EZH2

Summary

EZH2 (enhancer of zeste 2 polycomb repressive complex 2 subunit, HGNC:3527) is a protein-coding gene on chromosome 7q36.1, encoding Histone-lysine N-methyltransferase EZH2 (Q15910). Catalytic subunit of the PRC2/EED-EZH2 complex, a Polycomb group (PcG) complex that methylates ‘Lys-9’ (H3K9me) and ‘Lys-27’ (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene. In precision oncology, EZH2 Activating Mutation confers sensitivity to Tazemetostat in Follicular Lymphoma (CIViC Level A); 17 further curated variant–drug associations are listed below.

This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Source: NCBI Gene 2146 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Weaver syndrome (Definitive, ClinGen)
• GWAS associations: 14
• Clinical variants (ClinVar): 732 total — 10 pathogenic, 26 likely-pathogenic
• Phenotypes (HPO): 99
• Druggable target: yes — 6 molecules with ChEMBL bioactivity
• Precision-oncology evidence (CIViC): 18 curated variant–drug associations
• Cancer driver (intOGen): activating (oncogene-like) across 6 cancer types
• Transcription factor: yes — 165 downstream targets (CollecTRI)
• MANE Select transcript: NM_004456

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3527
Approved symbol	EZH2
Name	enhancer of zeste 2 polycomb repressive complex 2 subunit
Location	7q36.1
Locus type	gene with protein product
Status	Approved
Aliases	EZH1, ENX-1, KMT6, KMT6A
Ensembl gene	ENSG00000106462
Ensembl biotype	protein_coding
OMIM	601573
Entrez	2146

Gene structure

Transcript identifiers

Ensembl transcripts: 38 — 24 protein_coding, 8 retained_intron, 6 nonsense_mediated_decay

ENST00000320356, ENST00000350995, ENST00000460911, ENST00000469631, ENST00000476773, ENST00000478654, ENST00000483012, ENST00000483967, ENST00000492143, ENST00000498186, ENST00000682263, ENST00000682317, ENST00000682401, ENST00000683292, ENST00000683293, ENST00000683744, ENST00000684300, ENST00000684400, ENST00000684436, ENST00000684510, ENST00000893364, ENST00000893365, ENST00000893366, ENST00000893367, ENST00000893368, ENST00000931950, ENST00000931951, ENST00000931952, ENST00000931953, ENST00000931954, ENST00000931955, ENST00000931956, ENST00000931957, ENST00000931958, ENST00000931959, ENST00000931960, ENST00000931961, ENST00000943026

RefSeq mRNA: 5 — MANE Select: NM_004456 NM_001203247, NM_001203248, NM_001203249, NM_004456, NM_152998

CCDS: CCDS56516, CCDS56517, CCDS56518, CCDS5891, CCDS5892

Canonical transcript exons

ENST00000320356 — 20 exons

Exon	Start	End
ENSE00000729545	148816684	148816778
ENSE00000729547	148817222	148817391
ENSE00000729548	148817877	148818117
ENSE00001280487	148826454	148826632
ENSE00001938395	148884164	148884291
ENSE00003472219	148815506	148815546
ENSE00003478155	148829728	148829848
ENSE00003487653	148819596	148819687
ENSE00003517664	148832634	148832750
ENSE00003522638	148827164	148827266
ENSE00003536171	148814914	148815039
ENSE00003538474	148809310	148809390
ENSE00003573955	148809071	148809155
ENSE00003574435	148811625	148811720
ENSE00003589388	148846470	148846598
ENSE00003631618	148828740	148828880
ENSE00003632434	148810333	148810414
ENSE00003649824	148847182	148847305
ENSE00003685811	148813959	148814137
ENSE00003896389	148807383	148807706

Expression profiles

Bgee: expression breadth ubiquitous, 216 present calls, max score 96.20.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 11.0032 / max 205.5598, expressed in 1604 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
86715	7.0243	1466
86714	3.9602	1136
86713	0.0187	3

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ganglionic eminence	UBERON:0004023	96.20	gold quality
ventricular zone	UBERON:0003053	95.95	gold quality
embryo	UBERON:0000922	94.88	gold quality
buccal mucosa cell	CL:0002336	91.12	gold quality
left testis	UBERON:0004533	90.80	gold quality
right testis	UBERON:0004534	90.48	gold quality
testis	UBERON:0000473	89.86	gold quality
sperm	CL:0000019	89.44	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	89.18	gold quality
gingival epithelium	UBERON:0001949	88.59	gold quality
mucosa of transverse colon	UBERON:0004991	88.07	gold quality
skin of abdomen	UBERON:0001416	88.02	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	87.57	gold quality
bone marrow	UBERON:0002371	87.54	gold quality
cortical plate	UBERON:0005343	87.13	gold quality
esophagus mucosa	UBERON:0002469	87.10	gold quality
skin of leg	UBERON:0001511	87.08	gold quality
male germ cell	CL:0000015	86.90	gold quality
trabecular bone tissue	UBERON:0002483	86.62	gold quality
lower esophagus mucosa	UBERON:0035834	86.39	gold quality
rectum	UBERON:0001052	86.12	gold quality
endometrium epithelium	UBERON:0004811	85.98	gold quality
squamous epithelium	UBERON:0006914	85.86	gold quality
esophagus squamous epithelium	UBERON:0006920	85.55	gold quality
secondary oocyte	CL:0000655	85.16	gold quality
zone of skin	UBERON:0000014	85.09	gold quality
tibia	UBERON:0000979	85.09	gold quality
thymus	UBERON:0002370	84.90	gold quality
cartilage tissue	UBERON:0002418	84.07	gold quality
vermiform appendix	UBERON:0001154	84.06	gold quality

Single-cell (SCXA)

Detected in 6 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-MTAB-11268	yes	421.18
E-CURD-112	yes	39.62
E-CURD-122	yes	22.57
E-MTAB-6678	yes	9.07
E-ANND-3	yes	7.03
E-CURD-88	yes	5.93

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

165 targets.

Target	Regulation
ADAM2
ADAMTS1	Repression
ADRB2	Repression
AKT1
ALDH1A1	Repression
APC	Repression
AR
ASCL1
ASXL3
ATOH1
AXL	Activation
BACH1
BCL2
BCL2L11
BMI1
BRCA1	Unknown
CAMK4
CARM1
CBX2
CCNA2
CCND1	Activation
CCNE1	Activation
CCNE2
CD74
CDH1	Repression
CDH17
CDK4
CDKN1A	Repression
CDKN1B
CDKN1C

Upstream regulators (CollecTRI, top): ARID3B, ASCL1, CREBBP, E2F1, ELK1, EP300, ERG, EWSR1, EZH2, FLI1, FOSL1, JUN, MYC, NFIB, SIRT1, SMAD1, STAT3, TP53, VDR

miRNA regulators (miRDB)

55 targeting EZH2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-144-3P	99.94	73.98	2698
HSA-MIR-450B-5P	99.92	71.48	3175
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-4799-5P	99.82	70.60	2663
HSA-MIR-26A-5P	99.78	73.52	2303
HSA-MIR-26B-5P	99.78	73.51	2305
HSA-MIR-548AJ-5P	99.78	71.12	3085
HSA-MIR-548F-5P	99.78	71.02	3093
HSA-MIR-548G-5P	99.78	71.12	3085
HSA-MIR-548X-5P	99.78	71.12	3085
HSA-MIR-4465	99.71	72.56	2096
HSA-MIR-3714	99.71	70.74	2671
HSA-MIR-518A-5P	99.70	69.01	2209
HSA-MIR-527	99.70	69.01	2209
HSA-MIR-7159-5P	99.53	72.12	2472

Literature-anchored findings (GeneRIF, showing 40)

