FARS2

Summary

FARS2 (phenylalanyl-tRNA synthetase 2, mitochondrial, HGNC:21062) is a protein-coding gene on chromosome 6p25.1, encoding Phenylalanine–tRNA ligase, mitochondrial (O95363). Is responsible for the charging of tRNA(Phe) with phenylalanine in mitochondrial translation. It is a selective cancer dependency (DepMap: 53.6% of cell lines).

This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 10667 — RefSeq curated summary.

At a glance

• Gene–disease (curated): mitochondrial disease (Definitive, ClinGen) — +5 more curated relationships
• GWAS associations: 7
• Clinical variants (ClinVar): 651 total — 52 pathogenic, 28 likely-pathogenic (top 5% of genes corpus-wide)
• GTEx eGene: eQTL in 30 tissues, sQTL in 9 (q < 0.05)
• Phenotypes (HPO): 75
• Cancer dependency (DepMap): dependent in 53.6% of screened cell lines
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.01 (unconstrained)
• MANE Select transcript: NM_006567

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21062
Approved symbol	FARS2
Name	phenylalanyl-tRNA synthetase 2, mitochondrial
Location	6p25.1
Locus type	gene with protein product
Status	Approved
Aliases	dJ236A3.1, mtPheRS
Ensembl gene	ENSG00000145982
Ensembl biotype	protein_coding
OMIM	611592
Entrez	10667

Gene structure

Transcript identifiers

Ensembl transcripts: 45 — 38 protein_coding, 7 nonsense_mediated_decay

MANE Select: ENST00000274680

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 3: 2

ENST00000274680, ENST00000324331, ENST00000445533, ENST00000602691, ENST00000648580, ENST00000897566, ENST00000897567, ENST00000897568, ENST00000897569, ENST00000897570, ENST00000897571, ENST00000897572, ENST00000897573, ENST00000897574, ENST00000897575, ENST00000897576, ENST00000897577, ENST00000897578, ENST00000897579, ENST00000897580, ENST00000897581, ENST00000897582, ENST00000937582, ENST00000937583, ENST00000937584, ENST00000937585, ENST00000954686, ENST00000954687, ENST00000954688, ENST00000954689, ENST00000994128, ENST00000994129, ENST00001025745, ENST00001025747, ENST00001025748, ENST00001025749, ENST00001113236, ENST00001121618, ENST00001121619, ENST00001121620, ENST00001121621, ENST00001122598, ENST00001122599, ENST00001122600, ENST00001135779

RefSeq mRNA: 11 — MANE Select: NM_006567 NM_001318872, NM_001374875, NM_001374876, NM_001374877, NM_001374878, NM_001374879, NM_001375257, NM_001375258, NM_001375259, NM_001375260, NM_006567

CCDS: CCDS4494

Canonical transcript exons

ENST00000274680 — 7 exons

Exon	Start	End
ENSE00000973358	5404542	5404701
ENSE00000973359	5431041	5431172
ENSE00001125682	5368550	5369182
ENSE00001155746	5613169	5613320
ENSE00001155754	5545180	5545340
ENSE00001345246	5771291	5771583
ENSE00003407836	5261513	5261660

Expression profiles

Bgee: expression breadth ubiquitous, 260 present calls, max score 90.44.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 11.1685 / max 132.9220, expressed in 1778 samples.

Highest expression (Bgee): triceps brachii, endothelial cell, gluteal muscle, primordial germ cell in gonad, tongue squamous epithelium.

Genetic regulation across tissues (GTEx eQTL / sQTL)

