EXOSC8

Summary

EXOSC8 (exosome component 8, HGNC:17035) is a protein-coding gene on chromosome 13q13.3, encoding Exosome complex component RRP43 (Q96B26). Non-catalytic component of the RNA exosome complex which has 3’->5’ exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. It is a common-essential gene (DepMap: required in 98.3% of cancer cell lines).

This gene encodes a 3’-5’ exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6.

Source: NCBI Gene 11340 — RefSeq curated summary.

At a glance

• Gene–disease (curated): pontocerebellar hypoplasia, type 1C (Strong, GenCC) — +1 more curated relationship
• Clinical variants (ClinVar): 138 total — 2 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 42
• Cancer dependency (DepMap): dependent in 98.3% of screened cell lines (common-essential)
• MANE Select transcript: NM_181503

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17035
Approved symbol	EXOSC8
Name	exosome component 8
Location	13q13.3
Locus type	gene with protein product
Status	Approved
Aliases	OIP2, RRP43, bA421P11.3, Rrp43p, EAP2, p9, CIP3
Ensembl gene	ENSG00000120699
Ensembl biotype	protein_coding
OMIM	606019
Entrez	11340

Gene structure

Transcript identifiers

Ensembl transcripts: 38 — 15 protein_coding, 15 retained_intron, 5 nonsense_mediated_decay, 3 protein_coding_CDS_not_defined

ENST00000239893, ENST00000389704, ENST00000464235, ENST00000470423, ENST00000474661, ENST00000481013, ENST00000488108, ENST00000488779, ENST00000489088, ENST00000490537, ENST00000495092, ENST00000684866, ENST00000685563, ENST00000685624, ENST00000685643, ENST00000686472, ENST00000686701, ENST00000686729, ENST00000687482, ENST00000687944, ENST00000688064, ENST00000688436, ENST00000688771, ENST00000689744, ENST00000689948, ENST00000690673, ENST00000690774, ENST00000691611, ENST00000692143, ENST00000692477, ENST00000692588, ENST00000692636, ENST00000692761, ENST00000692787, ENST00000693100, ENST00000693562, ENST00000693733, ENST00000932950

RefSeq mRNA: 1 — MANE Select: NM_181503 NM_181503

CCDS: CCDS31958

Canonical transcript exons

ENST00000389704 — 11 exons

Exon	Start	End
ENSE00001537174	37000786	37000822
ENSE00003474106	37004516	37004561
ENSE00003475437	37002273	37002309
ENSE00003515150	37002934	37003007
ENSE00003566293	37006115	37006160
ENSE00003576663	37008729	37008835
ENSE00003584173	37005920	37006025
ENSE00003585628	37008057	37008177
ENSE00003598091	37006975	37007071
ENSE00003635437	37009184	37009614
ENSE00003663806	37002488	37002551

Expression profiles

Bgee: expression breadth ubiquitous, 298 present calls, max score 96.42.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 23.3601 / max 531.8351, expressed in 1791 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
134780	22.3903	1787
134779	0.8327	540
134782	0.0665	23
207006	0.0462	9
134781	0.0244	6