• is overexpressed in hormone-refractory, metastatic prostate cancer; may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression (PMID:12374981)
• functional role of EZH2 in cancer cell invasion and breast cancer progression (PMID:14500907)
• essential for the proliferation of both transformed and non-transformed human cells (PMID:14532106)
• deregulated expression of EZH2 is associated with loss of differentiation and development of poorly differentiated breast cancer in humans (PMID:14965441)
• Ezh2 competes with HDAC1 in binding to pRb2/p130, disrupting their occupancy on the cyclin A promoter. (PMID:15077161)
• Different EZH2-containing complexes target methylation of histones or nucleosomal histones (PMID:15099518)
• Activated p53 suppresses EZH2 expression, suggesting a further role for p53 in epigenetic regulation and in the maintenance of genetic stability. (PMID:15208672)
• hDAB2IP gene is a target gene of Ezh2 in prostatic epithelium, which provides an underlying mechanism of the down-regulation of hDAB2IP gene in prostate cancer (PMID:15817459)
• The findings of this study indicate that EZH2 mRNA expression was upregulated in human HCC and may play an important role in tumour progression, especially by facilitating portal vein invasion. (PMID:15856046)
• Results show the existence of the cytosolic Ezh2-containing methyltransferase complex and tie the function of this complex to regulation of actin polymerization in various cell types. (PMID:15882624)
• Deregulated expression of EZH2 is associated with bladder carcinoma. (PMID:16215315)
• results imply that Akt regulates the methylation activity, through phosphorylation of EZH2, which may contribute to oncogenesis (PMID:16224021)
• EZH2 is essential for BMI1 recruitment to the polycomb bodies. (PMID:16314526)
• A link between EZH2, a regulator of homeotic gene expression, and recombination DNA repair. (PMID:16331887)
• EZH2 is required for DNA methylation of EZH2-target promoters; results suggest that EZH2 serves as a recruitment platform for DNA methyltransferases (PMID:16357870)
• Increased EZH2 expression correlates with oncogenesis of the bladder. (PMID:16361539)
• Findings indicate an important relationship not only between EZH2 and markers of tumor cell proliferation but also with aggressive disease. (PMID:16489070)
• A fraction of late-stage tumors contains the gene amplification leading to the overexpression of the EZH2 gene, thus indicating the importance of EZH2 in the progression of prostate cancer (PMID:16575874)
• EZH2 is important for the maintenance of circadian rhythms and has a role in the core clockwork mechanism of mammals (PMID:16717091)
• We summarize the current knowledge on the function of EZH2 in cancer, with special focus on breast cancer, and propose a link between EZH2, the homologous recombination pathway of DNA repair, and breast tumorigenesis. (PMID:16855786)
• Advanced cell- & animal imaging, expression profiling, stable siRNA-gene targeting, and TMAs of experimental and clinical samples indicate that activation of the Ezh2 oncogene-associated PcG pathway plays an essential role in metastatic prostate cancer. (PMID:16963837)
• Review. EZH2 is up-regulated in ductal carcinoma in situ, atypical ductal hyperplasia, and even morphologically normal breast epithelial cells from women who have an increased risk of breast cancer. EZH2 may promote neoplastic conversion. (PMID:17018586)
• PcG protein EZH2 is associated with adverse pathological features and clinical PSA recurrence of prostate cancer. (PMID:17134822)
• Our data disclose a hitherto unexplored link between the putative oncogene EZH2 and the tumor suppressor PSP94, and show that MSMB is silenced by EZH2 in advanced prostate cancer cells. (PMID:17237810)
• Ezh2 has a role in aging of the hematopoietic stem cell system [review] (PMID:17332078)
• Study shows that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 complex. (PMID:17344414)
• EZH2 regulates the transcription of estrogen-responsive genes through association with REA, an estrogen receptor corepressor (PMID:17453341)
• These experiments indicated that EZH2 is a dual function transcription regulator with a dynamic activity, and we provide a mechanism for EZH2 in tumorigenesis. (PMID:17502350)
• APAF-1 methylation is related to transcriptional activity of EZH2 expression in early-stage tumor disease of the bladder. (PMID:17541304)
• Expressed target cancer genes with minimal DNA methylation have increased transcription during EZH2 knockdown, densely DNA hypermethylated and silenced genes retain their methylation and remain transcriptionally silent. (PMID:17545586)
• EZH2 plays a key role in hepatocellular carcinoma tumorigenesis, and is a novel therapeutic target. (PMID:17596871)
• EZH2 protein levels increase incrementally from benign nevi to melanoma, which suggests that EZH2 may play a role in the pathogenesis and progression of melanoma (PMID:17640228)
• The comprehensive downstream pathways of EZH2 were determined by proteomic profiling. (PMID:17676662)
• EZH2 expression levels were correlated to pathological tumor features and outcome in patients with urothelial carcinoma of the bladder. (PMID:17694325)
• NIPP1 is present in a complex with EED and EZH2 in vivo and has distinct binding sites for these proteins. (PMID:17804093)
• EZH2 is involved in transcriptional down-regulation of interferon gamma-induced MHC class II transactivator (CIITA) expression in uveal melanoma. (PMID:17911618)
• ADRB2 inhibition confers cell invasion and transforms benign prostate epithelial cells, whereas ADRB2 overexpression counteracts EZH2-mediated oncogenesis (PMID:17996646)
• EZH2 may regulate actin polymerization dynamics and thereby promote prostate cancer cell motility and invasiveness. (PMID:18095286)
• Data show that EZH2 mRNA expression in circulating epithelial cells represents a promising marker for detecting early metastasis in prostate cancer. (PMID:18159594)
• EZH2 expression was associated with decreased survival of patients with basal-like phenotype of breast cancer. (PMID:18269588)

Cross-species orthologs

16 orthologs

Organism	Symbol	Gene ID
danio_rerio	ezh2	ENSDARG00000010571
mus_musculus	Ezh2	ENSMUSG00000029687
rattus_norvegicus	Ezh2	ENSRNOG00000006048
drosophila_melanogaster	Set2	FBGN0030486
drosophila_melanogaster	CG4565	FBGN0037841
drosophila_melanogaster	G9a	FBGN0040372
caenorhabditis_elegans	set-32	WBGENE00008062
caenorhabditis_elegans		WBGENE00008206
caenorhabditis_elegans		WBGENE00008527
caenorhabditis_elegans	met-1	WBGENE00016603
caenorhabditis_elegans		WBGENE00018023
caenorhabditis_elegans		WBGENE00019584
caenorhabditis_elegans		WBGENE00019690
caenorhabditis_elegans		WBGENE00020006
caenorhabditis_elegans		WBGENE00020919
caenorhabditis_elegans		WBGENE00021282

Paralogs (19): KMT2C (ENSG00000055609), SETD1A (ENSG00000099381), SUV39H1 (ENSG00000101945), EZH1 (ENSG00000108799), NSD2 (ENSG00000109685), ASH1L (ENSG00000116539), KMT2A (ENSG00000118058), SETDB2 (ENSG00000136169), SETD1B (ENSG00000139718), SETDB1 (ENSG00000143379), NSD3 (ENSG00000147548), SETBP1 (ENSG00000152217), SUV39H2 (ENSG00000152455), NSD1 (ENSG00000165671), KMT2D (ENSG00000167548), EHMT1 (ENSG00000181090), SETD2 (ENSG00000181555), EHMT2 (ENSG00000204371), KMT2B (ENSG00000272333)

Protein

Protein identifiers

Histone-lysine N-methyltransferase EZH2 — Q15910 (reviewed: Q15910)

Alternative names: ENX-1, Enhancer of zeste homolog 2, Lysine N-methyltransferase 6

All UniProt accessions (7): Q15910, A0A090N8E9, A0A804HJH1, A0A804HLB8, E9PDH6, G3XAL2, S4S3R8

UniProt curated annotations — full annotation on UniProt →

Function. Catalytic subunit of the PRC2/EED-EZH2 complex, a Polycomb group (PcG) complex that methylates ‘Lys-9’ (H3K9me) and ‘Lys-27’ (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate ‘Lys-27’ of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Displays a preference for substrates with less methylation, loses activity when progressively more methyl groups are incorporated into H3K27, H3K27me0 > H3K27me1 > H3K27me2. Compared to EZH1-containing complexes, it is more abundant in embryonic stem cells and plays a major role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. The PRC2/EED-EZH2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems. Genes repressed by the PRC2/EED-EZH2 complex include HOXC8, HOXA9, MYT1, CDKN2A and retinoic acid target genes. EZH2 can also methylate non-histone proteins such as the transcription factor GATA4 and the nuclear receptor RORA. Regulates the circadian clock via histone methylation at the promoter of the circadian genes. Essential for the CRY1/2-mediated repression of the transcriptional activation of PER1/2 by the CLOCK-BMAL1 heterodimer; involved in the di and trimethylation of ‘Lys-27’ of histone H3 on PER1/2 promoters which is necessary for the CRY1/2 proteins to inhibit transcription.

Subunit / interactions. Component of the PRC2/EED-EZH2 complex, which includes EED, EZH2, SUZ12, RBBP4 and RBBP7 and possibly AEBP2. The minimum components required for methyltransferase activity of the PRC2/EED-EZH2 complex are EED, EZH2 and SUZ12. The PRC2 complex may also interact with DNMT1, DNMT3A, DNMT3B and PHF1 via the EZH2 subunit and with SIRT1 via the SUZ12 subunit. Interacts with HDAC1 and HDAC2. Binds ATRX via the SET domain. Interacts with PRAME. Interacts with CDYL. Interacts with CLOCK, BMAL1 and CRY1. Interacts with DNMT3L; the interaction is direct. Interacts with EZHIP; the interaction blocks EZH2 methyltransferase activity. Interacts with ZNF263; recruited to the SIX3 promoter along with other proteins involved in chromatin modification and transcriptional corepression where it contributes to transcriptional repression. Interacts with ARMC12. Interacts with ZMYND8; the interaction is dependent on the presence of chromatin. Interacts with DDX18; this interaction inhibits the PRC2 complex.

Subcellular location. Nucleus.

Tissue specificity. In the ovary, expressed in primordial follicles and oocytes and also in external follicle cells (at protein level). Expressed in many tissues. Overexpressed in numerous tumor types including carcinomas of the breast, colon, larynx, lymphoma and testis.

Post-translational modifications. Phosphorylated by AKT1. Phosphorylation by AKT1 reduces methyltransferase activity. Phosphorylation at Thr-345 by CDK1 and CDK2 promotes maintenance of H3K27me3 levels at EZH2-target loci, thus leading to epigenetic gene silencing. Sumoylated. Glycosylated: O-GlcNAcylation at Ser-75 by OGT increases stability of EZH2 and facilitates the formation of H3K27me3 by the PRC2/EED-EZH2 complex.

Disease relevance. Weaver syndrome (WVS) [MIM:277590] A syndrome of accelerated growth and osseous maturation, unusual craniofacial appearance, hoarse and low-pitched cry, and hypertonia with camptodactyly. Distinguishing features of Weaver syndrome include broad forehead and face, ocular hypertelorism, prominent wide philtrum, micrognathia, deep horizontal chin groove, and deep-set nails. In addition, carpal bone development is advanced over the rest of the hand. The disease is caused by variants affecting the gene represented in this entry.

Induction. Expression is induced by E2F1, E2F2 and E2F3. Expression is reduced in cells subject to numerous types of stress including UV-, IR- and bleomycin-induced DNA damage and by activation of p53/TP53.

Similarity. Belongs to the class V-like SAM-binding methyltransferase superfamily. Histone-lysine methyltransferase family. EZ subfamily.