FARS2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 30 tissues and its splicing (sQTL) in 9 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 39 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	eqtl	3.5e-28	+0.92	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Adipose Subcutaneous	eqtl	6.0e-19	+0.80	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Whole Blood	eqtl	5.3e-17	+0.55	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Nerve Tibial	eqtl	1.1e-15	+0.77	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Artery Aorta	eqtl	3.5e-15	+0.92	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Adipose Visceral Omentum	eqtl	5.5e-15	+0.90	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Skin Sun Exposed Lower leg	eqtl	7.6e-15	+0.59	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Artery Tibial	eqtl	3.0e-14	+0.59	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Cells Cultured fibroblasts	eqtl	6.0e-14	+0.92	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Esophagus Mucosa	eqtl	1.8e-12	+0.60	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Skin Not Sun Exposed Suprapubic	eqtl	1.4e-10	+0.51	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Spleen	eqtl	1.4e-09	+1.00	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Breast Mammary Tissue	eqtl	1.5e-08	+0.64	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Testis	sqtl	1.8e-08	-0.55	6:5646880:C:A
Testis	eqtl	3.5e-08	+0.96	6:5794947:G:A
Colon Transverse	eqtl	1.5e-07	+0.58	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Esophagus Muscularis	eqtl	3.9e-07	+0.60	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G
Thyroid	sqtl	7.3e-07	+0.42	6:5272326:T:TA
Heart Atrial Appendage	eqtl	9.6e-06	+0.75	6:5247885:T:C
Cells EBV-transformed lymphocytes	eqtl	1.7e-05	+0.69	6:5261233:GAGGCCGCGTTGCCCGGGTTACCGA:G

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
65588	10.1894	1772
65587	0.9791	567