Top tissues by expression

300 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	96.42	gold quality
ganglionic eminence	UBERON:0004023	95.95	gold quality
right uterine tube	UBERON:0001302	95.72	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	94.93	gold quality
embryo	UBERON:0000922	94.76	gold quality
left ovary	UBERON:0002119	94.67	gold quality
right ovary	UBERON:0002118	94.44	gold quality
right testis	UBERON:0004534	93.98	gold quality
ovary	UBERON:0000992	93.92	gold quality
left testis	UBERON:0004533	93.91	gold quality
testis	UBERON:0000473	93.73	gold quality
body of uterus	UBERON:0009853	93.57	gold quality
endocervix	UBERON:0000458	93.48	gold quality
rectum	UBERON:0001052	93.32	gold quality
body of pancreas	UBERON:0001150	93.29	gold quality
ectocervix	UBERON:0012249	93.18	gold quality
lymph node	UBERON:0000029	93.01	gold quality
endometrium	UBERON:0001295	92.96	gold quality
spleen	UBERON:0002106	92.91	gold quality
tibial nerve	UBERON:0001323	92.88	gold quality
left uterine tube	UBERON:0001303	92.87	gold quality
tendon of biceps brachii	UBERON:0008188	92.84	gold quality
sperm	CL:0000019	92.74	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	92.64	gold quality
granulocyte	CL:0000094	92.53	gold quality
islet of Langerhans	UBERON:0000006	92.36	gold quality
vermiform appendix	UBERON:0001154	92.14	gold quality
left lobe of thyroid gland	UBERON:0001120	92.13	gold quality
metanephros cortex	UBERON:0010533	92.11	gold quality
pancreas	UBERON:0001264	92.05	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-HCAD-13	yes	22.23
E-MTAB-9067	yes	21.86
E-CURD-112	yes	8.76
E-MTAB-9801	yes	7.36
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC

miRNA regulators (miRDB)

35 targeting EXOSC8, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-2052	99.79	69.37	2031
HSA-MIR-8076	99.78	68.52	1170
HSA-MIR-2681-5P	99.75	67.64	1655
HSA-MIR-29B-2-5P	99.67	68.98	1726
HSA-MIR-1284	99.67	73.56	1353
HSA-MIR-2113	99.58	71.22	1521
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-7849-3P	99.47	68.17	1224
HSA-MIR-19A-5P	99.36	66.93	1675
HSA-MIR-19B-1-5P	99.36	67.07	1669
HSA-MIR-19B-2-5P	99.36	67.07	1669
HSA-MIR-224-3P	98.91	68.42	1815
HSA-MIR-522-3P	98.91	68.56	1817
HSA-MIR-4774-3P	98.90	67.82	737
HSA-MIR-3145-3P	98.85	69.07	2031

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 98.3% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 7)

• A protein subunit of human RNase P, Rpp14, and its interacting partner, OIP2, have 3’–>5’ exoribonuclease activity. (PMID:11929972)
• Protein-protein interactions between human exosome components support the assembly of RNase PH-type subunits into a six-membered PNPase-like ring. (PMID:12419256)
• homozygous missense mutations cause progressive and lethal neurological disease (PMID:24989451)
• Knock-down of rbm7, exosc8 and exosc3 in zebrafish showed a common pattern of defects in motor neurons and cerebellum. Our data indicate that impaired RNA metabolism may underlie the clinical phenotype by fine tuning gene expression which is essential for correct neuronal differentiation (PMID:27193168)
• Comprehensive characterization of the rRNA metabolism-related genes in human cancer. (PMID:31548613)
• EXOSC8 promotes colorectal cancer tumorigenesis via regulating ribosome biogenesis-related processes. (PMID:36348012)
• A missense variant in EXOSC8 causes exon skipping and expands the phenotypic spectrum of pontocerebellar hypoplasia type 1C. (PMID:38017281)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	exosc8	ENSDARG00000068755
mus_musculus	Exosc8	ENSMUSG00000027752
rattus_norvegicus	Exosc8	ENSRNOG00000051623
caenorhabditis_elegans		WBGENE00018305

Paralogs (2): EXOSC7 (ENSG00000075914), EXOSC9 (ENSG00000123737)

Protein

Protein identifiers

Exosome complex component RRP43 — Q96B26 (reviewed: Q96B26)

Alternative names: Exosome component 8, Opa-interacting protein 2, Ribosomal RNA-processing protein 43, p9

All UniProt accessions (8): A0A8I5KNS0, A0A8I5KRG4, A0A8I5KRX4, A0A8I5KVC8, A0A8I5QJI7, Q96B26, H7C581, H7C5Z2

UniProt curated annotations — full annotation on UniProt →

Function. Non-catalytic component of the RNA exosome complex which has 3’->5’ exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding ‘pervasive’ transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3’ untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC8 binds to ARE-containing RNAs.