Isoforms (5)

UniProt ID	Names	Canonical?
Q15910-1	1	yes
Q15910-2	2
Q15910-3	3
Q15910-4	4
Q15910-5	5

RefSeq proteins (5): NP_001190176, NP_001190177, NP_001190178, NP_004447, NP_694543 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001005	SANT/Myb	Domain
IPR001214	SET_dom	Domain
IPR021654	EZH1/EZH2_N	Domain
IPR026489	CXC_dom	Domain
IPR033467	Tesmin/TSO1-like_CXC	Domain
IPR041343	PRC2_HTH_1	Domain
IPR041355	Pre-SET_CXC	Domain
IPR044439	EZH2_SET	Domain
IPR045318	EZH1/2-like	Family
IPR046341	SET_dom_sf	Homologous_superfamily
IPR048358	EZH1/2_MCSS	Domain

Pfam: PF00856, PF11616, PF18118, PF18264, PF21358

Enzyme classification (BRENDA):

• EC 2.1.1.356 — [histone H3]-lysine27 N-trimethyltransferase (BRENDA: 12 organisms, 23 substrates, 3 inhibitors, 14 Km, 13 kcat entries)

Substrate kinetics (BRENDA)

5 substrates with measured Km, best-characterized 5. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
(+/-)-2’,3’-DIBENZYL-S-ADENOSYL-L-METHIONINE	0.072–0.917	3
(+/-)-3’-BENZYL-S-ADENOSYL-L-METHIONINE	0.086–2.8	3
HISTONE H3(K27)	0.2762–3.9	3
S-ADENOSYL-L-METHIONINE	0.06–0.126	3
(+/-)-2’-BENZYL-S-ADENOSYL-L-METHIONINE	0.086–0.128	2

Catalyzed reactions (Rhea), 1 shown:

• L-lysyl(27)-[histone H3] + 3 S-adenosyl-L-methionine = N(6),N(6),N(6)-trimethyl-L-lysyl(27)-[histone H3] + 3 S-adenosyl-L-homocysteine + 3 H(+) (RHEA:60292)

UniProt features (126 total): strand 30, sequence variant 26, helix 24, turn 10, modified residue 8, mutagenesis site 7, region of interest 5, compositionally biased region 4, splice variant 4, sequence conflict 3, domain 2, chain 1, glycosylation site 1, cross-link 1

Structure

Experimental structures (PDB)

38 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
5U5T	X-RAY DIFFRACTION	1.6
7QK4	X-RAY DIFFRACTION	1.6
7QJG	X-RAY DIFFRACTION	1.8
7QJU	X-RAY DIFFRACTION	1.8
5H14	X-RAY DIFFRACTION	1.9
5H19	X-RAY DIFFRACTION	1.9
5U62	X-RAY DIFFRACTION	1.9
4MI0	X-RAY DIFFRACTION	2
4MI5	X-RAY DIFFRACTION	2
5WUK	X-RAY DIFFRACTION	2.03
6LO2	X-RAY DIFFRACTION	2.21
5H15	X-RAY DIFFRACTION	2.27
5H17	X-RAY DIFFRACTION	2.3
5GSA	X-RAY DIFFRACTION	2.49
5H24	X-RAY DIFFRACTION	2.5
5IJ7	X-RAY DIFFRACTION	2.62
5H25	X-RAY DIFFRACTION	2.88
6U4Y	X-RAY DIFFRACTION	2.91
5HYN	X-RAY DIFFRACTION	2.95
5IJ8	X-RAY DIFFRACTION	2.99
8VMI	ELECTRON MICROSCOPY	3.1
8VNV	ELECTRON MICROSCOPY	3.1
9C8U	ELECTRON MICROSCOPY	3.1
6P5L	X-RAY DIFFRACTION	3.3
8FYH	ELECTRON MICROSCOPY	3.4
9DCH	ELECTRON MICROSCOPY	3.4
5LS6	X-RAY DIFFRACTION	3.47
6C24	ELECTRON MICROSCOPY	3.5
6WKR	ELECTRON MICROSCOPY	3.5
8VML	ELECTRON MICROSCOPY	3.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15910-F1	76.58	0.43

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (9): 21, 76, 339, 345, 363, 366, 367, 487, 634

Glycosylation sites (1): 75

Mutagenesis-validated functional residues (7):

Position	Phenotype
21	enhances methyltransferase activity towards ’lys-27’ of histone h3 and abrogates phosphorylation by pkb/akt1.
21	reduces methyltransferase activity towards ’lys-27’ of histone h3 and abrogates phosphorylation by pkb/akt1.
75	reduced protein stability.
345	impaired cdk1- and cdk-2 mediated phosphorylation and subsequent gene silencing. altered ezh2-mediated cell proliferatio
588	strongly impairs methyltransferase activity towards ’lys-27’ of histone h3.
667	strongly decreases histone methyltransferase activity.
689	abrogates methyltransferase activity.

Function

Pathways and Gene Ontology

Reactome pathways

10 pathways

ID	Pathway
R-HSA-212300	PRC2 methylates histones and DNA
R-HSA-2559580	Oxidative Stress Induced Senescence
R-HSA-3214841	PKMTs methylate histone lysines
R-HSA-5617472	Activation of anterior HOX genes in hindbrain development during early embryogenesis
R-HSA-8943724	Regulation of PTEN gene transcription
R-HSA-8953750	Transcriptional Regulation by E2F6
R-HSA-9609690	HCMV Early Events
R-HSA-9710421	Defective pyroptosis
R-HSA-9764725	Negative Regulation of CDH1 Gene Transcription
R-HSA-9909649	Regulation of PD-L1(CD274) transcription

MSigDB gene sets: 1123 (showing top): GSE37336_LY6C_POS_VS_NEG_NAIVE_CD4_TCELL_UP, GOBP_CIRCADIAN_RHYTHM, E2F_Q4, GOBP_HINDBRAIN_DEVELOPMENT, MODULE_52, E2F_Q4_01, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_HEPATICOBILIARY_SYSTEM_DEVELOPMENT, GOBP_EPITHELIUM_DEVELOPMENT, FREAC2_01, GOBP_METENCEPHALON_DEVELOPMENT, GOBP_SKELETAL_MUSCLE_TISSUE_REGENERATION, HOFFMANN_SMALL_PRE_BII_TO_IMMATURE_B_LYMPHOCYTE_DN, E2F4DP1_01, GOBP_REGULATION_OF_PHOSPHORYLATION

GO Biological Process (56): G1/S transition of mitotic cell cycle (GO:0000082), negative regulation of transcription by RNA polymerase II (GO:0000122), chromatin organization (GO:0006325), DNA methylation-dependent constitutive heterochromatin formation (GO:0006346), regulation of DNA-templated transcription (GO:0006355), positive regulation of cell population proliferation (GO:0008284), positive regulation of epithelial to mesenchymal transition (GO:0010718), regulation of gliogenesis (GO:0014013), skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834), cardiac muscle hypertrophy in response to stress (GO:0014898), cerebellar cortex development (GO:0021695), hippocampus development (GO:0021766), B cell differentiation (GO:0030183), keratinocyte differentiation (GO:0030216), positive regulation of cell migration (GO:0030335), regulatory ncRNA-mediated heterochromatin formation (GO:0031048), heterochromatin formation (GO:0031507), subtelomeric heterochromatin formation (GO:0031509), methylation (GO:0032259), response to estradiol (GO:0032355), negative regulation of transcription elongation by RNA polymerase II (GO:0034244), cellular response to trichostatin A (GO:0035984), hepatocyte homeostasis (GO:0036333), regulation of circadian rhythm (GO:0042752), positive regulation of MAP kinase activity (GO:0043406), positive regulation of GTPase activity (GO:0043547), negative regulation of keratinocyte differentiation (GO:0045617), negative regulation of gene expression, epigenetic (GO:0045814), negative regulation of DNA-templated transcription (GO:0045892), negative regulation of retinoic acid receptor signaling pathway (GO:0048387), rhythmic process (GO:0048511), stem cell differentiation (GO:0048863), negative regulation of striated muscle cell differentiation (GO:0051154), synaptic transmission, GABAergic (GO:0051932), cellular response to hydrogen peroxide (GO:0070301), G1 to G0 transition (GO:0070314), protein localization to chromatin (GO:0071168), positive regulation of protein serine/threonine kinase activity (GO:0071902), regulation of kidney development (GO:0090183), liver regeneration (GO:0097421)

GO Molecular Function (24): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979), transcription corepressor binding (GO:0001222), chromatin binding (GO:0003682), transcription corepressor activity (GO:0003714), RNA binding (GO:0003723), protein-lysine N-methyltransferase activity (GO:0016279), chromatin DNA binding (GO:0031490), nucleosome binding (GO:0031491), histone methyltransferase activity (GO:0042054), histone binding (GO:0042393), ribonucleoprotein complex binding (GO:0043021), histone H3K27 methyltransferase activity (GO:0046976), primary miRNA binding (GO:0070878), lncRNA binding (GO:0106222), histone H3 methyltransferase activity (GO:0140938), histone H3K27 trimethyltransferase activity (GO:0140951), promoter-specific chromatin binding (GO:1990841), transcription cis-regulatory region binding (GO:0000976), DNA binding (GO:0003677), protein binding (GO:0005515), methyltransferase activity (GO:0008168), transferase activity (GO:0016740), sequence-specific DNA binding (GO:0043565)

GO Cellular Component (11): chromosome, telomeric region (GO:0000781), chromatin (GO:0000785), heterochromatin (GO:0000792), nucleus (GO:0005634), nucleoplasm (GO:0005654), chromatin silencing complex (GO:0005677), chromosome (GO:0005694), pericentric heterochromatin (GO:0005721), ESC/E(Z) complex (GO:0035098), pronucleus (GO:0045120), synapse (GO:0045202)

Reactome top-level categories

Rollup of top-10 pathways:

Category	Pathways
Epigenetic regulation of gene expression	1
Cellular Senescence	1
Chromatin modifying enzymes	1
Activation of HOX genes during differentiation	1
PTEN Regulation	1
Generic Transcription Pathway	1
HCMV Infection	1
Diseases of programmed cell death	1
Regulation of CDH1 Gene Transcription	1
Regulation of PD-L1(CD274) expression	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
chromatin binding	3
negative regulation of DNA-templated transcription	2
constitutive heterochromatin formation	2
anatomical structure development	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
nucleic acid binding	2
protein methyltransferase activity	2
protein-containing complex binding	2
RNA binding	2
cellular anatomical structure	2
mitotic cell cycle	1
mitotic cell cycle phase transition	1
cell cycle G1/S phase transition	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
cellular component organization	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
epithelial to mesenchymal transition	1
regulation of epithelial to mesenchymal transition	1
positive regulation of cell differentiation	1
positive regulation of multicellular organismal process	1
gliogenesis	1
regulation of neurogenesis	1
skeletal muscle tissue regeneration	1
maintenance of cell number	1
muscle hypertrophy in response to stress	1
cardiac muscle hypertrophy	1
cardiac muscle adaptation	1
cerebellum development	1
pallium development	1
limbic system development	1
lymphocyte differentiation	1
B cell activation	1
epidermal cell differentiation	1
skin development	1

