: 11 — 5 protein_coding, 3 nonsense_mediated_decay, 3 retained_intron

ENST00000222139, ENST00000586890, ENST00000588681, ENST00000588859, ENST00000589402, ENST00000590927, ENST00000591958, ENST00000592375, ENST00000852161, ENST00000852162, ENST00000940249

RefSeq mRNA: 1 — MANE Select: NM_000121 NM_000121

CCDS: CCDS12260

Canonical transcript exons

ENST00000222139 — 8 exons

Exon	Start	End
ENSE00001131148	11377207	11378595
ENSE00001246294	11383097	11383232
ENSE00003485957	11378691	11378778
ENSE00003501536	11381056	11381209
ENSE00003508964	11380884	11380971
ENSE00003600616	11381930	11382105
ENSE00003609569	11381692	11381849
ENSE00003850467	11384093	11384314

Expression profiles

Bgee: expression breadth ubiquitous, 268 present calls, max score 98.95.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 6.2780 / max 306.0101, expressed in 1589 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
179222	2.6901	1235
179226	2.0618	707
179227	0.7217	168
179225	0.5970	289
179224	0.1460	64
179223	0.0613	20

Top tissues by expression

283 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
type B pancreatic cell	CL:0000169	98.95	gold quality
olfactory bulb	UBERON:0002264	97.31	silver quality
left lobe of thyroid gland	UBERON:0001120	97.05	gold quality
right lobe of thyroid gland	UBERON:0001119	96.99	gold quality
thyroid gland	UBERON:0002046	96.12	gold quality
parotid gland	UBERON:0001831	96.04	gold quality
diaphragm	UBERON:0001103	95.29	silver quality
ileal mucosa	UBERON:0000331	94.34	silver quality
tibialis anterior	UBERON:0001385	92.91	silver quality
endometrium epithelium	UBERON:0004811	92.60	gold quality
metanephros cortex	UBERON:0010533	91.12	gold quality
right uterine tube	UBERON:0001302	91.11	gold quality
left adrenal gland cortex	UBERON:0035825	90.43	gold quality
adrenal cortex	UBERON:0001235	90.21	gold quality
tongue squamous epithelium	UBERON:0006919	90.04	gold quality
cardia of stomach	UBERON:0001162	90.02	gold quality
right adrenal gland	UBERON:0001233	89.88	gold quality
right adrenal gland cortex	UBERON:0035827	89.82	gold quality
vena cava	UBERON:0004087	89.64	silver quality
left adrenal gland	UBERON:0001234	89.43	gold quality
mucosa of paranasal sinus	UBERON:0005030	89.15	silver quality
pancreatic ductal cell	CL:0002079	89.14	gold quality
superficial temporal artery	UBERON:0001614	88.93	gold quality
frontal pole	UBERON:0002795	88.73	silver quality
mucosa of urinary bladder	UBERON:0001259	88.64	silver quality
adult mammalian kidney	UBERON:0000082	88.25	gold quality
Brodmann (1909) area 10	UBERON:0013541	88.18	silver quality
trabecular bone tissue	UBERON:0002483	88.05	gold quality
bone marrow	UBERON:0002371	88.01	gold quality
adrenal gland	UBERON:0002369	87.94	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-CURD-112	yes	55.97
E-MTAB-10042	yes	26.20
E-ANND-3	yes	7.26
E-MTAB-7249	no	44.64
E-HCAD-10	no	2.08

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): ETS1, ETV6, GATA1, GATA3, GATA4, HIF1A, ID1, PREB, RUNX1, SP1, STAT5A, TAL1, WT1

miRNA regulators (miRDB)

46 targeting EPOR, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-1179	99.71	68.70	1040
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-5580-3P	99.70	69.41	2052
HSA-MIR-6512-3P	99.65	66.07	1468
HSA-MIR-6720-5P	99.65	66.22	1459
HSA-MIR-4708-3P	99.51	67.99	870
HSA-MIR-548V	99.29	69.47	1157
HSA-MIR-1253	99.12	67.08	1688
HSA-MIR-3160-3P	99.07	64.78	955
HSA-MIR-4650-3P	99.01	68.39	1062
HSA-MIR-6770-5P	98.97	66.76	1853
HSA-MIR-4451	98.82	68.17	1455

Literature-anchored findings (GeneRIF, showing 40)