Subunit / interactions. Component of the RNA exosome core complex (Exo-9), composed of EXOSC1, EXOSC2, EXOSC3, EXOSC4, EXOSC5, EXOSC6, EXOSC7, EXOSC8 and EXOSC9; within the complex interacts with EXOSC5 and EXOSC6. The catalytically inactive RNA exosome core complex (Exo-9) associates with the catalytic subunit EXOSC10/RRP6. Exo-9 may associate with DIS3 to form the nucleolar exosome complex, or DIS3L to form the cytoplasmic exosome complex. Exo-9 is formed by a hexameric base ring consisting of the heterodimers EXOSC4-EXOSC9, EXOSC5-EXOSC8 and EXOSC6-EXOSC7, and a cap ring consisting of EXOSC1, EXOSC2 and EXOSC3. The RNA exosome complex associates with cofactors C1D/RRP47, MPHOSPH6/MPP6 and MTREX/MTR4. Binds outer membrane protein opap from Neisseria gonorrhoeae.

Subcellular location. Cytoplasm. Nucleus. Nucleolus.

Disease relevance. Pontocerebellar hypoplasia 1C (PCH1C) [MIM:616081] A severe autosomal recessive neurodegenerative disease characterized by cerebellar and corpus callosum hypoplasia, abnormal myelination of the central nervous system, and spinal motor neuron disease. Affected individuals manifest failure to thrive, severe muscle weakness, spasticity and psychomotor retardation. Vision and hearing are impaired. The disease is caused by variants affecting the gene represented in this entry. EXOSC8 dysfunction causes myelin disruption through an imbalanced supply of myelin proteins due to dysregulation of their ARE-containing mRNAs.

Similarity. Belongs to the RNase PH family.

RefSeq proteins (1): NP_852480* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001247	ExoRNase_PH_dom1	Domain
IPR015847	ExoRNase_PH_dom2	Domain
IPR020568	Ribosomal_Su5_D2-typ_SF	Homologous_superfamily
IPR027408	PNPase/RNase_PH_dom_sf	Homologous_superfamily
IPR033196	Rrp43	Family
IPR036345	ExoRNase_PH_dom2_sf	Homologous_superfamily
IPR050590	Exosome_comp_Rrp42_subfam	Family

Pfam: PF01138, PF03725

UniProt features (31 total): strand 16, helix 5, turn 4, sequence variant 2, initiator methionine 1, chain 1, modified residue 1, sequence conflict 1

Structure

Experimental structures (PDB)

8 structures.

PDB	Method	Resolution (Å)
9G8M	ELECTRON MICROSCOPY	3.3
2NN6	X-RAY DIFFRACTION	3.35
9G8O	ELECTRON MICROSCOPY	3.4
6D6Q	ELECTRON MICROSCOPY	3.45
6D6R	ELECTRON MICROSCOPY	3.45
9G8N	ELECTRON MICROSCOPY	3.7
6H25	ELECTRON MICROSCOPY	3.8
9G8P	ELECTRON MICROSCOPY	7

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96B26-F1	85.77	0.31

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 2

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-380994	ATF4 activates genes in response to endoplasmic reticulum stress
R-HSA-429958	mRNA decay by 3’ to 5’ exoribonuclease
R-HSA-450385	Butyrate Response Factor 1 (BRF1) binds and destabilizes mRNA
R-HSA-450513	Tristetraprolin (TTP, ZFP36) binds and destabilizes mRNA
R-HSA-450604	KSRP (KHSRP) binds and destabilizes mRNA
R-HSA-6791226	Major pathway of rRNA processing in the nucleolus and cytosol
R-HSA-9930044	Nuclear RNA decay