Protein interactions and networks

STRING

7058 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
EZH2	SUZ12	Q15022	999
EZH2	EED	O75530	999
EZH2	DNMT3A	Q9Y6K1	998
EZH2	DNMT1	P26358	998
EZH2	DNMT3B	Q9UBC3	997
EZH2	HDAC1	Q13547	996
EZH2	RBBP4	P31149	995
EZH2	RBBP7	Q16576	995
EZH2	AEBP2	Q6ZN18	995
EZH2	JARID2	Q92833	995
EZH2	YY1	P25490	994
EZH2	KDM1A	O60341	994
EZH2	SNAI1	O95863	992
EZH2	HDAC2	Q92769	986
EZH2	BMI1	P35226	985
EZH2	R4GMX3	R4GMX3	985

IntAct

354 interactions, top by confidence:

A	B	Type	Score
EZH2	SUZ12	psi-mi:“MI:0914”(association)	0.960
SUZ12	EZH2	psi-mi:“MI:0914”(association)	0.960
EZH2	SUZ12	psi-mi:“MI:0915”(physical association)	0.960
SUZ12	EZH2	psi-mi:“MI:2364”(proximity)	0.960
EZH2	EED	psi-mi:“MI:0915”(physical association)	0.930
EZH2	EED	psi-mi:“MI:0914”(association)	0.930
EED	EZH2	psi-mi:“MI:0915”(physical association)	0.930
SUZ12	EED	psi-mi:“MI:0914”(association)	0.910
PHF1	EZH2	psi-mi:“MI:0915”(physical association)	0.900
EZH2	PHF1	psi-mi:“MI:0914”(association)	0.900
RBBP7	CDK2AP1	psi-mi:“MI:0914”(association)	0.840
EZH2	DNMT3B	psi-mi:“MI:0915”(physical association)	0.830
PHF1	EED	psi-mi:“MI:0914”(association)	0.790
RBBP4	CDK2AP1	psi-mi:“MI:0914”(association)	0.790
EZH2	EPOP	psi-mi:“MI:0914”(association)	0.730
DNMT1	EZH2	psi-mi:“MI:0914”(association)	0.690
CEP63	EZH2	psi-mi:“MI:0915”(physical association)	0.670

BioGRID (2234): EZH2 (Affinity Capture-MS), CEP63 (Two-hybrid), EZH2 (Affinity Capture-MS), EZH2 (Affinity Capture-MS), EZH2 (Affinity Capture-Western), JARID2 (Affinity Capture-Western), SUZ12 (Affinity Capture-Western), EZH2 (Affinity Capture-Western), EED (Affinity Capture-Western), VCP (Affinity Capture-MS), SUZ12 (Affinity Capture-MS), EED (Affinity Capture-MS), NPLOC4 (Affinity Capture-MS), CPSF6 (Affinity Capture-MS), KIF5B (Affinity Capture-MS)

ESM2 similar proteins: A0A0G2JZ79, A1ZA92, A6QQR4, A7E2Z2, A8JQ65, A8WRG3, B3NYS4, B4K6T8, B4R0A5, B6VQ60, F4JZ68, O75164, O94640, P06700, P33294, P42124, P50526, P70351, Q04688, Q08BS4, Q14149, Q15910, Q21921, Q28D84, Q28Z18, Q2NKX8, Q4R381, Q4V863, Q5RD88, Q5RDS6, Q5RDX4, Q60L58, Q61188, Q61IS6, Q640I9, Q6DTM3, Q6PL18, Q757M7, Q8CDM1, Q8K3E5

Diamond homologs: A0A1L7TZE5, A4IGY9, A7E2Z2, A8XI75, J9VWH9, O43463, O54864, O60016, O65312, O82175, O88491, O88974, O96028, P20659, P42124, P45975, P46995, P55200, P70351, P93831, Q03164, Q06ZW3, Q08BR4, Q08BS4, Q0VD24, Q15047, Q15910, Q24742, Q28CQ7, Q28D84, Q294B9, Q2NL30, Q32PH7, Q4PB36, Q4R381, Q4R3E0, Q4V863, Q53H47, Q5DW34, Q5F3W5

SIGNOR signaling

34 interactions.

A	Effect	B	Mechanism
AKT1	“down-regulates activity”	EZH2	phosphorylation
EZH2	“form complex”	SUZ12/EZH2	binding
CDK1	down-regulates	EZH2	phosphorylation
MAPK14	“up-regulates activity”	EZH2	phosphorylation
JAK2	down-regulates	EZH2	phosphorylation
BTRC	down-regulates	EZH2	ubiquitination
NFIB	“down-regulates quantity by repression”	EZH2	“transcriptional regulation”
EZH2	“form complex”	“Polycomb repressive complex 2”	binding
AKT	“down-regulates activity”	EZH2	phosphorylation
EZH2	“up-regulates activity”	AR	binding
ERG	“up-regulates quantity by expression”	EZH2	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	ALDH1A1	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	DACT3	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	SSTR1	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	HOXB13	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	SNAI2	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	TWIST1	“transcriptional regulation”
CDK2	“up-regulates activity”	EZH2	phosphorylation
PPP1R8	“up-regulates activity”	EZH2	binding
EZH2	“down-regulates quantity by repression”	HOXA9	“transcriptional regulation”
EZH2	“down-regulates quantity by repression”	HOXA10	“transcriptional regulation”
ZDHHC5	“down-regulates activity”	EZH2	palmitoylation
MELK	“up-regulates quantity by stabilization”	EZH2	phosphorylation
USP36	“up-regulates quantity by stabilization”	EZH2	deubiquitination
GSK3B	“down-regulates activity”	EZH2	phosphorylation
JAK3	“up-regulates activity”	EZH2	phosphorylation
CDK20	“up-regulates activity”	EZH2	phosphorylation
ATM	“down-regulates quantity”	EZH2	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 84 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Regulation of TP53 Activity through Acetylation	6	43.5×	4e-07
PRC2 methylates histones and DNA	15	36.2×	2e-17
Transcriptional regulation of brown and beige adipocyte differentiation by EBF2	5	30.2×	2e-05
Deactivation of the beta-catenin transactivating complex	7	25.9×	8e-07
Transcriptional Regulation by E2F6	5	23.2×	8e-05
Negative Regulation of CDH1 Gene Transcription	12	22.9×	3e-11
Regulation of PTEN gene transcription	8	22.7×	3e-07
Defective pyroptosis	9	22.4×	4e-08

GO biological processes:

GO term	Partners	Fold	FDR
regulation of stem cell differentiation	5	50.4×	4e-06
heterochromatin formation	11	37.0×	4e-12
DNA methylation-dependent constitutive heterochromatin formation	5	35.8×	2e-05
negative regulation of gene expression, epigenetic	6	31.7×	4e-06
stem cell differentiation	6	23.8×	2e-05
regulation of circadian rhythm	6	20.5×	3e-05
protein destabilization	5	19.1×	3e-04
circadian regulation of gene expression	5	15.4×	9e-04

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: activating (oncogene-like) across 6 cancer types — ALL, AML, DLBCLNOS, ES, MLYM, NHL.

Clinical variants and AI predictions

ClinVar

732 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	10
Likely pathogenic	26
Uncertain significance	250
Likely benign	314
Benign	59

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
158579	NM_004456.5(EZH2):c.1876G>A (p.Val626Met)	Pathogenic
158582	NM_004456.5(EZH2):c.2050C>T (p.Arg684Cys)	Pathogenic
1699242	NM_004456.5(EZH2):c.2185T>C (p.Phe729Leu)	Pathogenic
1700627	NM_004456.5(EZH2):c.2199C>G (p.Tyr733Ter)	Pathogenic
1700628	NM_004456.5(EZH2):c.2204_2211dup (p.Ala738fs)	Pathogenic
30198	NM_004456.5(EZH2):c.457_459del (p.Tyr153del)	Pathogenic
30199	NM_004456.5(EZH2):c.2080C>T (p.His694Tyr)	Pathogenic
30200	NM_004456.5(EZH2):c.394C>T (p.Pro132Ser)	Pathogenic
833114	NC_000007.14:g.(?146116001)(148847318_?)del	Pathogenic
975993	NM_004456.5(EZH2):c.2235A>T (p.Glu745Asp)	Pathogenic
1064801	NM_004456.5(EZH2):c.457T>C (p.Tyr153His)	Likely pathogenic
1285414	NM_004456.5(EZH2):c.472C>T (p.His158Tyr)	Likely pathogenic
158584	NM_004456.5(EZH2):c.2236A>G (p.Arg746Gly)	Likely pathogenic
2442387	NM_004456.5(EZH2):c.1882G>A (p.Gly628Ser)	Likely pathogenic
2578510	NM_004456.5(EZH2):c.1891del (p.Ile631fs)	Likely pathogenic
2636412	NM_004456.5(EZH2):c.835C>T (p.His279Tyr)	Likely pathogenic
265527	NM_004456.5(EZH2):c.2007C>G (p.Ser669Arg)	Likely pathogenic
2663828	NM_004456.5(EZH2):c.2015T>G (p.Phe672Cys)	Likely pathogenic
3027053	NM_004456.5(EZH2):c.394C>A (p.Pro132Thr)	Likely pathogenic
3075661	NM_004456.5(EZH2):c.2035G>C (p.Val679Leu)	Likely pathogenic
3377158	NM_004456.5(EZH2):c.1969G>A (p.Asp657Asn)	Likely pathogenic
3393823	NM_004456.5(EZH2):c.434T>G (p.Phe145Cys)	Likely pathogenic
411683	NM_004456.5(EZH2):c.1990G>T (p.Asp664Tyr)	Likely pathogenic
421581	NM_004456.5(EZH2):c.2221T>C (p.Tyr741His)	Likely pathogenic
423764	NM_004456.5(EZH2):c.550G>C (p.Asp184His)	Likely pathogenic
430846	NM_004456.5(EZH2):c.2213C>A (p.Ala738Asp)	Likely pathogenic
431817	NM_004456.5(EZH2):c.2191T>C (p.Tyr731His)	Likely pathogenic
432410	NM_004456.5(EZH2):c.1730C>T (p.Pro577Leu)	Likely pathogenic
521486	NM_004456.5(EZH2):c.406G>C (p.Asp136His)	Likely pathogenic
577229	NM_004456.5(EZH2):c.2218_2220dup (p.Lys740dup)	Likely pathogenic