• Amino acid determinants of beta-hairpin conformation in erythropoeitin receptor agonist peptides derived from a phage display library (PMID:11884148)
• While both Epo and Epo-R were detected in all samples of isolated epithelial cells analysed throughout the menstrual cycle, neither one was detected in isolated stromal cells. Epo and Epo-R protein expression in glandular epithelial cells was increased (PMID:11994541)
• REVIEW: Role of erythropoietin receptor in myelodysplastic syndrome and leukemia. (PMID:11999556)
• The extracellular binding site for ERP is now characterized. The site is located in the membrane proximal, extracellular part of the receptor. ERP binds to a region on the EPOR that contains the same sequence as ERP (PMID:12021194)
• evidence for pY429pY431 being a new high affinity binding site for SOCS-3 on the EpoR (PMID:12027890)
• functional significance of expression in breast cancer (PMID:12118093)
• JAK2 activation mediates cross-talk between extracellular domain mutants of the beta-subunit of the GM-CSF receptor and EpoR (PMID:12488507)
• Epo and Epo-R localized within glandular epithelial cells in both peritoneal endometriosis and eutopic endometrium. Epo-R expression lower in black peritoneal lesions. (PMID:12525458)
• Expression of erythropoietin receptor splice variants in tumor cell lines. (PMID:12878211)
• Majority of papillary thyroid carcinomas (PTC) from children and adolescents express EPO-R, a finding associated with favorable prognostic indicators and a lower risk of recurrence. (PMID:14584755)
• Increased erythropoietin receptor expression is associated with advanced-stage disease, lymphovascular invasion, lymph node metastasis of endometrial carcinoma (PMID:15160341)
• erythropoietin receptor and nitric oxide production are stimulated by erythropoietin and hypoxia in vascular endothelial cells (PMID:15205261)
• These data demonstrate that EPO can promote differentiation of neuronal stem cells into astrocytes in an EPO receptor dependent manner, and this effect may be associated with the activation of ERK kinase and NF-kappaB pathway. (PMID:15249201)
• activated Epo receptors appear to be quickly degraded after ubiquitination by 2 proteolytic systems that proceed successively (PMID:15358619)
• Epression of erythropoietin receptor in prostate cancer cell lines suggesting that these cells may serve as useful experimental models for further studies of erythropoietin receptor function for growth regulation in prostate cancer. (PMID:15467711)
• the erythropoietin-receptor pathway modulates survival of cancer cells (PMID:15480420)
• The Erythropoietin Receptor mutations have been shown to cause the myeloproliferative disorders disease. (PMID:15572213)
• detailed mapping of interactions of several signalling proteins with phosphorylated tyrosine-containing motifs in the cytosolic domain OF EPOR (PMID:15644415)
• the TM-JM junction of EpoR forms an N-terminal helix cap required for function (PMID:15657048)
• erythropoietin and EPOR are co-expressed in tumor cells, suggesting that erythropoietin may potentially function as an autocrine or paracrine factor in head and neck cancer (PMID:15671524)
• erythropoietin receptor was expressed in almost all samples in non-small cell lung carcinomas. (PMID:15709164)
• Results showed that VHL disease-associated renal clear cell carcinomas and renal cysts coexpress and erythropoietin receptor and erythropoietin. (PMID:15709172)
• Coexpression of Erythropoietin and Erythropoietin receptor was found in all five Hippel Lindau disease-associated pheochromocytomas. (PMID:15769989)
• the erythropoietin functions that promote cell survival and proliferation are affected by aluminum exposure through mechanisms involving erythropoietin receptor (PMID:15777837)
• Y285 and Y344 in the cytoplasmic domain of EPOR-ME may contribute to increased Epo sensitivity that is characteristic of primary familial and congenital polycythemia phenotype. (PMID:15878737)
• CaM binds to the membrane-proximal EpoR cytoplasmic region and plays an essential role in activation of Jak2-mediated EpoR signaling (PMID:16084495)
• data demonstrate that transformed, non-malignant and malignant prostate epithelial cells have functional EpoR (PMID:16161153)
• Erythropoietin and erythropoietin receptor are expressed in head and neck squamous cell carcinoma (PMID:16278379)
• No EPOR exon VIII mutations were found in members of 8 Greek families with primary familial and congenital polycythemia. (PMID:16608505)
• Coexpression of erythropoietin and its receptor plays a important role in tumorigenesis of sporadic clear cell renal cell carcinoma. (PMID:16627979)
• findings show that three thyroid cancer cell lines expressed Epo and EpoR mRNA (PMID:16699298)
• Collectively, the results suggest that Jak2 is the sole direct signaling molecule downstream of EpoR required for biological activity. (PMID:16982687)
• erythropoietin receptor is not ubiquitinated following erythropoietin stimulation in this cancer cell line, and there is no turnover of the receptor in either unstimulated or stimulated cells (PMID:17038666)
• Doubt concerning the significance of previous immunohistochemical studies of EPOR expression in malignancy and emphasize the need for more specific anti-EPOR antibodies to define the true extent of EPOR expression in neoplastic tissue. (PMID:17110616)
• The EpoR expression correlated significantly with apoptosis and correlated significantly with tumor size and was significantly associated with the presence of lymphovascular space involvement in Cervical cancers. (PMID:17145806)
• The Epo receptor may be important for secretion, endothelial progenitor cell mobilization, and angiogenesis in ischemic tissue as well as Epo in peripheral vasculature of EpoR-deficient-rescued transgenic mice, compared with wild type. (PMID:17293480)
• Recognition of a vascular EpoR system which is endowed with significant pathophysiological functions opens new exploitation horizons in cardiovascular medicine. (PMID:17363704)
• upregulation of EpoR in temporal cortical and hippocampal astrocytes is an early, potentially neuroprotective, event in the pathogenesis of sporadic Alzheimer disease. (PMID:17483696)
• A novel sporadic EPOR 1453G->A (Trp439Stop) mutation was detected. All familial erythrocytosis cases, varied in phenotype, presented the EPOR 1414C->G (Tyr426Stop) mutation. (PMID:17488692)
• Five of the antibodies recognized recombinant rat and human EPOR in HEK293 cells by Western blotting, but the same antibodies yielded different and inconsistent results when using human UT-7 cells or rat brain tissue. (PMID:17524492)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	epor	ENSDARG00000090834
danio_rerio	il4r.1	ENSDARG00000102583
danio_rerio		ENSDARG00000116052
mus_musculus	Epor	ENSMUSG00000006235
rattus_norvegicus	Epor	ENSRNOG00000012619