Top tissues by expression

showing 100 of 281 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
triceps brachii	UBERON:0001509	90.44	silver quality
endothelial cell	CL:0000115	88.54	gold quality
gluteal muscle	UBERON:0002000	88.14	silver quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	88.12	gold quality
tongue squamous epithelium	UBERON:0006919	87.39	silver quality
skeletal muscle tissue	UBERON:0001134	86.73	gold quality
deltoid	UBERON:0001476	86.69	gold quality
epithelium of bronchus	UBERON:0002031	86.61	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	86.59	gold quality
nasal cavity epithelium	UBERON:0005384	86.51	gold quality
buccal mucosa cell	CL:0002336	86.50	gold quality
quadriceps femoris	UBERON:0001377	86.50	silver quality
vastus lateralis	UBERON:0001379	86.49	silver quality
choroid plexus epithelium	UBERON:0003911	86.45	gold quality
bronchus	UBERON:0002185	86.44	gold quality
sperm	CL:0000019	86.02	silver quality
cervix squamous epithelium	UBERON:0006922	86.00	gold quality
muscle tissue	UBERON:0002385	85.92	gold quality
adrenal tissue	UBERON:0018303	85.83	gold quality
male germ cell	CL:0000015	85.78	silver quality
heart left ventricle	UBERON:0002084	85.68	gold quality
cardiac ventricle	UBERON:0002082	85.58	gold quality
muscle organ	UBERON:0001630	85.54	gold quality
epithelium of nasopharynx	UBERON:0001951	85.21	gold quality
vena cava	UBERON:0004087	85.20	silver quality
myocardium	UBERON:0002349	85.17	silver quality
calcaneal tendon	UBERON:0003701	85.17	gold quality
muscle of leg	UBERON:0001383	85.13	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	85.11	gold quality
left ventricle myocardium	UBERON:0006566	85.01	silver quality
gastrocnemius	UBERON:0001388	84.93	gold quality
bronchial epithelial cell	CL:0002328	84.86	gold quality
biceps brachii	UBERON:0001507	84.86	gold quality
gingival epithelium	UBERON:0001949	84.81	gold quality
mucosa of transverse colon	UBERON:0004991	84.81	gold quality
diaphragm	UBERON:0001103	84.75	gold quality
parotid gland	UBERON:0001831	84.55	silver quality
hindlimb stylopod muscle	UBERON:0004252	84.42	gold quality
heart	UBERON:0000948	84.28	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.91	gold quality
tendon	UBERON:0000043	83.89	gold quality
right adrenal gland	UBERON:0001233	83.87	gold quality
apex of heart	UBERON:0002098	83.87	gold quality
squamous epithelium	UBERON:0006914	83.86	gold quality
nephron tubule	UBERON:0001231	83.83	gold quality
pigmented layer of retina	UBERON:0001782	83.81	gold quality
right adrenal gland cortex	UBERON:0035827	83.51	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	83.45	gold quality
left lobe of thyroid gland	UBERON:0001120	83.40	gold quality
gingiva	UBERON:0001828	83.23	gold quality
thyroid gland	UBERON:0002046	83.22	gold quality
right atrium auricular region	UBERON:0006631	83.16	gold quality
kidney epithelium	UBERON:0004819	83.13	gold quality
right lobe of thyroid gland	UBERON:0001119	83.08	gold quality
heart right ventricle	UBERON:0002080	83.07	gold quality
cardiac atrium	UBERON:0002081	83.03	gold quality
left adrenal gland	UBERON:0001234	82.95	gold quality
adrenal gland	UBERON:0002369	82.84	gold quality
mucosa of paranasal sinus	UBERON:0005030	82.81	gold quality
right uterine tube	UBERON:0001302	82.79	gold quality
adrenal cortex	UBERON:0001235	82.35	gold quality
monocyte	CL:0000576	82.28	gold quality
leukocyte	CL:0000738	82.28	gold quality
left adrenal gland cortex	UBERON:0035825	82.24	gold quality
middle temporal gyrus	UBERON:0002771	82.22	gold quality
mononuclear cell	CL:0000842	82.18	gold quality
pancreatic ductal cell	CL:0002079	82.17	silver quality
rectum	UBERON:0001052	82.17	gold quality
ganglionic eminence	UBERON:0004023	82.08	gold quality
adult mammalian kidney	UBERON:0000082	82.05	gold quality
esophagus squamous epithelium	UBERON:0006920	82.04	gold quality
inferior olivary complex	UBERON:0002127	81.93	silver quality
stromal cell of endometrium	CL:0002255	81.76	gold quality
kidney	UBERON:0002113	81.75	gold quality
popliteal artery	UBERON:0002250	81.62	gold quality
tibial artery	UBERON:0007610	81.61	gold quality
smooth muscle tissue	UBERON:0001135	81.53	gold quality
type B pancreatic cell	CL:0000169	81.50	gold quality
corpus callosum	UBERON:0002336	81.50	gold quality
granulocyte	CL:0000094	81.49	gold quality
adenohypophysis	UBERON:0002196	81.49	gold quality
metanephros	UBERON:0000081	81.48	gold quality
pericardium	UBERON:0002407	81.47	silver quality
palpebral conjunctiva	UBERON:0001812	81.41	gold quality
olfactory bulb	UBERON:0002264	81.41	gold quality
lymph node	UBERON:0000029	81.39	gold quality
tendon of biceps brachii	UBERON:0008188	81.38	gold quality
islet of Langerhans	UBERON:0000006	81.21	gold quality
pituitary gland	UBERON:0000007	81.16	gold quality
left coronary artery	UBERON:0001626	81.13	gold quality
renal glomerulus	UBERON:0000074	81.09	gold quality
coronary artery	UBERON:0001621	81.08	gold quality
skin of abdomen	UBERON:0001416	81.06	gold quality
ventricular zone	UBERON:0003053	81.06	gold quality
embryo	UBERON:0000922	81.02	gold quality
cortex of kidney	UBERON:0001225	81.00	gold quality
periodontal ligament	UBERON:0008266	80.92	silver quality
aorta	UBERON:0000947	80.85	gold quality
tibialis anterior	UBERON:0001385	80.85	gold quality
body of stomach	UBERON:0001161	80.83	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.71