MSigDB gene sets: 310 (showing top): GOBP_RIBOSOME_BIOGENESIS, REACTOME_UNFOLDED_PROTEIN_RESPONSE_UPR, GOMF_RNA_NUCLEASE_ACTIVITY, GOMF_NUCLEASE_ACTIVITY, GOBP_TRNA_METABOLIC_PROCESS, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GNF2_MCM5, chr13q13, PUJANA_CHEK2_PCC_NETWORK, MUELLER_PLURINET, GOBP_RNA_SURVEILLANCE, ONKEN_UVEAL_MELANOMA_UP, GNF2_ANP32B, GOBP_MATURATION_OF_5_8S_RRNA_FROM_TRICISTRONIC_RRNA_TRANSCRIPT_SSU_RRNA_5_8S_RRNA_LSU_RRNA, GNF2_SMC4L1

GO Biological Process (11): exonucleolytic trimming to generate mature 3’-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000467), RNA processing (GO:0006396), RNA catabolic process (GO:0006401), rRNA catabolic process (GO:0016075), U1 snRNA 3’-end processing (GO:0034473), U4 snRNA 3’-end processing (GO:0034475), U5 snRNA 3’-end processing (GO:0034476), nuclear mRNA surveillance (GO:0071028), nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035), TRAMP-dependent tRNA surveillance pathway (GO:0071038), rRNA processing (GO:0006364)

GO Molecular Function (4): mRNA 3’-UTR AU-rich region binding (GO:0035925), identical protein binding (GO:0042802), RNA binding (GO:0003723), protein binding (GO:0005515)

GO Cellular Component (12): nuclear exosome (RNase complex) (GO:0000176), cytoplasmic exosome (RNase complex) (GO:0000177), exosome (RNase complex) (GO:0000178), fibrillar center (GO:0001650), nucleus (GO:0005634), nucleoplasm (GO:0005654), chromosome (GO:0005694), nucleolus (GO:0005730), cytoplasm (GO:0005737), cytosol (GO:0005829), nucleolar exosome (RNase complex) (GO:0101019), exoribonuclease complex (GO:1905354)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Regulation of mRNA stability by proteins that bind AU-rich elements	3
PERK regulates gene expression	1
Deadenylation-dependent mRNA decay	1
rRNA processing in the nucleus and cytosol	1
Metabolism of RNA	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
snRNA 3’-end processing	3
nuclear RNA surveillance	3
nuclear lumen	3
rRNA metabolic process	2
exosome (RNase complex)	2
cytoplasm	2
intracellular anatomical structure	2
nucleolus	2
intracellular membraneless organelle	2
maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	1
rRNA 3’-end processing	1
gene expression	1
RNA biosynthetic process	1
primary metabolic process	1
RNA metabolic process	1
nucleic acid catabolic process	1
RNA catabolic process	1
nuclear-transcribed mRNA catabolic process	1
tRNA surveillance	1
RNA processing	1
ribosome biogenesis	1
mRNA 3’-UTR binding	1
protein binding	1
nucleic acid binding	1
binding	1
nucleus	1
nuclear protein-containing complex	1
exoribonuclease complex	1
intracellular membrane-bounded organelle	1
nuclear exosome (RNase complex)	1
catalytic complex	1

Protein interactions and networks

STRING

2199 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
EXOSC8	EXOSC5	Q9NQT4	999
EXOSC8	EXOSC4	Q9NPD3	999
EXOSC8	EXOSC3	Q9NQT5	999
EXOSC8	EXOSC1	Q9Y3B2	999
EXOSC8	EXOSC6	Q5RKV6	999
EXOSC8	EXOSC7	Q15024	991
EXOSC8	EXOSC9	Q06265	991
EXOSC8	EXOSC2	Q13868	978
EXOSC8	EXOSC10	Q01780	976
EXOSC8	DIS3	Q9Y2L1	967
EXOSC8	NIP7	Q9Y221	915
EXOSC8	DIS3L	Q8TF46	837
EXOSC8	SKIC2	Q15477	831
EXOSC8	OIP5	O43482	811
EXOSC8	TRIP6	Q15654	795

IntAct

320 interactions, top by confidence:

A	B	Type	Score
EXOSC8	EXOSC5	psi-mi:“MI:0915”(physical association)	0.950
EXOSC5	EXOSC8	psi-mi:“MI:0915”(physical association)	0.950
EXOSC8	EXOSC1	psi-mi:“MI:0915”(physical association)	0.890
EXOSC8	DUSP23	psi-mi:“MI:0915”(physical association)	0.810
DUSP23	EXOSC8	psi-mi:“MI:0915”(physical association)	0.810
EXOSC1	EXOSC10	psi-mi:“MI:0915”(physical association)	0.810
EXOSC8	EXOSC8	psi-mi:“MI:0915”(physical association)	0.740
TXNDC9	EXOSC8	psi-mi:“MI:0915”(physical association)	0.720
EXOSC8	TFAP4	psi-mi:“MI:0915”(physical association)	0.720
EXOSC8	OTUD4	psi-mi:“MI:0915”(physical association)	0.720
FAM90A1	EXOSC8	psi-mi:“MI:0915”(physical association)	0.720
EXOSC8	TXNDC17	psi-mi:“MI:0915”(physical association)	0.720
EXOSC8	TXNDC9	psi-mi:“MI:0915”(physical association)	0.720
TFAP4	EXOSC8	psi-mi:“MI:0915”(physical association)	0.720
EXOSC8	FAM90A1	psi-mi:“MI:0915”(physical association)	0.720
TXNDC17	EXOSC8	psi-mi:“MI:0915”(physical association)	0.720

BioGRID (343): EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), EXOSC8 (Two-hybrid), OTUD4 (Two-hybrid), DUSP23 (Two-hybrid), FAM90A1 (Two-hybrid), EXOSC5 (Two-hybrid), AEN (Two-hybrid)

ESM2 similar proteins: A4YJV0, A5E8F2, B6JAL5, B8BJ39, B8BM17, O08810, O09061, O23714, O24633, O80526, O81147, P18421, P20618, P28024, P28070, P34067, P40304, P40307, P49721, P99026, Q01217, Q2KHU3, Q2QNG7, Q2QXR8, Q2QZ86, Q2RAK2, Q2TBX6, Q3SWE6, Q3SX43, Q3T108, Q5E9K0, Q5F3X4, Q5RCW2, Q63486, Q6DRF3, Q7DLR9, Q7L523, Q80X95, Q89WM9, Q8K1R3

Diamond homologs: A2C412, A4QEY2, A4YJR3, A5E8I9, A6Q4N2, B2V890, B3EH06, B3EMN6, B5YFY8, B6YSE7, B8I2R5, C1DTW6, C3MQ47, C3MVG5, C3N5R4, C3NED0, C3NHC2, C3PH09, C4KHE3, C4LJ74, C5A2B8, O26778, O29756, O59224, O74918, Q05636, Q06265, Q0W2Y7, Q10205, Q15024, Q2GGA4, Q2KHU3, Q3SW80, Q3SWZ4, Q3YSC4, Q47RU5, Q4QR75, Q54VM4, Q5FHK5, Q5HBH6

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
EXOSC8	“form complex”	Exosome_Complex	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 77 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
mRNA decay by 3’ to 5’ exoribonuclease	7	111.0×	1e-11
Butyrate Response Factor 1 (BRF1) binds and destabilizes mRNA	7	98.7×	1e-11
Tristetraprolin (TTP, ZFP36) binds and destabilizes mRNA	7	98.7×	1e-11
KSRP (KHSRP) binds and destabilizes mRNA	7	98.7×	1e-11
Nuclear RNA decay	12	82.3×	2e-18
ATF4 activates genes in response to endoplasmic reticulum stress	7	63.4×	5e-10
Major pathway of rRNA processing in the nucleolus and cytosol	14	19.2×	9e-13
rRNA processing in the nucleus and cytosol	5	17.9×	3e-04

GO biological processes:

GO term	Partners	Fold	FDR
maturation of 5.8S rRNA	5	73.1×	2e-07
rRNA catabolic process	5	68.8×	3e-07
nuclear-transcribed mRNA catabolic process	6	63.8×	2e-08
RNA catabolic process	10	63.3×	2e-13
RNA processing	11	33.4×	5e-12
rRNA processing	10	19.7×	5e-09
mRNA splicing, via spliceosome	6	7.6×	3e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

138 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	1
Uncertain significance	64
Likely benign	38
Benign	16

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
1027469	NM_181503.3(EXOSC8):c.269C>G (p.Ser90Ter)	Pathogenic
157609	NM_181503.3(EXOSC8):c.5C>T (p.Ala2Val)	Pathogenic
4845689	NM_181503.3(EXOSC8):c.259delinsTGG (p.Pro87fs)	Likely pathogenic

SpliceAI

3209 predictions. Top by Δscore:

Variant	Effect	Δscore
13:37002477:T:G	acceptor_gain	1.0000
13:37002552:G:GG	donor_gain	1.0000
13:37002557:G:GT	donor_gain	1.0000
13:37002929:TTCA:T	acceptor_loss	1.0000
13:37002930:TCA:T	acceptor_loss	1.0000
13:37002932:A:AG	acceptor_gain	1.0000
13:37002933:G:GA	acceptor_gain	1.0000
13:37002933:GGTTC:G	acceptor_gain	1.0000
13:37003004:AGCA:A	donor_gain	1.0000
13:37003005:GCA:G	donor_gain	1.0000
13:37003005:GCAG:G	donor_gain	1.0000
13:37003006:CA:C	donor_gain	1.0000
13:37003006:CAGT:C	donor_loss	1.0000
13:37003007:AG:A	donor_loss	1.0000
13:37003008:G:GG	donor_gain	1.0000
13:37003009:TAA:T	donor_loss	1.0000
13:37003010:AA:A	donor_loss	1.0000
13:37004562:G:C	donor_loss	1.0000
13:37004562:G:GG	donor_gain	1.0000
13:37004563:T:A	donor_loss	1.0000
13:37005944:T:TA	acceptor_gain	1.0000
13:37005946:T:TA	acceptor_gain	1.0000
13:37006026:G:GG	donor_gain	1.0000
13:37006962:A:AG	acceptor_gain	1.0000
13:37006963:A:G	acceptor_gain	1.0000
13:37006964:T:G	acceptor_gain	1.0000
13:37006968:A:AG	acceptor_gain	1.0000
13:37006969:T:G	acceptor_gain	1.0000
13:37006969:TTTTA:T	acceptor_loss	1.0000
13:37006970:TTTAG:T	acceptor_loss	1.0000

AlphaMissense

1789 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
13:37002500:C:A	R23S	0.997
13:37002514:A:C	R27S	0.997
13:37002514:A:T	R27S	0.997
13:37002995:T:G	C60W	0.997
13:37007005:T:C	C141R	0.997
13:37002513:G:C	R27T	0.996
13:37002531:G:C	R33T	0.996
13:37002957:T:C	S48P	0.996
13:37002960:G:C	A49P	0.996
13:37006981:T:A	W133R	0.996
13:37006981:T:C	W133R	0.996
13:37007021:G:T	G146V	0.996
13:37009231:G:C	A255P	0.996
13:37002304:T:C	F17L	0.995
13:37002306:T:A	F17L	0.995
13:37002306:T:G	F17L	0.995
13:37002532:A:C	R33S	0.995
13:37002532:A:T	R33S	0.995
13:37002993:T:C	C60R	0.995
13:37002994:G:A	C60Y	0.995
13:37004552:G:A	G77R	0.995
13:37004552:G:C	G77R	0.995
13:37005948:T:G	C89W	0.995
13:37002531:G:T	R33I	0.994
13:37002955:G:A	G47D	0.994
13:37002961:C:A	A49D	0.994
13:37002997:G:A	G61E	0.994
13:37004553:G:A	G77E	0.994
13:37005929:T:A	V83E	0.994
13:37005946:T:C	C89R	0.994

