FAM246C

Summary

FAM246C (family with sequence similarity 246 member C (gene/pseudogene), HGNC:54842) is a protein-coding gene on chromosome 22q11.21, encoding Protein FAM246C (P0DSO1).

At a glance

• Clinical variants (ClinVar): 1 total — 1 pathogenic

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:54842
Approved symbol	FAM246C
Name	family with sequence similarity 246 member C (gene/pseudogene)
Location	22q11.21
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000286025
Ensembl biotype	protein_coding
Entrez	117134596

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding_LoF

ENST00000652053, ENST00000697771

RefSeq mRNA: 1 — MANE Select: None NM_001396027

Canonical transcript exons

ENST00000652053 — 1 exons

Exon	Start	End
ENSE00003851124	19029524	19031242

Expression profiles

Bgee: expression breadth broad, 94 present calls, max score 85.21.

Top tissues by expression

110 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	85.21	gold quality
right hemisphere of cerebellum	UBERON:0014890	80.22	gold quality
cerebellar cortex	UBERON:0002129	80.10	gold quality
cerebellar hemisphere	UBERON:0002245	80.06	gold quality
cerebellum	UBERON:0002037	80.03	gold quality
right frontal lobe	UBERON:0002810	70.20	gold quality
Brodmann (1909) area 9	UBERON:0013540	68.78	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	68.70	gold quality
anterior cingulate cortex	UBERON:0009835	68.68	gold quality
cortical plate	UBERON:0005343	68.35	gold quality
hypothalamus	UBERON:0001898	68.32	gold quality
superior frontal gyrus	UBERON:0002661	68.08	gold quality
primary visual cortex	UBERON:0002436	67.60	gold quality
nucleus accumbens	UBERON:0001882	67.56	gold quality
brain	UBERON:0000955	66.99	gold quality
temporal lobe	UBERON:0001871	66.80	gold quality
amygdala	UBERON:0001876	66.75	gold quality
cerebral cortex	UBERON:0000956	66.73	gold quality
putamen	UBERON:0001874	66.23	gold quality
Ammon’s horn	UBERON:0001954	66.06	gold quality
caudate nucleus	UBERON:0001873	65.91	gold quality
frontal cortex	UBERON:0001870	65.48	gold quality
blood	UBERON:0000178	63.73	gold quality
right lobe of liver	UBERON:0001114	62.43	gold quality
prefrontal cortex	UBERON:0000451	61.86	gold quality
substantia nigra	UBERON:0002038	61.21	gold quality
bone marrow cell	CL:0002092	61.17	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	58.87	gold quality
liver	UBERON:0002107	58.01	gold quality
ganglionic eminence	UBERON:0004023	54.81	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.17

Regulation

Is transcription factor: no

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Fam246a	ENSMUSG00000116652
rattus_norvegicus	LOC120095536	ENSRNOG00000070676

Paralogs (2): FAM246A (ENSG00000286102), FAM246B (ENSG00000286175)

Protein

Protein identifiers

Protein FAM246C — P0DSO1 (reviewed: P0DSO1)

All UniProt accessions (0):

UniProt curated annotations — full annotation on UniProt →

Polymorphism. There are two variants, that are the most frequent in population and represented on the reference genome assembly (GRCh38/hg38). The first variant (rs979651598) has a stop codon instead of Ser-116, giving rise to truncated form. The variant Ser-116 is rare, except in populations from non-Finnish European. The second variant has a stop codon instead of Leu-186, giving rise to truncated form. The sequence shown is rare and is not represented on the reference genome assembly (GRCh38/hg38).

Similarity. Belongs to the FAM246 family.

RefSeq proteins (1): NP_001382956 (*=MANE)

Domains & families (InterPro)

UniProt features (9 total): compositionally biased region 4, region of interest 2, sequence variant 2, chain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P0DSO1-F1	53.24	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 1 (showing top): chr22q11

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: B2GHI7, O77618, P03327, P08098, P09165, P0CV93, P0DSO1, P13985, P14501, P16796, P16797, P16961, P17143, P20185, P25315, P25316, P26159, P26919, P27458, P27898, P52167, P55505, P56504, P65046, P95225, P9WF14, P9WF15, P9WL34, P9WL35, Q03381, Q1BJT2, Q2J4A0, Q2T103, Q3KSP3, Q50702, Q54340, Q56353, Q60E34, Q64364, Q68US6

Diamond homologs: A0A494C0N9, A0A494C0Y3, P0DSO1

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

1 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
155226	GRCh38/hg38 22q11.21(chr22:18339130-21111370)x1	Pathogenic

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000503010 (22:19030318 C>T), RS1001087299 (22:19030017 GCCCCGCGCCGTC>G,GCCCCGCGCCGTCCCCCGCGCCGTC), RS1002332288 (22:19028134 T>C,G), RS1003496208 (22:19029005 C>A), RS1004347107 (22:19030115 A>C), RS1004505294 (22:19029953 G>A,C), RS1006336077 (22:19027679 T>C), RS1007245816 (22:19028509 G>A,C), RS1008247457 (22:19029520 G>A), RS1008301631 (22:19029673 T>C), RS1009256013 (22:19030360 CG>C), RS1009307044 (22:19030472 G>A,T), RS1011261926 (22:19028168 T>C), RS1012558825 (22:19029222 C>G,T), RS1013619078 (22:19030301 G>C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.