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Choroid plexus	tissue	52.6
Caudate putamen	tissue	26.5
Nucleus accumbens	tissue	24.2
Skeletal muscle	tissue	18.5	medium
Frontal cortex	tissue	18.5
Postcentral gyrus	tissue	18.4
Tongue	tissue	16.8
Hippocampus	tissue	16.8	low
Thalamus	tissue	15.8
Locus coeruleus	tissue	15.5
Pons	tissue	14.4
Fallopian tube	tissue	14.0	not detected
Heart muscle	tissue	13.9	medium
Liver	tissue	13.5	low
Thyroid gland	tissue	13.4	medium
Kidney	tissue	13.2	low
Hippocampal formation	tissue	13.2
Medulla oblongata	tissue	13.1
Cerebral cortex	tissue	13.0	low
Motor cortex	tissue	13.0
Superior colliculi	tissue	13.0
Midbrain	tissue	12.8
Occipital cortex	tissue	12.8
Somatosensory cortex	tissue	12.5
Parathyroid gland	tissue	12.4	not detected
Hypothalamus	tissue	12.3
Periaqueductal gray	tissue	12.3
Temporal cortex	tissue	12.3
Prefrontal cortex	tissue	12.1
Putamen	tissue	12.1
Lymph node	tissue	11.6	low
Thymus	tissue	11.6
Insular cortex	tissue	11.6
Testis	tissue	11.5	medium
Spinal cord	tissue	11.5
Retrosplenial and cingulate cortex	tissue	11.5
Entorhinal cortex	tissue	11.4
Basal ganglia	tissue	11.3	low
Amygdala	tissue	11.3
Bone marrow	tissue	11.0	medium
Substantia nigra	tissue	10.7
Rectum	tissue	10.6	medium
Ventral forebrain	tissue	10.6
Retrosplenial cortex	tissue	10.6
Septum	tissue	10.4
Breast	tissue	10.3	low
Tonsil	tissue	10.3	medium
Colon	tissue	9.9	medium
Pancreas	tissue	9.8	low
Adrenal gland	tissue	9.6	medium
Esophagus	tissue	9.3	not detected
Pituitary gland	tissue	9.2
Smooth muscle	tissue	9.1	low
Lung	tissue	9.1	medium
Appendix	tissue	9.1	low
Cerebellum	tissue	8.9	low
Olfactory bulb	tissue	8.8
Ovary	tissue	8.7	medium
Endometrium 1	tissue	8.6	low
Spleen	tissue	8.6	low

Brain sub-regions (HPA Brain Atlas): detected in 190; highest nTPM — Ventromedial nucleus (27.0), Caudate nucleus (26.8), Fusiform gyrus (26.6), Inferior parietal lobule (25.1), Arcuate nucleus (24.4).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): QRICH1

miRNA regulators (miRDB)

Targeting FARS2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

12 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6809-3P	99.91	71.45	3814
HSA-MIR-548AR-3P	99.85	71.26	3889
HSA-MIR-130B-5P	99.83	68.50	1888
HSA-MIR-548AZ-3P	99.82	70.56	3549
HSA-MIR-548BC	99.82	70.61	3524
HSA-MIR-548E-3P	99.82	70.59	3514
HSA-MIR-548F-3P	99.82	70.59	3540
HSA-MIR-548A-3P	99.76	70.58	3524
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-3151-3P	97.80	66.16	479
HSA-MIR-5699-5P	97.36	67.03	1014
HSA-MIR-335-5P	97.10	68.12	1022

Functional genomics

gnomAD constraint: pLI 3.22e-09, LOEUF 1.01, missense Z 1.13 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000274680 — one region, missense o/e 0.90. ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map DepMap (CRISPR cell-line fitness): dependent in 53.6% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): SNU-869 (-1.802), OCI-AML3 (-1.62), SU-DHL-10 (-1.618), SU-DHL-1 (-1.5), FU97 (-1.488), SNU-398 (-1.451), GSS (-1.446), EWS502 (-1.383), SF-295 (-1.338), OCI-AML2 (-1.316), LN-428 (-1.311), F-36P (-1.3), TE-11 (-1.297), NCI-H1703 (-1.294), HMC-1-8 (-1.291).

Literature-anchored findings (GeneRIF, showing 18)