Paralogs (7): IL4R (ENSG00000077238), CSF2RB (ENSG00000100368), IL2RB (ENSG00000100385), IL21R (ENSG00000103522), MPL (ENSG00000117400), IL9R (ENSG00000124334), IL7R (ENSG00000168685)

Protein

Protein identifiers

Erythropoietin receptor — P19235 (reviewed: P19235)

All UniProt accessions (4): P19235, K7EN47, K7EP50, K7ERB5

UniProt curated annotations — full annotation on UniProt →

Function. Receptor for erythropoietin, which mediates erythropoietin-induced erythroblast proliferation and differentiation. Upon EPO stimulation, EPOR dimerizes triggering the JAK2/STAT5 signaling cascade. In some cell types, can also activate STAT1 and STAT3. May also activate the LYN tyrosine kinase. Acts as a dominant-negative receptor of EPOR-mediated signaling.

Subunit / interactions. Forms homodimers on EPO stimulation. The tyrosine-phosphorylated form interacts with several SH2 domain-containing proteins including LYN, the adapter protein SH2B2, PTPN6, PTPN11, JAK2, PI3 kinases, STAT5A/B, SOCS3, CRKL. Interacts with INPP5D/SHIP1. SH2B2 binding inhibits the JAK-STAT signaling. Interacts with RHEX; this interaction occurs in a erythropoietin (EPO)-dependent manner. Interacts with ATXN2L.

Subcellular location. Cell membrane Secreted.

Tissue specificity. Erythroid cells and erythroid progenitor cells. Isoform EPOR-F is the most abundant form in EPO-dependent erythroleukemia cells and in late-stage erythroid progenitors. Isoform EPOR-S and isoform EPOR-T are the predominant forms in bone marrow. Isoform EPOR-S and isoform EPOR-T are the predominant forms in bone marrow. Isoform EPOR-T is the most abundant from in early-stage erythroid progenitor cells.

Post-translational modifications. On EPO stimulation, phosphorylated on C-terminal tyrosine residues by JAK2. The phosphotyrosine motifs are also recruitment sites for several SH2-containing proteins and adapter proteins which mediate cell proliferation. Phosphorylation on Tyr-454 is required for PTPN6 interaction, Tyr-426 for PTPN11. Tyr-426 is also required for SOCS3 binding, but Tyr-454/Tyr-456 motif is the preferred binding site. Ubiquitinated by the ECS(SOCS2) complex following ligand-binding and phosphorylation by JAK2, leading to its degradation by the proteasome. Regulation by the ECS(SOCS2) complex acts as a negative feedback loop of erythropoietin-mediated signaling pathway. Ubiquitination at Lys-281 mediates receptor internalization, whereas ubiquitination at Lys-453 promotes trafficking of activated receptors to the lysosomes for degradation. Ubiquitinated by NOSIP; appears to be either multi-monoubiquitinated or polyubiquitinated. Ubiquitination mediates proliferation and survival of EPO-dependent cells.

Disease relevance. Erythrocytosis, familial, 1 (ECYT1) [MIM:133100] An autosomal dominant disorder characterized by elevated hemoglobin and hematocrit, hypersensitivity of erythroid progenitors to erythropoietin, erythropoietin low serum levels, and no increase in platelets nor leukocytes. It has a relatively benign course and does not progress to leukemia. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The WSXWS motif appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif is required for JAK interaction and/or activation. Contains 1 copy of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases.

Similarity. Belongs to the type I cytokine receptor family. Type 1 subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
P19235-1	EPOR-F, Full-length form	yes
P19235-2	EPOR-S, Soluble form
P19235-3	EPOR-T, Truncated form

RefSeq proteins (1): NP_000112* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003528	Long_hematopoietin_rcpt_CS	Conserved_site
IPR003961	FN3_dom	Domain
IPR009167	Erythropoietin_rcpt	Family
IPR013783	Ig-like_fold	Homologous_superfamily
IPR015152	Growth/epo_recpt_lig-bind	Domain
IPR036116	FN3_sf	Homologous_superfamily

Pfam: PF00041, PF09067

UniProt features (88 total): strand 23, mutagenesis site 18, modified residue 8, helix 7, turn 5, splice variant 4, short sequence motif 3, sequence variant 3, sequence conflict 3, topological domain 2, disulfide bond 2, cross-link 2, region of interest 2, signal peptide 1, chain 1, site 1, glycosylation site 1, transmembrane region 1, domain 1

Structure

Experimental structures (PDB)

22 structures.