dbSNP variants (sampled 300 via entrez): RS1000576901 (13:37001050 C>T), RS1000582390 (13:37008279 C>G,T), RS1000638797 (13:37001286 G>A), RS1000916818 (13:37007561 T>C), RS1000926768 (13:37007867 G>C), RS1001098633 (13:37001238 G>A), RS1001259769 (13:37000983 C>A), RS1001527778 (13:37006335 A>C), RS1001582005 (13:37000036 A>G), RS1002429465 (13:37006920 C>T), RS1002586731 (13:36998850 C>A), RS1002605838 (13:37005288 G>A), RS1002658776 (13:36999067 A>C), RS1002771803 (13:37000713 G>C,T), RS1003020471 (13:36999464 TGGAGAGGAGCGCTAGGTTCC>T)

Disease associations

OMIM: gene MIM:606019 | disease phenotypes: MIM:108600, MIM:616081

GenCC curated gene-disease

Disease	Classification	Inheritance
pontocerebellar hypoplasia, type 1C	Strong	Autosomal recessive
pontocerebellar hypoplasia type 1	Supportive	Autosomal recessive

Mondo (3): spastic ataxia (MONDO:0017845), pontocerebellar hypoplasia, type 1C (MONDO:0014485), pontocerebellar hypoplasia type 1 (MONDO:0016396)

Orphanet (2): Spastic ataxia (Orphanet:316226), Pontocerebellar hypoplasia type 1 (Orphanet:2254)

HPO phenotypes

42 total (30 of 42 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000253	Progressive microcephaly
HP:0000365	Hearing impairment
HP:0000486	Strabismus
HP:0000505	Visual impairment
HP:0000529	Progressive visual loss
HP:0000565	Esotropia
HP:0000639	Nystagmus
HP:0000648	Optic atrophy
HP:0000737	Irritability
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001252	Hypotonia
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001265	Hyporeflexia
HP:0001270	Motor delay
HP:0001285	Spastic tetraparesis
HP:0001308	Tongue fasciculations
HP:0001320	Cerebellar vermis hypoplasia
HP:0001324	Muscle weakness
HP:0001347	Hyperreflexia
HP:0001508	Failure to thrive
HP:0002079	Hypoplasia of the corpus callosum
HP:0002093	Respiratory insufficiency
HP:0002120	Cerebral cortical atrophy
HP:0002280	Enlarged cisterna magna
HP:0002350	Cerebellar cyst
HP:0002398	Degeneration of anterior horn cells
HP:0002804	Arthrogryposis multiplex congenita

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
C548069	Pontocerebellar Hypoplasia Type 1 (supp.)
C564815	Spastic Ataxia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

58 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
(+)-JQ1 compound	decreases expression	2
Tetrachlorodibenzodioxin	affects expression, decreases expression	2
Cyclosporine	increases expression	2
aristolochic acid I	decreases expression	1
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
propionaldehyde	decreases expression	1
bisphenol A	decreases expression	1
trichostatin A	affects expression	1
arsenite	increases reaction, affects binding	1
mono-(2-ethylhexyl)phthalate	decreases expression	1
sodium arsenite	decreases expression	1
cobaltous chloride	decreases expression	1
potassium chromate(VI)	decreases expression	1
nickel sulfate	decreases expression	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	increases expression	1
azoxystrobin	increases expression	1
perfluoro-n-nonanoic acid	increases expression	1
deguelin	increases expression	1
fenpyroximate	increases expression	1
4-chloro-N-((4-(1,1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
pyrimidifen	increases expression	1
nutlin 3	affects cotreatment, increases secretion	1
thifluzamide	increases expression	1
pyrachlostrobin	increases expression	1
LDN 193189	affects cotreatment, increases expression	1
picoxystrobin	increases expression	1

Clinical trials (associated diseases)

2 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT04297891	Not specified	UNKNOWN	Phenotypes, Biomarkers and Pathophysiology in Spastic Ataxias