• The recombinant human enzyme has been purified to homogeneity and crystallized in complex with phenylalanine and ATP. (PMID:17768348)
• Formation of the PheRS-tRNAPhe complex in human mitochondria must be accompanied by considerable rearrangement of the anticodon binding domain upon tRNA binding. (PMID:18611382)
• Mitochondrial and cytoplasmic phenylalanyl-tRNA synthetases (HsmtPheRS and HsctPheRS, respectively) catalyze direct attachment of m-Tyr to tRNA(Phe). (PMID:19549855)
• these results indicate that conformational flexibility of the two functional modules in mtPheRS is essential for its phenylalanylation activity. (PMID:19737557)
• Two phenylalanyl-tRNA synthetase variants Ser57Cys and Asp280Ser both display wild-type aminoacylation activity and stability with respect to their free energies of unfolding, but are less stable at low hydrogen-ion concentration (pH). (PMID:21601574)
• the three FARS2 mutations directly impair aminoacylation function and stability of mtPheRS, leading to a decrease in overall tRNA charging capacity. (PMID:22833457)
• this study expands the phenotypic spectrum of FARS2 related disease and emphasizes intragenic deletion in the list of causative mutations. (PMID:25851414)
• A newly identified missense mutation in FARS2 causes autosomal-recessive spastic paraplegia. (PMID:26553276)
• in patients with drug-resistant infantile spasm syndrome, associated with focal seizures, mild metabolic changes, and cerebral atrophy with volume loss of white matter on MRI, mutations in FARS2 should be considered. (PMID:27549011)
• Kinetic and structural changes in HsmtPheRS, induced by pathogenic mutations in human FARS2 have been described. (PMID:28419689)
• Based on the phenotypic data of previously reported subjects and the two subjects reported here, we conclude that FARS2 deficiency can be associated with two phenotypes: (i) an epileptic phenotype, and (ii) a spastic paraplegia phenotype. (PMID:29126765)
• The total number of unique pathogenic FARS2 variants known to date is 21 including three different partial gene deletions reported in four individuals. Except for the large deletions, all variants but two (one in-frame deletion of one amino acid and one splice-site variant) are missense. All large deletions and the single splice-site variant are in trans with a missense variant. (PMID:30177229)
• the presence of aggregation-prone insoluble human mitochondrial phenylalanyl-tRNA synthetase (HsmitPheRS) variants could have a detrimental impact on organellar translation, and potentially impact normal mitochondrial function in Alpers encephalopathy (PMID:31241862)
• Breaking a single hydrogen bond in the mitochondrial tRNA(Phe) -PheRS complex leads to phenotypic pleiotropy of human disease. (PMID:32115907)
• Novel FARS2 variants in patients with early onset encephalopathy with or without epilepsy associated with long survival. (PMID:33168986)
• Phenotypic diversity of brain MRI patterns in mitochondrial aminoacyl-tRNA synthetase mutations. (PMID:33972171)
• Two Chinese siblings of combined oxidative phosphorylation deficiency 14 caused by compound heterozygous variants in FARS2. (PMID:36155627)
• FARS2 Deficiency Causes Cardiomyopathy by Disrupting Mitochondrial Homeostasis and the Mitochondrial Quality Control System. (PMID:38362779)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	fars2	ENSDARG00000091247
mus_musculus	Fars2	ENSMUSG00000021420
rattus_norvegicus	Fars2	ENSRNOG00000016135
drosophila_melanogaster	PheRS-m	FBGN0275436
caenorhabditis_elegans		WBGENE00013361

Paralogs (2): FARSA (ENSG00000179115), FDXACB1 (ENSG00000255561)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1917205) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 18 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal cell morphology	1
abnormal cerebral cortex morphology	1
abnormal ectoderm development	1
embryonic growth arrest	1
decreased brain weight	1
loss of cortex neurons	1
increased circulating aspartate transaminase level	1
abnormal mitochondrial physiology	1
increased apoptosis	1
thin cerebral cortex	1
decreased grip strength	1
abnormal oxidative phosphorylation	1
neonatal lethality, complete penetrance	1
embryonic lethality between implantation and somite formation, complete penetrance	1
preweaning lethality, complete penetrance	1
enlarged brain ventricles	1
abnormal mitochondrial crista morphology	1
decreased cellular ATP level	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Arabidopsis thaliana	Q94K73	48.2%	Diamond
Dictyostelium discoideum	Q86A68	48.1%	Diamond
Saccharomyces cerevisiae S288C	P08425	47.5%	Diamond
Schizosaccharomyces pombe 972h-	O74952	43.9%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MIR3691	ncRNA	100500900
FARS2-AS1	ncRNA	101927972
RPP40	protein-coding	10799
LYRM4	protein-coding	57128
PPP1R3G	protein-coding	648791
CDYL	protein-coding	9425
LYRM4-AS1	ncRNA	100129461