SpliceAI

3831 predictions. Top by Δscore:

Variant	Effect	Δscore
7:148809067:CAA:C	donor_loss	1.0000
7:148809069:ACCT:A	donor_loss	1.0000
7:148809070:CCTGT:C	donor_loss	1.0000
7:148809151:CATAA:C	acceptor_gain	1.0000
7:148809152:ATAA:A	acceptor_gain	1.0000
7:148809153:TAA:T	acceptor_gain	1.0000
7:148809156:C:CC	acceptor_gain	1.0000
7:148809386:AAAAT:A	acceptor_gain	1.0000
7:148809387:AAAT:A	acceptor_gain	1.0000
7:148809388:AAT:A	acceptor_gain	1.0000
7:148809389:AT:A	acceptor_gain	1.0000
7:148809390:TCT:T	acceptor_loss	1.0000
7:148809391:C:CA	acceptor_loss	1.0000
7:148809391:C:CC	acceptor_gain	1.0000
7:148810411:TAAT:T	acceptor_gain	1.0000
7:148810412:AATC:A	acceptor_loss	1.0000
7:148810415:C:CC	acceptor_gain	1.0000
7:148810415:C:T	acceptor_loss	1.0000
7:148810416:T:A	acceptor_loss	1.0000
7:148811620:CTTAC:C	donor_loss	1.0000
7:148811621:TTACC:T	donor_loss	1.0000
7:148811622:TA:T	donor_loss	1.0000
7:148811623:A:AC	donor_gain	1.0000
7:148811623:A:AT	donor_loss	1.0000
7:148811624:C:CC	donor_gain	1.0000
7:148811624:CCT:C	donor_gain	1.0000
7:148811624:CCTCT:C	donor_gain	1.0000
7:148811716:AGATG:A	acceptor_gain	1.0000
7:148811717:GATG:G	acceptor_gain	1.0000
7:148811718:ATG:A	acceptor_gain	1.0000

AlphaMissense

5025 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:148807675:C:G	G738R	1.000
7:148807677:A:T	V737D	1.000
7:148807686:A:G	L734P	1.000
7:148807689:G:T	A733D	1.000
7:148807705:A:G	Y728H	1.000
7:148809071:C:A	R727I	1.000
7:148809071:C:G	R727T	1.000
7:148809074:T:C	Y726C	1.000
7:148809075:A:C	Y726D	1.000
7:148809075:A:G	Y726H	1.000
7:148809076:A:C	D725E	1.000
7:148809076:A:T	D725E	1.000
7:148809077:T:A	D725V	1.000
7:148809077:T:C	D725G	1.000
7:148809077:T:G	D725A	1.000
7:148809078:C:A	D725Y	1.000
7:148809078:C:G	D725H	1.000
7:148809079:A:C	F724L	1.000
7:148809079:A:T	F724L	1.000
7:148809080:A:C	F724C	1.000
7:148809080:A:G	F724S	1.000
7:148809081:A:G	F724L	1.000
7:148809081:A:T	F724I	1.000
7:148809082:A:C	F723L	1.000
7:148809082:A:T	F723L	1.000
7:148809084:A:G	F723L	1.000
7:148809084:A:T	F723I	1.000
7:148809086:A:C	L722R	1.000
7:148809086:A:G	L722P	1.000
7:148809086:A:T	L722Q	1.000

dbSNP variants (sampled 300 via entrez): RS1000026683 (7:148814723 C>T), RS1000030234 (7:148838422 C>T), RS1000083879 (7:148849359 A>AG), RS1000085819 (7:148882010 T>A), RS1000091287 (7:148877895 C>G), RS1000139875 (7:148843815 T>C), RS1000154091 (7:148849889 G>A), RS1000173741 (7:148869984 G>A), RS1000208299 (7:148849660 T>A), RS1000287562 (7:148876598 C>A), RS1000299182 (7:148809753 T>A), RS1000303322 (7:148884192 TCCCGCGCGTCGCC>T,TCCCGCGCGTCGCCCCCGCGCGTCGCC), RS1000375273 (7:148816305 C>T), RS1000435439 (7:148838161 T>A), RS1000446386 (7:148843948 T>C)

Disease associations

OMIM: gene MIM:601573 | disease phenotypes: MIM:277590, MIM:610042

GenCC curated gene-disease

Disease	Classification	Inheritance
Weaver syndrome	Definitive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
Weaver syndrome	Definitive	AD

Mondo (6): Weaver syndrome (MONDO:0010193), neurodevelopmental disorder (MONDO:0700092), cortical dysplasia-focal epilepsy syndrome (MONDO:0012400), hereditary neoplastic syndrome (MONDO:0015356), childhood neoplasm (MONDO:0021079), intellectual disability (MONDO:0001071)

Orphanet (5): Weaver syndrome (Orphanet:3447), CNTNAP2-related developmental and epileptic encephalopathy (Orphanet:163681), OBSOLETE: Pitt-Hopkins-like syndrome (Orphanet:221150), Inherited cancer-predisposing syndrome (Orphanet:140162), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

99 total (30 of 99 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000023	Inguinal hernia
HP:0000028	Cryptorchidism
HP:0000034	Hydrocele testis
HP:0000098	Tall stature
HP:0000256	Macrocephaly
HP:0000278	Retrognathia
HP:0000286	Epicanthus
HP:0000303	Mandibular prognathia
HP:0000311	Round face
HP:0000316	Hypertelorism
HP:0000337	Broad forehead
HP:0000343	Long philtrum
HP:0000347	Micrognathia
HP:0000358	Posteriorly rotated ears
HP:0000400	Macrotia
HP:0000486	Strabismus
HP:0000494	Downslanted palpebral fissures
HP:0000708	Atypical behavior
HP:0000750	Delayed speech and language development
HP:0000773	Short ribs
HP:0000944	Abnormal metaphysis morphology
HP:0000954	Single transverse palmar crease
HP:0000973	Cutis laxa
HP:0000995	Melanocytic nevus
HP:0001176	Large hands
HP:0001212	Prominent fingertip pads
HP:0001231	Abnormal fingernail morphology
HP:0001249	Intellectual disability
HP:0001250	Seizure

GWAS associations

14 associations (top):

Study	Trait	p-value
GCST002647_71	Height	2.000000e-18
GCST003209_10	Colorectal or endometrial cancer	1.000000e-06
GCST004063_15	Waist circumference adjusted for body mass index	2.000000e-06
GCST004063_40	Waist circumference adjusted for body mass index	4.000000e-08
GCST004131_11	Inflammatory bowel disease	3.000000e-10
GCST004132_80	Crohn’s disease	6.000000e-07
GCST004500_139	Waist circumference adjusted for BMI (adjusted for smoking behaviour)	5.000000e-07
GCST004501_39	Waist circumference adjusted for BMI (joint analysis main effects and smoking interaction)	2.000000e-06
GCST004504_43	Waist circumference adjusted for BMI in non-smokers	1.000000e-06
GCST006088_9	Familial squamous cell lung carcinoma	2.000000e-06
GCST007576_326	Chronotype	4.000000e-08
GCST008839_570	Height	3.000000e-15
GCST90002396_359	Mean reticulocyte volume	4.000000e-09
GCST90002397_315	Mean spheric corpuscular volume	1.000000e-09

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0004230	endometrial neoplasm
EFO:0007789	BMI-adjusted waist circumference
EFO:0004318	smoking behavior
EFO:0006953	family history of lung cancer
EFO:0008328	chronotype measurement
EFO:0010701	mean reticulocyte volume

MeSH disease descriptors (5)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
D065886	Neurodevelopmental Disorders	F03.625
C567657	Cortical Dysplasia-Focal Epilepsy Syndrome (supp.)
C536687	Weaver syndrome (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (8): CHEMBL2189110 (SINGLE PROTEIN), CHEMBL3137286 (PROTEIN COMPLEX), CHEMBL3301388 (PROTEIN COMPLEX), CHEMBL5169073 (PROTEIN-PROTEIN INTERACTION), CHEMBL5169086 (PROTEIN-PROTEIN INTERACTION), CHEMBL6066550 (PROTEIN COMPLEX), CHEMBL6066587 (PROTEIN COMPLEX), CHEMBL6195579 (PROTEIN-PROTEIN INTERACTION)

Molecules with ChEMBL bioactivity

6 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 4,807 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL3414621	TAZEMETOSTAT	4	1,869
CHEMBL4080228	MEVROMETOSTAT	2	443
CHEMBL4597193	VALEMETOSTAT	2	193
CHEMBL5939817	ZEPRUMETOSTAT	2	34
CHEMBL3287735	GSK2816126	1	1,396
CHEMBL4297463	CPI-1205	1	872

Clinical evidence (CIViC)

Drug × variant × indication: 18 predictive associations from 20 curated evidence items; also 15 functional, 7 prognostic, 7 oncogenic, 2 diagnostic.