PDB	Method	Resolution (Å)
1EER	X-RAY DIFFRACTION	1.9
6MOI	X-RAY DIFFRACTION	2.06
6MOE	X-RAY DIFFRACTION	2.09
8VUI	X-RAY DIFFRACTION	2.1
1ERN	X-RAY DIFFRACTION	2.4
6MOJ	X-RAY DIFFRACTION	2.43
4Y5V	X-RAY DIFFRACTION	2.6
6E2Q	X-RAY DIFFRACTION	2.65
6I4X	X-RAY DIFFRACTION	2.69
1EBA	X-RAY DIFFRACTION	2.7
1CN4	X-RAY DIFFRACTION	2.8
1EBP	X-RAY DIFFRACTION	2.8
4Y5Y	X-RAY DIFFRACTION	2.85
6MOF	X-RAY DIFFRACTION	2.89
8VVM	X-RAY DIFFRACTION	2.9
8VVO	X-RAY DIFFRACTION	3.09
4Y5X	X-RAY DIFFRACTION	3.15
6MOL	X-RAY DIFFRACTION	3.16
2JIX	X-RAY DIFFRACTION	3.2
6MOH	X-RAY DIFFRACTION	3.2
6MOK	X-RAY DIFFRACTION	5.1
2MV6	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P19235-F1	67.74	0.36

Antibody-complex structures (SAbDab): 7 — 2JIX, 4Y5V, 4Y5X, 4Y5Y, 8VUI, 8VVM, 8VVO

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 117 (required for ligand binding)

Post-translational modifications (10): 368, 426, 454, 456, 468, 485, 489, 504, 281, 453

Disulfide bonds (2): 52–62, 91–107

Glycosylation sites (1): 76

Mutagenesis-validated functional residues (18):

Position	Phenotype
114	little effect on epo binding.
115	little effect on epo binding.
116	10-fold reduction in epo binding.
117	greatly reduced epo binding.
117	60-fold reduction in epo binding.
117	8-fold reduction in epo binding.
118	16-fold reduction in epo binding.
120	some reduction in epo binding.
121	little effect on epo binding.
165	little effect on epo binding.
174	little effect on epo binding.
176	16-fold reduction in epo binding.
177	little effect on epo binding.
179	little effect on epo binding.
426	decreased phosphorylation by jak2 and association with the ecs(socs2) complex.
454	some loss of socs3 binding.
456	inhibition of stat1/stat3 activity. no effect on stat5 activity. some loss of socs3 binding.
468	no effect on stat1/stat3 nor stat5 activity.

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-9006335	Signaling by Erythropoietin
R-HSA-9027276	Erythropoietin activates Phosphoinositide-3-kinase (PI3K)
R-HSA-9027277	Erythropoietin activates Phospholipase C gamma (PLCG)
R-HSA-9027283	Erythropoietin activates STAT5
R-HSA-9027284	Erythropoietin activates RAS

MSigDB gene sets: 249 (showing top): BASSO_B_LYMPHOCYTE_NETWORK, GOBP_RESPONSE_TO_PEPTIDE, XU_GH1_AUTOCRINE_TARGETS_UP, GCANCTGNY_MYOD_Q6, MODULE_64, DACOSTA_UV_RESPONSE_VIA_ERCC3_UP, GOCC_CELL_SURFACE, AMIT_SERUM_RESPONSE_20_MCF10A, IVANOVA_HEMATOPOIESIS_MATURE_CELL, AP4_Q6, CAGCTG_AP4_Q5, RODRIGUES_NTN1_TARGETS_DN, SHEDDEN_LUNG_CANCER_GOOD_SURVIVAL_A5, GOBP_DECIDUALIZATION, BIOCARTA_EPO_PATHWAY

GO Biological Process (7): signal transduction (GO:0007165), brain development (GO:0007420), heart development (GO:0007507), erythropoietin-mediated signaling pathway (GO:0038162), decidualization (GO:0046697), cytokine-mediated signaling pathway (GO:0019221), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)

GO Molecular Function (5): erythropoietin receptor activity (GO:0004900), identical protein binding (GO:0042802), transmembrane signaling receptor activity (GO:0004888), cytokine receptor activity (GO:0004896), protein binding (GO:0005515)

GO Cellular Component (5): extracellular region (GO:0005576), plasma membrane (GO:0005886), external side of plasma membrane (GO:0009897), nuclear speck (GO:0016607), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Signaling by Erythropoietin	4
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
animal organ development	2
cytokine-mediated signaling pathway	2
cellular anatomical structure	2
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
central nervous system development	1
head development	1
circulatory system development	1
cellular response to erythropoietin	1
maternal placenta development	1
developmental process involved in reproduction	1
tissue development	1
cell surface receptor signaling pathway	1
cellular response to cytokine stimulus	1
ubiquitin-dependent protein catabolic process	1
proteasomal protein catabolic process	1
cytokine receptor activity	1
erythropoietin-mediated signaling pathway	1
protein binding	1
signaling receptor activity	1
transmembrane signaling receptor activity	1
cytokine binding	1
immune receptor activity	1
binding	1
membrane	1
cell periphery	1
plasma membrane	1
cell surface	1
side of membrane	1
nuclear ribonucleoprotein granule	1

Protein interactions and networks

STRING

1432 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
EPOR	EPO	P01588	999
EPOR	JAK2	O60674	997
EPOR	NPTN	Q9Y639	990
EPOR	CSF2RB	P32927	985
EPOR	STAT5A	P42229	950
EPOR	STAT5B	P51692	947
EPOR	TFR2	Q9UP52	945
EPOR	THPO	P40225	918
EPOR	GRB2	P29354	895
EPOR	GATA1	P15976	855
EPOR	SOCS2	O14508	854
EPOR	JAK1	P23458	843
EPOR	SOCS3	O14543	812
EPOR	KIT	P10721	799
EPOR	CRLF2	Q9HC73	766

IntAct

52 interactions, top by confidence:

A	B	Type	Score
PTPN6	EPOR	psi-mi:“MI:0915”(physical association)	0.800
EPOR	PTPN6	psi-mi:“MI:0915”(physical association)	0.800
PTPN6	EPOR	psi-mi:“MI:0407”(direct interaction)	0.800
PTPN6	EPOR	psi-mi:“MI:0914”(association)	0.800
EPOR	EPO	psi-mi:“MI:0407”(direct interaction)	0.610
EPO	EPOR	psi-mi:“MI:0915”(physical association)	0.610
PTPN1	EPOR	psi-mi:“MI:0915”(physical association)	0.600
EPOR	PTPN1	psi-mi:“MI:0203”(dephosphorylation reaction)	0.600
EPOR	EPOR	psi-mi:“MI:2364”(proximity)	0.570
EPOR	EPOR	psi-mi:“MI:0407”(direct interaction)	0.570
EPO	EPOR	psi-mi:“MI:0407”(direct interaction)	0.560
EPOR	INPP5D	psi-mi:“MI:0915”(physical association)	0.550
Cish	EPOR	psi-mi:“MI:0915”(physical association)	0.550
EPOR	Cish	psi-mi:“MI:0915”(physical association)	0.550
INPP5D	EPOR	psi-mi:“MI:0914”(association)	0.550
EPOR	ATXN2L	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (79): EPOR (Two-hybrid), PTPN11 (Reconstituted Complex), EPOR (Affinity Capture-Western), VHL (Affinity Capture-Western), CUL2 (Affinity Capture-Western), EGLN3 (Affinity Capture-Western), EGLN3 (Reconstituted Complex), VHL (Reconstituted Complex), TCEB1 (Reconstituted Complex), TCEB2 (Reconstituted Complex), EPOR (Synthetic Lethality), EPOR (Affinity Capture-MS), EPOR (Protein-peptide), EPOR (Affinity Capture-Western), CISH (Affinity Capture-Western)

ESM2 similar proteins: A2APT9, A5PJC7, B0BN44, O94989, O95153, P14753, P19235, P25118, P36941, P40238, Q01114, Q07303, Q13671, Q2KL21, Q3U4N7, Q3UYR4, Q400G9, Q49LS3, Q5F267, Q5FWH6, Q5GH66, Q5JXC2, Q5R866, Q6UX68, Q6ZVH7, Q7TNF8, Q7Z3H0, Q80VJ8, Q80W87, Q8BG26, Q8BX43, Q8C310, Q8CII8, Q8MII8, Q8N386, Q8NBR0, Q8TE82, Q8WZ75, Q921Q7, Q93038

Diamond homologs: P14753, P19235, P40931, Q01113, Q07303, Q2KL21, Q4W815, Q9MYZ9, Q8R4S8, P40238, Q08351, Q8CII9, Q9HC73

SIGNOR signaling

12 interactions.

A	Effect	B	Mechanism
PTPN1	“down-regulates activity”	EPOR	dephosphorylation
EPO	up-regulates	EPOR	binding
JAK2	“up-regulates activity”	EPOR	phosphorylation
NOSIP	“up-regulates activity”	EPOR	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 21 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Growth hormone receptor signaling	5	183.0×	5e-09
Neutrophil degranulation	5	8.9×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
cytokine-mediated signaling pathway	6	52.2×	3e-07
T cell receptor signaling pathway	5	50.6×	4e-06
intracellular signal transduction	5	12.7×	7e-04

Disease & clinical

Cancer significance

Clinical variants and AI predictions

ClinVar

178 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	4
Uncertain significance	95
Likely benign	25
Benign	25

Top pathogenic / likely-pathogenic (6)

Variant ID	HGVS	Classification
16595	NM_000121.4(EPOR):c.1317G>A (p.Trp439Ter)	Pathogenic
3723428	NM_000121.4(EPOR):c.1195G>T (p.Glu399Ter)	Pathogenic
268131	NM_000121.4(EPOR):c.1316G>A (p.Trp439Ter)	Likely pathogenic
3899248	NM_000121.4(EPOR):c.950G>A (p.Trp317Ter)	Likely pathogenic
423071	NM_000121.4(EPOR):c.465_481dup (p.His161fs)	Likely pathogenic
4819730	NM_000121.4(EPOR):c.1340del (p.Pro447fs)	Likely pathogenic

SpliceAI

1491 predictions. Top by Δscore:

Variant	Effect	Δscore
19:11378774:GAGCC:G	acceptor_gain	1.0000
19:11378775:AGCC:A	acceptor_gain	1.0000
19:11378776:GCC:G	acceptor_gain	1.0000
19:11378777:CC:C	acceptor_gain	1.0000
19:11378777:CCC:C	acceptor_gain	1.0000
19:11378778:CC:C	acceptor_gain	1.0000
19:11378779:C:CC	acceptor_gain	1.0000
19:11378779:CT:C	acceptor_loss	1.0000
19:11378780:T:C	acceptor_loss	1.0000
19:11378788:CCAA:C	acceptor_gain	1.0000
19:11378789:CAA:C	acceptor_gain	1.0000
19:11378790:A:T	acceptor_gain	1.0000
19:11380882:A:AC	donor_gain	1.0000
19:11380883:C:CC	donor_gain	1.0000
19:11380883:CCGG:C	donor_gain	1.0000
19:11380931:C:CT	acceptor_gain	1.0000
19:11380967:CAGGT:C	acceptor_gain	1.0000
19:11380972:C:CC	acceptor_gain	1.0000
19:11381050:CCTCA:C	donor_loss	1.0000
19:11381051:CTCAC:C	donor_loss	1.0000
19:11381052:TCA:T	donor_loss	1.0000
19:11381053:CACCG:C	donor_loss	1.0000
19:11381054:A:AC	donor_gain	1.0000
19:11381054:A:AG	donor_loss	1.0000
19:11381055:C:CC	donor_gain	1.0000
19:11381055:CCG:C	donor_gain	1.0000
19:11381690:AC:A	donor_gain	1.0000
19:11381691:CC:C	donor_gain	1.0000
19:11381691:CCCT:C	donor_gain	1.0000
19:11381704:C:CA	donor_gain	1.0000