Protein

Protein identifiers

Phenylalanine–tRNA ligase, mitochondrial — O95363 (reviewed: O95363)

Alternative names: Phenylalanyl-tRNA synthetase

All UniProt accessions (4): A0A3B3ITR6, O95363, Q5JRF7, R4GMX6

UniProt curated annotations — full annotation on UniProt →

Function. Is responsible for the charging of tRNA(Phe) with phenylalanine in mitochondrial translation. To a lesser extent, also catalyzes direct attachment of m-Tyr (an oxidized version of Phe) to tRNA(Phe), thereby opening the way for delivery of the misacylated tRNA to the ribosome and incorporation of ROS-damaged amino acid into proteins.

Subunit / interactions. Monomer.

Subcellular location. Mitochondrion matrix. Mitochondrion.

Disease relevance. Combined oxidative phosphorylation deficiency 14 (COXPD14) [MIM:614946] A severe multisystemic autosomal recessive disorder characterized by neonatal onset of global developmental delay, refractory seizures, and lactic acidosis. Biochemical studies show deficiencies of multiple mitochondrial respiratory enzymes. The disease is caused by variants affecting the gene represented in this entry. Spastic paraplegia 77, autosomal recessive (SPG77) [MIM:617046] A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the class-II aminoacyl-tRNA synthetase family.

RefSeq proteins (11): NP_001305801, NP_001361804, NP_001361805, NP_001361806, NP_001361807, NP_001361808, NP_001362186, NP_001362187, NP_001362188, NP_001362189, NP_006558* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002319	Phenylalanyl-tRNA_Synthase	Domain
IPR004530	Phe-tRNA-synth_IIc_mito	Family
IPR005121	Fdx_antiC-bd	Domain
IPR006195	aa-tRNA-synth_II	Domain
IPR036690	Fdx_antiC-bd_sf	Homologous_superfamily
IPR045864	aa-tRNA-synth_II/BPL/LPL	Homologous_superfamily

Pfam: PF01409, PF03147

Enzyme classification (BRENDA)

• EC 6.1.1.20 — phenylalanine-tRNA ligase (BRENDA: 45 organisms, 151 substrates, 239 inhibitors, 149 Km, 73 kcat entries)

Substrate kinetics (BRENDA)

22 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
L-PHENYLALANINE	0.0003–11	28
TRNAPHE	0.0001–0.018	27
ATP	0.0058–2.5	26
PHE	0.0004–0.083	12
L-PHE	0.0018–0.05	11
2-CHLOROADENOSINE 5’-TRIPHOSPHATE	0.05–0.2	8
L-TYROSINE	0.32–3	7
2’-DEOXYADENOSINE 5’-TRIPHOSPHATE	0.085–0.4	4
3,4-DIHYDROXY-L-PHENYLALANINE	0.38–0.65	3
3’-DEOXYADENOSINE 5’-TRIPHOSPHATE	0.82–1	2
DL-M-TYROSINE	0.012–0.13	2
(S-PA)TRNAPHE	0.0002	1
(S-PG)TRNAPHE	0.0002	1
2-DEOXYADENOSINE 5’-TRIPHOSPHATE	1.54	1
2-L-NAPHTHYLALANINE	2	1

Catalyzed reactions (Rhea)

• tRNA(Phe) + L-phenylalanine + ATP = L-phenylalanyl-tRNA(Phe) + AMP + diphosphate + H(+) (RHEA:19413)

UniProt features (63 total): helix 23, strand 18, sequence variant 6, binding site 6, turn 4, sequence conflict 2, transit peptide 1, chain 1, domain 1, modified residue 1

Structure

Experimental structures (PDB)

9 structures by resolution:

PDB	Title	Method	Resolution (Å)
5MGW	Kinetic and Structural Changes in HsmtPheRS, Induced by Pathogenic Mutations in Human …	X-RAY DIFFRACTION	1.46
8P8X	Crystal structure of a pathogenic mutant variant of human mitochodnrial PheRS	X-RAY DIFFRACTION	1.46
5MGH	Crystal structure of pathogenic mutants of human mitochodnrial PheRS	X-RAY DIFFRACTION	1.87
5MGU	Kinetic and Structural Changes in HsmtPheRS, Induced by Pathogenic Mutations in Human …	X-RAY DIFFRACTION	1.89
5MGV	Kinetic and Structural Changes in HsmtPheRS, Induced by Pathogenic Mutations in Human …	X-RAY DIFFRACTION	2.05
3CMQ	Crystal structure of human mitochondrial phenylalanine tRNA synthetase	X-RAY DIFFRACTION	2.2
3TEG	Bacterial and Eukaryotic Phenylalanyl-tRNA Synthetases Catalyze Misaminoacylation of …	X-RAY DIFFRACTION	2.2
3HFV	Crystal structure of human mitochondrial phenylalanyl-tRNA synthetase complexed with …	X-RAY DIFFRACTION	2.6
3TUP	Crystal structure of human mitochondrial PheRS complexed with tRNAPhe in the active open …	X-RAY DIFFRACTION	3.05

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O95363-F1	90.17	0.86

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Ligase, Predicted intracellular proteins, Disease related genes, Potential drug targets, Human disease related genes, Congenital disorders of metabolism

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (6)

Position	Role
157–160	substrate
179	substrate
186–188	substrate
193–195	substrate
287	substrate
312	substrate

Post-translational modifications (1)

Type	Positions
N6-acetyllysine	202

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 4; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

4 pathways:

ID	Pathway	Evidence
R-HSA-379726	Mitochondrial tRNA aminoacylation	curated
R-HSA-392499	Metabolism of proteins	—
R-HSA-72766	Translation	—
R-HSA-379724	tRNA Aminoacylation	—

MSigDB gene sets: 254 (showing top): BEGUM_TARGETS_OF_PAX3_FOXO1_FUSION_UP, GOBP_AMINO_ACID_ACTIVATION, GOBP_TRNA_METABOLIC_PROCESS, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_TRANSLATION, chr6p25, BROWNE_HCMV_INFECTION_14HR_DN, DACOSTA_UV_RESPONSE_VIA_ERCC3_COMMON_DN, KEGG_AMINOACYL_TRNA_BIOSYNTHESIS, AFFAR_YY1_TARGETS_DN, REACTOME_MITOCHONDRIAL_TRNA_AMINOACYLATION, GRYDER_PAX3FOXO1_ENHANCERS_IN_TADS, ACEVEDO_LIVER_CANCER_UP, SPIELMAN_LYMPHOBLAST_EUROPEAN_VS_ASIAN_DN, GOBP_TRNA_PROCESSING

GO Biological Process (5): tRNA aminoacylation for protein translation (GO:0006418), phenylalanyl-tRNA aminoacylation (GO:0006432), tRNA processing (GO:0008033), translation (GO:0006412), tRNA aminoacylation (GO:0043039)

GO Molecular Function (7): tRNA binding (GO:0000049), phenylalanine-tRNA ligase activity (GO:0004826), ATP binding (GO:0005524), nucleotide binding (GO:0000166), aminoacyl-tRNA ligase activity (GO:0004812), protein binding (GO:0005515), ligase activity (GO:0016874)

GO Cellular Component (3): cytoplasm (GO:0005737), mitochondrion (GO:0005739), mitochondrial matrix (GO:0005759)

Reactome top-level categories

3 top-level categories:

Category	Pathways
tRNA Aminoacylation	1
Translation	1
Metabolism of proteins	1

GO top-level categories

30 GO namespaces:

Category	Terms
tRNA metabolic process	2
translation	1
tRNA aminoacylation	1
tRNA aminoacylation for protein translation	1
RNA processing	1
peptidyltransferase activity	1
translational initiation	1
translational elongation	1
translational termination	1
macromolecule biosynthetic process	1
protein metabolic process	1
protein biosynthetic process	1
amino acid activation	1
RNA binding	1
aminoacyl-tRNA ligase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
anion binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
ligase activity, forming carbon-oxygen bonds	1
catalytic activity, acting on a tRNA	1
binding	1
catalytic activity	1
intracellular anatomical structure	1
cellular anatomical structure	1
cytoplasm	1
intracellular membrane-bounded organelle	1
mitochondrion	1
intracellular organelle lumen	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 5 of 15 annotations. The rest are phylogenetic / computational / electronic (IEA).