Variant	Therapy	Indication	Effect	Level	CIViC
EZH2 Activating Mutation	Tazemetostat	Follicular Lymphoma	Sensitivity/Response	CIViC A	EID9709 +1
EZH2 Y646S OR EZH2 Y646F OR EZH2 Y646H OR EZH2 Y646C OR EZH2 Y646N OR EZH2 A692V OR EZH2 A682G	Tazemetostat	B-cell Non-Hodgkin Lymphoma	Sensitivity/Response	CIViC A	EID11220
EZH2 Y646N	Tazemetostat + Atezolizumab	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC B	EID11112
EZH2 Y646S OR EZH2 Y646F OR EZH2 Y646H OR EZH2 Y646C OR EZH2 Y646N OR EZH2 A692V OR EZH2 A682G	Tazemetostat	Follicular Lymphoma	Sensitivity/Response	CIViC B	EID11109
EZH2 Y646S OR EZH2 Y646F OR EZH2 Y646H OR EZH2 Y646C OR EZH2 Y646N OR EZH2 A692V OR EZH2 A682G	Tazemetostat	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC B	EID11110
EZH2 Y646H	Tazemetostat	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC C	EID9377
EZH2 expression	Tazemetostat	Diffuse Large B-cell Lymphoma Germinal Center B-cell Type	Sensitivity/Response	CIViC C	EID11108
EZH2 Y646F	Tazemetostat	Non-Hodgkin Lymphoma	Sensitivity/Response	CIViC D	EID11000 +1
BRAF V600E AND EZH2 Y646F	JQEZ5	Melanoma	Sensitivity/Response	CIViC D	EID6952
EZH2 A682G	Tazemetostat	Follicular Lymphoma	Sensitivity/Response	CIViC D	EID12877
EZH2 Overexpression	Tazemetostat + GSK126	Neuroblastoma	Sensitivity/Response	CIViC D	EID9115
EZH2 Y646	GSK126	Skin Melanoma	Sensitivity/Response	CIViC D	EID1494
EZH2 Y646F	Tazemetostat	B-cell Lymphoma	Sensitivity/Response	CIViC D	EID10999
EZH2 Y646F	EPZ011989	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC D	EID11025
EZH2 Y646F	JQEZ5	B-cell Lymphoma	Sensitivity/Response	CIViC D	EID11083
EZH2 Y646F	GSK126	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC D	EID11106
EZH2 Y646N	Tazemetostat	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC D	EID11049
EZH2 Y646N	GSK126	Diffuse Large B-cell Lymphoma	Sensitivity/Response	CIViC D	EID11105

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — 2.1.1.43 Histone methyltransferases (HMTs)

Most potent curated ligand interactions (16 total), top 16:

Ligand	Action	Affinity	Parameter
tulmimetostat	Inhibition	10.7	pIC50
mevrometostat	Inhibition	10.0	pKi
SKLB-03220	Inhibition	8.76	pIC50
UNC1999	Inhibition	8.7	pIC50
CPI-1205	Inhibition	8.7	pIC50
EPZ011989	Inhibition	8.52	pKi
GSK343	Inhibition	8.4	pIC50
valemetostat	Inhibition	8.29	pIC50
zeprumetostat	Inhibition	8.24	pIC50
EBI-2511	Inhibition	8.1	pIC50
EI1	Inhibition	8.03	pIC50
GSK126	Inhibition	8.0	pIC50
tazemetostat	Inhibition	7.96	pIC50
JQEZ5	Inhibition	7.96	pIC50
EPZ005687	Inhibition	7.62	pKi
compound 15a [PMID: 36642961]	Inhibition	6.6	pIC50

Binding affinities (BindingDB)

1313 measured of 1605 human assays (1605 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
5,8-dichloro-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[1-(1-methylazetidin-3-yl)ethyl]-3,4-dihydroisoquinolin-1-one	KI	0.01 nM	US-10570121: Substituted dihydroisoquinolinone compounds
7-chloro-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-2-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]-1,3-benzodioxole-5-carboxamide	IC50	0.037 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
(2R)-7-chloro-2-[4-(dimethylamino)cyclohexyl]-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.038 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
7-chloro-N-((4-chloro-6-methyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-2-(4-(3-cyclopropoxyazetidin-1-yl)cyclohexyl)-2,4-dimethylbenzo[d][1,3]dioxole-5-carboxamide	IC50	0.039 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
7-chloro-2-(4-(3-methoxyazetidin-1-yl)cyclohexyl)-2,4-dimethyl-N-((6-methyl-4-(methylthio)-2-oxo-1,2-dihydropyridin-3-yl)methyl)benzo[d][1,3]dioxole-5-carboxamide	IC50	0.043 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
(2R)-7-chloro-2-[4-(dimethylamino)cyclohexyl]-2,4-dimethyl-N-[(2-methyl-4-methylsulfanyl-6-oxo-1,3-diazinan-5-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.054 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
7-chloro-2-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.054 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
CHEMBL5188476	IC50	0.057 nM
7-chloro-N-[(4-chloro-6-methyl-2-oxopiperidin-3-yl)methyl]-2-[4-[3-(difluoromethoxy)azetidin-1-yl]cyclohexyl]-2,4-dimethyl-1,3-benzodioxole-5-carboxamide	IC50	0.084 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
7-chloro-2-[4-[3-(difluoromethoxy)azetidin-1-yl]cyclohexyl]-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.091 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
7-chloro-2-[4-(3-fluoroazetidin-1-yl)cyclohexyl]-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.092 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
4-[[5,8-dichloro-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-1-oxo-3,4-dihydroisoquinolin-7-yl]-methoxymethyl]piperidine-1-carbaldehyde	KI	0.1 nM	US-10570121: Substituted dihydroisoquinolinone compounds
5-bromo-8-chloro-2-[(4,6-dimethyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[methoxy-(1-methylpiperidin-4-yl)methyl]-3,4-dihydroisoquinolin-1-one	KI	0.1 nM	US-10570121: Substituted dihydroisoquinolinone compounds
5,8-dichloro-7-[1-[1-(2-hydroxyacetyl)piperidin-4-yl]ethyl]-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	KI	0.1 nM	US-10570121: Substituted dihydroisoquinolinone compounds
7-chloro-2-[4-[[3-(fluoromethyl)oxetan-3-yl]amino]cyclohexyl]-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.14 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
8-chloro-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[methoxy(oxolan-3-yl)methyl]-5-methyl-3,4-dihydroisoquinolin-1-one	KI	0.2 nM	US-10570121: Substituted dihydroisoquinolinone compounds
8-chloro-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[methoxy(oxetan-3-yl)methyl]-5-methyl-3,4-dihydroisoquinolin-1-one	KI	0.2 nM	US-10570121: Substituted dihydroisoquinolinone compounds
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[methoxy(piperidin-4-yl)methyl]-3,4-dihydroisoquinolin-1-one	KI	0.2 nM	US-10570121: Substituted dihydroisoquinolinone compounds
7-chloro-2-[4-[3-(difluoromethoxy)azetidin-1-yl]cyclohexyl]-2,4-dimethyl-N-[(2-methyl-4-methylsulfanyl-6-oxo-1,3-diazinan-5-yl)methyl]-1,3-benzodioxole-5-carboxamide	IC50	0.202 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[methoxy-(1-methylsulfonylazetidin-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	KI	0.3 nM	US-10570121: Substituted dihydroisoquinolinone compounds
8-chloro-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-5-methyl-7-[1-(1-methylsulfonylazetidin-3-yl)ethyl]-3,4-dihydroisoquinolin-1-one	KI	0.3 nM	US-10570121: Substituted dihydroisoquinolinone compounds
7-chloro-N-[(4-chloro-6-methyl-2-oxopiperidin-3-yl)methyl]-2,4-dimethyl-2-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]-1,3-benzodioxole-5-carboxamide	IC50	0.31 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
N-((4,6-dimethyl-2-carbonyl-1,2-dihydropyridin-3-yl)methyl)-3-(ethyl(tetrahydro-2H-pyran-4-yl)amino)-5-(1-isopropyl-2’,3’,5’,6’-tetrahydrospiro[dihydroindole-3,4’-pyran]-6-yl)-2-methylbenzamide	IC50	0.33 nM	US-12473298: Amide compounds, preparation method therefor, and use thereof in the medical field
3-(ethyl(tetrahydro-2H-pyran-4-yl)amino)-5-(6-fluoro-2’,3’,5’,6’-tetrahydrospiro[indene-1,4’-pyran]-5-yl)-N-((4-methoxy-6-methyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-2-methylbenzamide	IC50	0.35 nM	US-12473298: Amide compounds, preparation method therefor, and use thereof in the medical field
(2R)-7-chloro-N-[(6-chloro-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-2-[4-(dimethylamino)cyclohexyl]-2,4-dimethyl-1,3-benzodioxole-5-carboxamide	IC50	0.37 nM	US-11274095: Modulators of methyl modifying enzymes, compositions and uses thereof
8-chloro-2-[(4-methoxy-6-methyl-2-oxo-3H-pyridin-3-yl)methyl]-7-[(R)-methoxy-[(3R)-oxolan-3-yl]methyl]-5-methyl-3,4-dihydroisoquinolin-1-one	KI	0.4 nM	US-10570121: Substituted dihydroisoquinolinone compounds
N-((4,6-dimethyl-2-carbonyl-1,2-dihydropyridin-3-yl)methyl)-3-(ethyl(tetrahydro-2H-pyran-4-yl)amino)-2-methyl-5-(2-carbonyl-1-propyl-2’,3’,5’,6’-tetrahydrospiro[dihydroindole-3,4’-pyran]-6-yl)benzamide	IC50	0.4 nM	US-12473298: Amide compounds, preparation method therefor, and use thereof in the medical field
N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-3-[ethyl(oxan-4-yl)amino]-2-methyl-5-(2-oxospiro[1H-indole-3,4’-oxane]-6-yl)benzamide	IC50	0.45 nM	US-12473298: Amide compounds, preparation method therefor, and use thereof in the medical field
N-((4,6-dimethyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-3-(ethyl(tetrahydro-2H-pyran-4-yl)amino)-2-methyl-5-(1’-methylsulfonyl-2-oxospiro[dihydroindole-3,4’-piperidine]-6-yl)benzamide	IC50	0.46 nM	US-12473298: Amide compounds, preparation method therefor, and use thereof in the medical field
N-((4,6-Dimethyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-3-(ethyl(2,6-dimethyltetrahydro-2H-pyran-4-yl)amino)-2-methyl-5-(2-oxo-2’,3’,5’,6’-tetrahydrospiro[dihydroindole-3,4’-pyran]-6-yl)benzamide	IC50	0.46 nM	US-12473298: Amide compounds, preparation method therefor, and use thereof in the medical field
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
N-[(4-cyclobutylsulfanyl-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
1-[(1R)-1-[1-(2-hydroxy-2-methylpropyl)piperidin-4-yl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1-[(1R)-1-[1-(oxetan-3-yl)piperidin-4-yl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-3H-pyridin-3-yl)methyl]-1-[(1R)-1-[4-[(3-methyloxetan-3-yl)amino]cyclohexyl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1-[(1R)-1-[4-(oxetan-3-ylamino)cyclohexyl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-1-[(1R)-1-[4-[methyl-(3-methyloxetan-3-yl)amino]cyclohexyl]ethyl]-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
1-[(1R)-1-[4-(3-methoxyazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-3H-pyridin-3-yl)methyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
1-[(1R)-1-[5-(tert-butylamino)-1,3-dioxan-2-yl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-3H-pyridin-3-yl)methyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1-[(1R)-1-[5-[(3-methyloxetan-3-yl)amino]-1,3-dioxan-2-yl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
1-[(1R)-1-[5-(dimethylamino)-1,3-dioxan-2-yl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1-[(1R)-1-[3-(oxetan-3-ylamino)-1-bicyclo[1.1.1]pentanyl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1-[(1R)-1-[3-[methyl(oxetan-3-yl)amino]-1-bicyclo[1.1.1]pentanyl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1-[(1R)-1-[3-[methyl(2,2,2-trifluoroethyl)amino]-1-bicyclo[1.1.1]pentanyl]ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-3H-pyridin-3-yl)methyl]-1-[(1R)-1-(oxan-4-yl)ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxopiperidin-3-yl)methyl]-1-[(1R)-1-(oxetan-3-yl)ethyl]indole-3-carboxamide	IC50	0.5 nM	US-11459315: Modulators of methyl modifying enzymes, compositions and uses thereof