AlphaMissense

3249 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:11381136:A:T	V220D	0.998
19:11381781:A:G	W166R	0.997
19:11381781:A:T	W166R	0.997
19:11383156:C:A	W64C	0.997
19:11383156:C:G	W64C	0.997
19:11381133:C:G	R221P	0.996
19:11381093:G:C	S234R	0.995
19:11381093:G:T	S234R	0.995
19:11381095:T:G	S234R	0.995
19:11381779:C:A	W166C	0.995
19:11381779:C:G	W166C	0.995
19:11382006:G:C	F117L	0.995
19:11382006:G:T	F117L	0.995
19:11382008:A:G	F117L	0.995
19:11383164:A:G	C62R	0.994
19:11381096:C:A	W233C	0.993
19:11381096:C:G	W233C	0.993
19:11381739:A:C	Y180D	0.993
19:11378727:A:C	F293L	0.992
19:11378727:A:T	F293L	0.992
19:11378729:A:G	F293L	0.992
19:11381087:C:A	W236C	0.992
19:11381087:C:G	W236C	0.992
19:11381094:C:A	S234I	0.992
19:11381142:A:G	F218S	0.991
19:11382007:A:C	F117C	0.991
19:11383194:A:G	C52R	0.991
19:11383162:A:C	C62W	0.990
19:11383163:C:G	C62S	0.990
19:11383163:C:T	C62Y	0.990

dbSNP variants (sampled 300 via entrez): RS1000662735 (19:11383769 C>G), RS1002331320 (19:11380371 C>A), RS1002464588 (19:11380745 C>T), RS1002663347 (19:11379083 T>C), RS1002715714 (19:11378622 G>A,C), RS1002835061 (19:11383302 T>G), RS1002944054 (19:11385033 C>T), RS1003071534 (19:11377049 A>C), RS1003429180 (19:11377376 C>T), RS1003633138 (19:11377025 GCAGGAGGATCGCCTGAGCC>G), RS1003841581 (19:11384648 G>C,T), RS1004020008 (19:11378814 A>T), RS1005830342 (19:11382665 AT>A,ATT,ATTT), RS1006576690 (19:11381250 A>T), RS1006618418 (19:11382606 G>A,T)

Disease associations

OMIM: gene MIM:133171 | disease phenotypes: MIM:133100, MIM:309580

GenCC curated gene-disease

Disease	Classification	Inheritance
primary familial polycythemia due to EPO receptor mutation	Strong	Autosomal dominant

Mondo (3): primary familial polycythemia due to EPO receptor mutation (MONDO:0007572), intellectual disability-hypotonic facies syndrome, X-linked, 1 (MONDO:0010663), acute megakaryoblastic leukemia without down syndrome (MONDO:0018004)

Orphanet (9): Primary familial polycythemia (Orphanet:90042), X-linked intellectual disability-hypotonic face syndrome (Orphanet:73220), Holmes-Gang syndrome (Orphanet:93970), Chudley-Lowry-Hoar syndrome (Orphanet:93971), Juberg-Marsidi syndrome (Orphanet:93972), Carpenter-Waziri syndrome (Orphanet:93973), Smith-Fineman-Myers syndrome (Orphanet:93974), OBSOLETE: Renier-Gabreels-Jasper syndrome (Orphanet:93975), Acute megakaryoblastic leukemia in children without Down syndrome (Orphanet:329469)

HPO phenotypes

25 total (25 of 25 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000421	Epistaxis
HP:0000822	Hypertension
HP:0000989	Pruritus
HP:0001050	Plethora
HP:0001342	Cerebral hemorrhage
HP:0001658	Myocardial infarction
HP:0001744	Splenomegaly
HP:0001892	Abnormal bleeding
HP:0001898	Increased red blood cell mass
HP:0001899	Increased hematocrit
HP:0001900	Increased circulating hemoglobin concentration
HP:0001901	Polycythemia
HP:0001907	Thromboembolism
HP:0002027	Abdominal pain
HP:0002094	Dyspnea
HP:0002315	Headache
HP:0002321	Vertigo
HP:0002641	Peripheral thrombosis
HP:0002829	Arthralgia
HP:0002875	Exertional dyspnea
HP:0004936	Venous thrombosis
HP:0011902	Abnormal hemoglobin
HP:0012378	Fatigue
HP:0012735	Cough

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST005194_32	Coronary artery disease	2.000000e-06
GCST006536_1	Serum erythropoietin levels	2.000000e-11

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008391	erythropoetin measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C537445	Mental retardation Smith Fineman Myers type (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL1817 (SINGLE PROTEIN), CHEMBL4804252 (PROTEIN COMPLEX)

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: catalytic receptor — Prolactin receptor family

Most potent curated ligand interactions (2 total), top 2:

Ligand	Action	Affinity	Parameter
erythropoietin	Agonist	11.15	pIC50
peginesatide	Agonist	10.43	pIC50

ChEMBL bioactivities

21 potent at pChembl≥5 of 36 total, top 21 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.96	EC50	11	nM	CHEMBL4244759
7.92	EC50	12	nM	CHEMBL4239773
7.58	EC50	26	nM	CHEMBL4243291
7.51	EC50	31	nM	CHEMBL4243549
7.51	EC50	31	nM	CHEMBL4239220
7.38	EC50	42	nM	CHEMBL4249192
6.62	EC50	240	nM	CHEMBL4246983
6.27	EC50	540	nM	CHEMBL4240318
6.27	EC50	540	nM	CHEMBL4244160
6.27	EC50	540	nM	CHEMBL4244951
5.82	IC50	1500	nM	CHEMBL269188
5.82	IC50	1500	nM	CHEMBL406248
5.70	IC50	2000	nM	CHEMBL428168
5.40	IC50	4000	nM	CHEMBL414551
5.30	IC50	5000	nM	CHEMBL440818
5.22	IC50	6000	nM	CHEMBL217589
5.16	IC50	7000	nM	CHEMBL415681
5.00	IC50	1e+04	nM	CHEMBL58237
5.00	IC50	1e+04	nM	CHEMBL427610
5.00	IC50	1e+04	nM	CHEMBL61554
5.00	IC50	1e+04	nM	CHEMBL303757

PubChem BioAssay actives

21 with measured affinity, of 108 total; 21 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-29-[(2S)-butan-2-yl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-23-(naphthalen-1-ylmethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.0110	uM
(2S)-2-[[(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-29-[(2S)-butan-2-yl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-23-(naphthalen-1-ylmethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carbonyl]amino]-N-[(2S)-1-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]amino]-1-oxopropan-2-yl]-N-methylpentanediamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.0120	uM
(4R,7S,10S,13S,16S,19S,25S,28S,31R)-31-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-16-[(2S)-butan-2-yl]-13-[(1R)-1-hydroxyethyl]-28-(1H-imidazol-5-ylmethyl)-19,20-dimethyl-25-(2-methylsulfanylethyl)-10-(naphthalen-1-ylmethyl)-6,9,12,15,18,21,24,27,30-nonaoxo-7-propan-2-yl-1,2-dithia-5,8,11,14,17,20,23,26,29-nonazacyclodotriacontane-4-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.0260	uM
(4R,7S,10S,13S,16S,25S,28S,31R)-31-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-16-[(2S)-butan-2-yl]-13-[(1R)-1-hydroxyethyl]-28-(1H-imidazol-5-ylmethyl)-20-methyl-25-(2-methylsulfanylethyl)-10-(naphthalen-1-ylmethyl)-6,9,12,15,18,21,24,27,30-nonaoxo-7-propan-2-yl-1,2-dithia-5,8,11,14,17,20,23,26,29-nonazacyclodotriacontane-4-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.0310	uM
(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-(carbamoylamino)-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-29-[(2S)-butan-2-yl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-23-(naphthalen-1-ylmethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.0310	uM
(2S)-2-[[(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-29-[(2S)-butan-2-yl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-23-(naphthalen-1-ylmethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carbonyl]amino]-N-[2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]amino]-2-oxoethyl]-N-methylpentanediamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.0420	uM
(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-29-[(2S)-butan-2-yl]-23-[(4-chlorophenyl)methyl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.2400	uM
(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-29-[(2S)-butan-2-yl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-23-(naphthalen-2-ylmethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.5400	uM
(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-23-[(4-bromophenyl)methyl]-29-[(2S)-butan-2-yl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.5400	uM
(6S,9S,12R,17R,20S,23S,26S,29S,32S)-12-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[2-[(2-acetamidoacetyl)amino]acetyl]amino]-4-methylpentanoyl]amino]-3-(4-hydroxyphenyl)propanoyl]amino]propanoyl]amino]-N-[(2S)-5-amino-1-[(2S)-2-[[(2S)-1-[[(2S)-5-carbamimidamido-1-[[2-[[(2S)-1,6-diamino-1-oxohexan-2-yl]amino]-2-oxoethyl]-methylamino]-1-oxopentan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]carbamoyl]pyrrolidin-1-yl]-1,5-dioxopentan-2-yl]-29-[(2S)-butan-2-yl]-23-[(2-fluorophenyl)methyl]-26-[(1R)-1-hydroxyethyl]-9-(1H-imidazol-5-ylmethyl)-6-(2-methylsulfanylethyl)-2,5,8,11,19,22,25,28,31-nonaoxo-20-propan-2-yl-14,15-dithia-1,4,7,10,18,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-17-carboxamide	1399285: Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	ec50	0.5400	uM
5-[[(5R)-5-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-[2-[2-[2-[[(2S)-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-(4-carboxybutanoylamino)hexanoyl]amino]ethoxy]ethoxy]ethylamino]-6-oxohexyl]amino]-5-oxopentanoic acid	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	1.5000	uM
4-[[(5R)-5-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-[2-[2-[2-[[(2S)-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-(3-carboxypropanoylamino)hexanoyl]amino]ethoxy]ethoxy]ethylamino]-6-oxohexyl]amino]-4-oxobutanoic acid	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	1.5000	uM
(2R)-6-amino-N-[2-[2-[2-[[(2S)-6-amino-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]hexanoyl]amino]ethoxy]ethoxy]ethyl]-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]hexanamide	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	2.0000	uM
5-[[(5R)-5-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-[3-[4-[3-[[(2S)-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-(4-carboxybutanoylamino)hexanoyl]amino]propoxy]butoxy]propylamino]-6-oxohexyl]amino]-5-oxopentanoic acid	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	4.0000	uM
(3S,6S,9S,12S,15S,20R,23S,26S,32S)-15-[[(2S)-6-amino-2-[[(2S)-1-[(2S)-5-amino-2-[[2-[(2-aminoacetyl)amino]acetyl]amino]-5-oxopentanoyl]pyrrolidine-2-carbonyl]amino]hexanoyl]amino]-N-[(2S)-1-[[(2S)-1-[[(2S,3R)-1-[[2-[(2-amino-2-oxoethyl)amino]-2-oxoethyl]amino]-3-hydroxy-1-oxobutan-2-yl]amino]-3-hydroxy-1-oxopropan-2-yl]amino]-3-(4-hydroxyphenyl)-1-oxopropan-2-yl]-26-benzyl-6-[(1R)-1-hydroxyethyl]-23-(1H-imidazol-4-ylmethyl)-9-(1H-indol-3-ylmethyl)-3-(2-methylpropyl)-2,5,8,11,14,22,25,28,31-nonaoxo-12-propan-2-yl-17,18-dithia-1,4,7,10,13,21,24,27,30-nonazabicyclo[30.3.0]pentatriacontane-20-carboxamide	70702: Compound was evaluated for inhibition of [125I]EPO binding to Erythropoietin receptor (EBP)	ic50	5.0000	uM
4-[[(5R)-5-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-[3-[4-[3-[[(2S)-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-(3-carboxypropanoylamino)hexanoyl]amino]propoxy]butoxy]propylamino]-6-oxohexyl]amino]-4-oxobutanoic acid	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	6.0000	uM
4-[[(5S)-5-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-[3-[2-[2-[3-[[(2S)-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-(3-carboxypropanoylamino)hexanoyl]amino]propoxy]ethoxy]ethoxy]propylamino]-6-oxohexyl]amino]-4-oxobutanoic acid	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	7.0000	uM
5-[[(5S)-5-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-[3-[2-[2-[3-[[(2S)-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]-6-(4-carboxybutanoylamino)hexanoyl]amino]propoxy]ethoxy]ethoxy]propylamino]-6-oxohexyl]amino]-5-oxopentanoic acid	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	10.0000	uM
methyl (2S)-6-amino-2-[bis[(3-phenylmethoxyphenyl)methyl]amino]hexanoate	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	10.0000	uM
methyl (2S)-6-amino-2-[[(E)-3-[3-(4-tert-butylphenoxy)phenyl]prop-1-enyl]-[(3-phenylmethoxyphenyl)methyl]amino]hexanoate	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	10.0000	uM
methyl (2S)-6-amino-2-[bis[(4-phenylmethoxyphenyl)methyl]amino]hexanoate	70697: Compound was evaluated for inhibition of [125I]-EPO binding to Erythropoietin receptor (EBP)	ic50	10.0000	uM

