FAM226A
gene geneOn this page
Also known as MGC34827
Summary
FAM226A (family with sequence similarity 226 member A, HGNC:28544) is a long non-coding RNA gene on chromosome Xq13.1.
At a glance
- GWAS associations: 1
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:28544 |
| Approved symbol | FAM226A |
| Name | family with sequence similarity 226 member A |
| Location | Xq13.1 |
| Locus type | RNA, long non-coding |
| Status | Approved |
| Aliases | MGC34827 |
| Entrez | 203429 |
| RNAcentral | URS000075D90C — lncRNA, 2023 nt, 1 organism(s) |
Gene structure
Transcript identifiers
Ensembl transcripts: 0
RefSeq mRNA: 0 — MANE Select: None
Canonical transcript exons
None — 0 exons
Expression profiles
Top tissues by expression
0 total, by Bgee expression score (0-100, higher = more expressed):
Regulation
Is transcription factor: no
Cross-species orthologs
0 orthologs
Protein
Protein identifiers
Canonical reviewed UniProt: None (reviewed: )
All UniProt accessions (0):
RefSeq proteins (0): (*=MANE)
Domains & families (InterPro)
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 0 (showing top):
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (0):
Protein interactions and networks
STRING
0 interactions, top by confidence (×1000):
IntAct
0 interactions, top by confidence:
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
0 scored. Top likely-pathogenic:
dbSNP variants (sampled 299 via entrez): RS1197102905 (X:72944115 A>G), RS1198932721 (X:72943835 G>A,C), RS1202396970 (X:72943885 A>G), RS1212719177 (X:72943772 A>C,G), RS1229164919 (X:72943772 AAGGAGGAGGAGGAGGAGGAGG>A,AAGGAGGAGG,AAGGAGGAGGAGG,AAGGAGGAGGAGGAGG,AAGGAGGAGGAGGAGGAGG,AAGGAGGAGGAGGAGGAGGAGGAGG,AAGGAGGAGGAGGAGGAGGAGGAGGAGG,AAGGAGGAGGAGGAGGAGGAGGAGGAGGAGG), RS1273116988 (X:72944111 T>C), RS1305506799 (X:72943814 G>A,C), RS1395867526 (X:72943820 CAGGAGGAGGAGGAGG>C,CAGGAGGAGGAGGAGGAGG,CAGGAGGAGGAGGAGGAGGAGG,CAGGAGGAGGAGGAGGAGGAGGAGG,CAGGAGGAGGAGGAGGAGGAGGAGGAGGAGG,CAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGG), RS1404761963 (X:72943805 C>A,G), RS1437095902 (X:72944063 C>T), RS1470586027 (X:72943766 G>GGGAGAA), RS1480669199 (X:72943855 G>A,C), RS1556358211 (X:72941298 C>T), RS1556358213 (X:72941311 C>T), RS1556358215 (X:72941336 C>A)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
1 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST008103_139 | Bipolar disorder | 3.000000e-06 |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.