ChEMBL bioactivities

3775 potent at pChembl≥5 of 3858 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
11.00	IC50	0.01	nM	CHEMBL5188827
10.55	IC50	0.028	nM	CHEMBL5172110
10.42	IC50	0.038	nM	CHEMBL5178022
10.41	IC50	0.039	nM	CHEMBL5206526
10.24	IC50	0.057	nM	CHEMBL4639983
10.24	IC50	0.057	nM	CHEMBL5188476
10.23	IC50	0.059	nM	CHEMBL4640994
10.22	IC50	0.06	nM	CHEMBL4638754
10.20	IC50	0.063	nM	CHEMBL4637572
10.17	IC50	0.067	nM	CHEMBL4635809
10.14	IC50	0.072	nM	CHEMBL4635863
10.04	IC50	0.092	nM	CHEMBL4635102
10.00	Ki	0.1	nM	CHEMBL4062421
10.00	IC50	0.1	nM	CHEMBL4639913
10.00	IC50	0.1	nM	CHEMBL4633923
9.92	IC50	0.12	nM	CHEMBL4633932
9.89	Ki	0.13	nM	CHEMBL4073864
9.89	IC50	0.13	nM	CHEMBL4634677
9.85	IC50	0.14	nM	CHEMBL4637958
9.82	Ki	0.15	nM	CHEMBL4082565
9.82	Ki	0.15	nM	CHEMBL4072089
9.82	Ki	0.15	nM	CHEMBL4080606
9.80	IC50	0.16	nM	CHEMBL4649131
9.74	IC50	0.18	nM	CHEMBL4639616
9.74	IC50	0.18	nM	CHEMBL4639569
9.72	Ki	0.19	nM	CHEMBL4060447
9.70	IC50	0.2	nM	CHEMBL4633053
9.70	IC50	0.2	nM	CHEMBL4644363
9.70	IC50	0.2	nM	CHEMBL4641325
9.70	IC50	0.2	nM	CHEMBL4632988
9.68	IC50	0.21	nM	CHEMBL5188577
9.66	Ki	0.22	nM	CHEMBL4067961
9.62	Ki	0.24	nM	CHEMBL4080043
9.60	Ki	0.25	nM	CHEMBL4094432
9.52	IC50	0.3	nM	CHEMBL5868146
9.49	IC50	0.32	nM	CHEMBL5568736
9.47	IC50	0.34	nM	TAZEMETOSTAT
9.46	Ki	0.35	nM	CHEMBL4065249
9.46	IC50	0.35	nM	CHEMBL5087917
9.46	IC50	0.35	nM	CHEMBL5185991
9.46	IC50	0.35	nM	CHEMBL5956024
9.44	IC50	0.36	nM	CHEMBL6011932
9.43	IC50	0.37	nM	CHEMBL5575119
9.42	Ki	0.38	nM	CHEMBL4090352
9.40	IC50	0.4	nM	CHEMBL5191375
9.40	IC50	0.4	nM	CHEMBL5591743
9.35	IC50	0.45	nM	CHEMBL5562984
9.33	IC50	0.47	nM	CHEMBL5188577
9.31	IC50	0.49	nM	CHEMBL4634390
9.30	Ki	0.5	nM	GSK2816126

PubChem BioAssay actives

1250 with measured affinity, of 2211 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
7-methyl-N-[(6-methyl-2-oxo-4-propyl-1H-pyridin-3-yl)methyl]-4-(6-morpholin-4-yl-3-pyridinyl)-1-propan-2-ylindole-6-carboxamide	1868615: Inhibition of EZH2 (unknown origin)	ic50	<0.0001	uM
5-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-2-[(1R)-1-[4-(3-methoxyazetidin-1-yl)cyclohexyl]ethyl]-3-methyl-7,8-dihydro-6H-thieno[3,2-c]azepin-4-one	1868625: Inhibition of wild-type EZH2 (unknown origin)	ic50	<0.0001	uM
7-chloro-N-[(4-chloro-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]-2,4-dimethyl-1,3-benzodioxole-5-carboxamide	1868615: Inhibition of EZH2 (unknown origin)	ic50	<0.0001	uM
(2R)-7-chloro-2-[4-(dimethylamino)cyclohexyl]-2,4-dimethyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1,3-benzodioxole-5-carboxamide	1868615: Inhibition of EZH2 (unknown origin)	ic50	<0.0001	uM
(2R)-9-chloro-2-[4-(dimethylamino)cyclohexyl]-2,4-dimethyl-6-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-7,8-dihydro-[1,3]dioxolo[4,5-g]isoquinolin-5-one	1868615: Inhibition of EZH2 (unknown origin)	ic50	<0.0001	uM
3-chloro-4-(2-cyano-3-pyridazin-4-ylphenoxy)-N-(2,2,6,6-tetramethylpiperidin-4-yl)benzamide	1882367: Inhibition of EZH2 (unknown origin)	ic50	<0.0001	uM
5,8-dichloro-2-[(4-methoxy-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[(R)-methoxy(oxetan-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[2-hydroxy-1-(oxan-4-yl)ethyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[methoxy(oxan-4-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
7-[(1-acetylpiperidin-4-yl)-methoxymethyl]-5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
5,8-dichloro-7-[[1-(2-hydroxyacetyl)piperidin-4-yl]-methoxymethyl]-2-[(4-methoxy-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
5,8-dichloro-2-[(4-methoxy-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[methoxy(oxolan-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[methoxy-(1-methylpiperidin-4-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
5,8-dichloro-7-(3,5-dimethyl-1,2-oxazol-4-yl)-2-[(4-methoxy-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0001	uM
1-[(1R)-1-[4-(3-methoxyazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1-[(1R)-1-[4-(oxetan-3-ylamino)cyclohexyl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1R)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]pyrrolo[2,3-b]pyridine-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1R)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-5-fluoro-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]pyrrolo[2,3-b]pyridine-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1R)-1-[1-(2-hydroxy-2-methylpropyl)piperidin-4-yl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
7-[(1R)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-6-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]pyrrolo[2,3-d]pyrimidine-5-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1-[(1R)-1-[1-(oxetan-3-yl)piperidin-4-yl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1R)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-7-fluoro-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1-[(1R)-1-[4-[3-(trifluoromethoxy)azetidin-1-yl]cyclohexyl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
5-chloro-1-[(1R)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]pyrrolo[2,3-b]pyridine-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1R)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1R)-1-[4-[3-(difluoromethoxy)azetidin-1-yl]cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0001	uM
1-[(1S)-1-[4-(3-cyclopropyloxyazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1882367: Inhibition of EZH2 (unknown origin)	ic50	0.0001	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[(R)-methoxy(oxetan-3-yl)methyl]-3,4-dihydroisoquinolin-1-one	1882370: Binding affinity to EZH2 Y641N mutant (unknown origin) assessed as inhibition constant	ki	0.0001	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[(1R)-2-hydroxy-1-[(3R)-oxolan-3-yl]ethyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0002	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[(1,1-dioxothietan-3-yl)-methoxymethyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0002	uM
N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
1-[(1R)-1-[5-(dimethylamino)-1,3-dioxan-2-yl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
3-[ethyl(oxan-4-yl)amino]-N-[(4-methoxy-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-5-(3-morpholin-4-yl-2,3-dihydro-1H-inden-5-yl)benzamide	1868624: Inhibition of EZH2 Y641N mutant (unknown origin)	ic50	0.0002	uM
N-[(4-chloro-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
N-[(6-chloro-4-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
1-[(1R)-1-[4-(3,3-difluoroazetidin-1-yl)cyclohexyl]ethyl]-2-methyl-N-[(6-methyl-4-methylsulfanyl-2-oxo-1H-pyridin-3-yl)methyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
N-[(6-methoxy-4-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-1-[(1R)-1-[1-(2,2,2-trifluoroethyl)piperidin-4-yl]ethyl]indole-3-carboxamide	1658407: Inhibition of N-terminal FLAG-tagged EZH2 in PRC2 complex (unknown origin) expressed in baculovirus infected Sf9 cells using H2N-RKQLATKAAR(Kme0)SAPATGGVKKP-NTPEGBiot peptide as substrate preincubated with [3H]SAM for 4 to 5 hrs followed by substrate addition and measured after 20 hrs by Topcount reader analysis	ic50	0.0002	uM
N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-4-(1-phenylethyl)benzamide	1868620: Inhibition of EZH2 Y641F mutant (unknown origin)	ic50	0.0002	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[[1-(2-hydroxyacetyl)piperidin-4-yl]-methoxymethyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0003	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[(1,1-dioxothian-4-yl)-methoxymethyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0003	uM
9-bromo-2-[4-(dimethylamino)cyclohexyl]-6-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-2,4-dimethyl-7,8-dihydro-[1,3]dioxolo[4,5-g]isoquinolin-5-one	1868615: Inhibition of EZH2 (unknown origin)	ic50	0.0003	uM
6,9-dichloro-7-(3,5-dimethyl-1,2-oxazol-4-yl)-4-[(4-methoxy-6-methyl-2-oxo-1H-pyridin-3-yl)methyl]-2,3-dihydro-1H-1,4-benzodiazepin-5-one	1827286: Inhibition of EZH2 (unknown origin) using 3H-SAM as substrate incubated for 1 hour by filter binding method	ic50	0.0003	uM
3-[[4-(dimethylamino)cyclohexyl]-ethylamino]-N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-5-[3-methyl-1-(1-methylpiperidin-4-yl)-2-oxobenzimidazol-5-yl]benzamide	2107830: Inhibition of wild type EZH2 (unknown origin) preincubated for 15 mins followed by substrate addition and measured after 45 mins by AlphaLISA assay	ic50	0.0003	uM
Tazemetostat	1666561: Inhibition of wild type EZH2 (unknown origin) by AlphaLISA assay	ic50	0.0003	uM
5,8-dichloro-2-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-7-[2-hydroxy-1-(oxolan-3-yl)ethyl]-3,4-dihydroisoquinolin-1-one	1472354: Inhibition of EZH2 Y641N mutant (unknown origin) using oligonucleosomes as substrate after 60 mins in presence of [3H]SAM by scintillation counting analysis	ki	0.0004	uM
1-[(1R)-1-(4-methoxycyclohexyl)ethyl]-2-methyl-N-[[6-methyl-2-oxo-4-(trideuteriomethylsulfanyl)-1H-pyridin-3-yl]methyl]-5-(1-methylpyrazol-4-yl)indole-3-carboxamide	1868615: Inhibition of EZH2 (unknown origin)	ic50	0.0004	uM
N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-3-[ethyl-[4-[2-methoxyethyl(methyl)amino]cyclohexyl]amino]-2-methyl-5-[3-methyl-1-(1-methylpiperidin-4-yl)-2-oxobenzimidazol-5-yl]benzamide	2107830: Inhibition of wild type EZH2 (unknown origin) preincubated for 15 mins followed by substrate addition and measured after 45 mins by AlphaLISA assay	ic50	0.0004	uM
3-[(1-acetylpiperidin-4-yl)-ethylamino]-N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-2-methyl-5-[3-methyl-1-(1-methylpiperidin-4-yl)-2-oxobenzimidazol-5-yl]benzamide	2107830: Inhibition of wild type EZH2 (unknown origin) preincubated for 15 mins followed by substrate addition and measured after 45 mins by AlphaLISA assay	ic50	0.0004	uM
N-[(4,6-dimethyl-2-oxo-1H-pyridin-3-yl)methyl]-3-[ethyl-[4-[ethyl(methyl)amino]cyclohexyl]amino]-2-methyl-5-[3-methyl-1-(1-methylpiperidin-4-yl)-2-oxobenzimidazol-5-yl]benzamide	2107830: Inhibition of wild type EZH2 (unknown origin) preincubated for 15 mins followed by substrate addition and measured after 45 mins by AlphaLISA assay	ic50	0.0004	uM