CTD chemical–gene interactions

53 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects expression, affects cotreatment	8
Estradiol	decreases expression, increases expression, affects expression	3
entinostat	increases expression, affects cotreatment	2
Air Pollutants	affects expression, increases abundance, decreases expression	2
Tobacco Smoke Pollution	decreases expression	2
GSK-J4	decreases expression	1
dicrotophos	decreases expression	1
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	increases expression	1
sodium arsenate	affects response to substance	1
trichostatin A	increases expression	1
nickel chloride	affects expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
bafilomycin A1	decreases expression, decreases reaction, increases degradation	1
testosterone-3-carboxymethyloxime-bovine serum albumin conjugate	affects reaction, increases expression, decreases reaction	1
perfluorooctane sulfonic acid	increases expression	1
pyrazolanthrone	decreases reaction, increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
dorsomorphin	affects cotreatment, increases expression	1
jinfukang	affects cotreatment, increases expression	1
Gefitinib	increases expression	1
Resveratrol	decreases expression, affects cotreatment	1
Wortmannin	decreases reaction, increases expression	1
Arsenic Trioxide	decreases expression	1
Aluminum	affects expression	1
Amphotericin B	increases expression	1
Benzo(a)pyrene	increases methylation, affects methylation	1
Biological Factors	decreases expression	1
Chelating Agents	decreases expression, affects binding	1

ChEMBL screening assays

9 unique, capped per target: 9 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4235755	Binding	Agonist activity at EPO receptor in human TF1 cells assessed as induction of cell proliferation after 48 hrs by MTT assay	Design, synthesis, and activity evaluation of novel erythropoietin mimetic peptides. — Bioorg Med Chem Lett

Cellosaurus cell lines

6 cell lines: 5 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D7PG	Ubigene A-549 EPOR KO	Cancer cell line	Male
CVCL_D8KY	Ubigene HCT 116 EPOR KO	Cancer cell line	Male
CVCL_D9EE	Ubigene HEK293 EPOR KO	Transformed cell line	Female
CVCL_E0CQ	Ubigene HeLa EPOR KO	Cancer cell line	Female
CVCL_SM25	HAP1 EPOR (-) 1	Cancer cell line	Male
CVCL_SM26	HAP1 EPOR (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.