CTD chemical–gene interactions

107 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	increases reaction, decreases expression, increases expression, increases methylation, decreases reaction (+3 more)	5
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	4
GSK-2816126	affects binding, affects cotreatment, decreases reaction, decreases activity, decreases expression	4
Acetaminophen	increases expression, affects expression	4
Benzo(a)pyrene	affects methylation, decreases expression, increases expression	4
3-deazaneplanocin	decreases reaction, decreases activity, decreases expression, affects binding	3
palbociclib	decreases expression	3
Arsenic Trioxide	affects binding, decreases reaction, decreases expression, increases expression, decreases response to substance	3
Hydrogen Peroxide	affects expression, increases phosphorylation, affects localization, decreases reaction	3
Particulate Matter	affects binding, decreases reaction, increases abundance, decreases expression	3
cobaltous chloride	increases reaction, decreases expression	2
(+)-JQ1 compound	increases reaction, affects cotreatment, affects binding, decreases reaction, decreases expression	2
GSK343	decreases activity	2
Resveratrol	affects cotreatment, increases expression, decreases expression, increases reaction, increases response to substance	2
Acetylcysteine	affects localization, affects binding, increases abundance, decreases expression, decreases reaction (+1 more)	2
Arsenic	increases phosphorylation, affects localization, affects cotreatment, decreases expression, increases abundance (+1 more)	2
Diethylstilbestrol	increases reaction, increases acetylation, increases expression, increases methylation, decreases reaction (+1 more)	2
Doxorubicin	affects expression, affects response to substance	2
Estradiol	affects binding, increases reaction, increases acetylation, increases expression, increases methylation (+1 more)	2
Smoke	affects binding, increases reaction, decreases reaction, increases expression, decreases expression	2
Tretinoin	decreases expression	2
Valproic Acid	affects expression, increases expression	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
triptolide	decreases expression	1
methylmercuric chloride	affects reaction, affects binding, affects cotreatment	1
triphenyl phosphate	affects expression	1
geraniol	decreases expression	1
zinc chromate	decreases expression, increases abundance	1
manganese chloride	increases abundance, affects cotreatment, decreases expression	1

ChEMBL screening assays

839 unique, capped per target: 833 binding, 6 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL2209050	Binding	Ratio of IC50 for EZH2-mediated proliferation of human LNCaP cells to IC50 for EZH2-mediated nuclear H3K27 methylation in human HCC1806 cells	Identification of Potent, Selective, Cell-Active Inhibitors of the Histone Lysine Methyltransferase EZH2. — ACS Med Chem Lett
CHEMBL4618943	Functional	In vivo inhibition of EZH2 in CB-17 SCID mouse xenografted with human KARPAS422 cells assessed as reduction in trimethylation of H3K27 in tumor at 25 mg/kg, po bid for 21 days measured after 14 days by MSD-ELISA	Design, Synthesis, and Pharmacological Evaluation of Second Generation EZH2 Inhibitors with Long Residence Time. — ACS Med Chem Lett

Cellosaurus cell lines

36 cell lines: 12 transformed cell line, 10 cancer cell line, 5 telomerase immortalized cell line, 3 embryonic stem cell, 3 spontaneously immortalized cell line, 3 induced pluripotent stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0098	SKM-1	Cancer cell line	Male
CVCL_0539	SU-DHL-4	Cancer cell line	Male
CVCL_1902	WSU-DLCL2	Cancer cell line	Male
CVCL_2206	SU-DHL-6	Cancer cell line	Male
CVCL_A1Q2	SEES3-1V human EZH2, clone1	Embryonic stem cell	Male
CVCL_A1Q3	SEES3-1V human EZH2, clone2	Embryonic stem cell	Male
CVCL_A1Q4	SEES3-1V human EZH2, clone3	Embryonic stem cell	Male
CVCL_B7TU	e-hChon-1	Transformed cell line	Female
CVCL_B7TV	e-hChon-2	Transformed cell line	Female
CVCL_B7TX	e-hChon-4	Transformed cell line	Female

Clinical trials (associated diseases)

299 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT03107325	PHASE4	WITHDRAWN	Biokinetics Study for F-18 FDG in Pediatric Molecular Imaging
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT05887882	PHASE1	SUSPENDED	Intra-Tumoral Injections of Natural Killer Cells for Recurrent Malignant Pediatric Brain Tumors
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT01783041	PHASE2/PHASE3	COMPLETED	Effect of Early L-Carnitine Supplementation on Neurodevelopmental Outcomes in Very Preterm Infants
NCT05767385	PHASE2/PHASE3	RECRUITING	Fetal Cerebrovascular Autoregulation in Congenital Heart Disease and Association With Neonatal Neurobehavior
NCT05675098	EARLY_PHASE1	NOT_YET_RECRUITING	Central Nervous System Stimulants and Physical Function in Children With Cerebral Palsy
NCT00783783	Not specified	COMPLETED	CYP2D6 Pharmacogenetics in Risperidone-Treated Children
NCT01778504	Not specified	RECRUITING	Studying Childhood-onset Behavioral, Psychiatric, and Developmental Disorders
NCT01850784	Not specified	UNKNOWN	High Energy Formula Feeding in Infants With Congenital Heart Disease
NCT01922791	Not specified	COMPLETED	Nutrition and Pregnancy Intervention Study
NCT01942525	Not specified	UNKNOWN	Influence of Intrauterine Growth Restriction on Amplitude-integrated EEG in Preterm Infants
NCT02003170	Not specified	COMPLETED	Etiology and Early Diagnosis of Neurodevelopmental Disorders
NCT02118649	Not specified	ACTIVE_NOT_RECRUITING	Enhancing Behavior and Brain Response to Visual Targets Using a Computer Game
NCT02557191	Not specified	TERMINATED	Biomarkers, Neurodevelopment and Preterm Infants
NCT02690675	Not specified	COMPLETED	Iron Supplement Effect on Child Development