5 experimentally-supported GO terms:

GO term	NS	Evidence
phenylalanyl-tRNA aminoacylation	BP	direct assay
tRNA processing	BP	direct assay
mitochondrion	CC	high-throughput
phenylalanine-tRNA ligase activity	MF	direct assay
tRNA binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 1,452 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
FARS2	DARS2	Q6PI48	813
FARS2	RARS2	Q5T160	804
FARS2	NARS2	Q96I59	787
FARS2	EARS2	Q5JPH6	786
FARS2	PARS2	Q7L3T8	761
FARS2	AARS2	Q5JTZ9	753
FARS2	YARS2	Q9Y2Z4	751
FARS2	MARS2	Q96GW9	747
FARS2	LARS2	Q15031	732
FARS2	IARS2	Q9NSE4	713
FARS2	AARS1	P49588	696
FARS2	VARS1	P26640	686
FARS2	CARS2	Q9HA77	685
FARS2	FARSB	Q9NSD9	684
FARS2	WARS2	Q9UGM6	671

IntAct

Human interaction partners of FARS2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 74 partners by confidence:

Partner	Interaction type	MIscore	Records
APPL1	physical association	0.780	9
CALCOCO2	physical association	0.780	7
IKZF3	physical association	0.720	6
KRT40	physical association	0.720	6
KRTAP10-7	physical association	0.720	6
KRTAP10-9	physical association	0.720	6
MID2	physical association	0.720	6
RCBTB2	physical association	0.720	6
BANP	physical association	0.600	4
AGTRAP	physical association	0.560	6
CMTM5	physical association	0.560	6
ADAMTSL4	physical association	0.560	3
AJUBA	physical association	0.560	3
AP1B1	physical association	0.560	3
BACH2	physical association	0.560	3
BAG4	physical association	0.560	3
BEX5	physical association	0.560	3
CBY2	physical association	0.560	3
CCDC152	physical association	0.560	3
CDCA4	physical association	0.560	3
CYSRT1	physical association	0.560	3
DGAT2L6	physical association	0.560	3
DPH2	physical association	0.560	3
DVL3	physical association	0.560	3
FHL5	physical association	0.560	3
FKBP7	physical association	0.560	3
FSD2	physical association	0.560	3
GRB10	physical association	0.560	3
HIGD1C	physical association	0.560	3
HMBOX1	physical association	0.560	3

BioGRID (168 interactions; top human partners by supporting records): GAMT (Affinity Capture-MS; 3 records), HIST1H1A (Affinity Capture-MS; 3 records), HNRNPA1 (Affinity Capture-MS; 3 records), AGTRAP (Two-hybrid; 2 records), APPL1 (Two-hybrid; 2 records), CALCOCO2 (Two-hybrid; 2 records), CMTM5 (Two-hybrid; 2 records), CUL3 (Affinity Capture-MS; 2 records), HIST1H1E (Affinity Capture-MS; 2 records), HIST1H1T (Affinity Capture-MS; 2 records), IKZF3 (Two-hybrid; 2 records), KRT40 (Two-hybrid; 2 records), KRTAP10-7 (Two-hybrid; 2 records), KRTAP10-9 (Two-hybrid; 2 records), MID2 (Two-hybrid; 2 records)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
QRICH1	“up-regulates quantity by expression”	FARS2	“transcriptional regulation”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 74 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Keratinization	10	13.6×	3e-07

Disease & clinical

Genetic variants

Variant evidence for FARS2: 651 ClinVar records (80 pathogenic / likely pathogenic); 7 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

651 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	52
Likely pathogenic	28
Uncertain significance	293
Likely benign	181
Benign	47

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 80 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
39824	NM_006567.5(FARS2):c.431A>G (p.Tyr144Cys)	Pathogenic	criteria provided, multiple submitters, no conflicts	10
389162	NM_006567.5(FARS2):c.646C>T (p.Gln216Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	3
522083	NM_006567.5(FARS2):c.801C>G (p.Tyr267Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
253159	NM_006567.5(FARS2):c.424G>T (p.Asp142Tyr)	Pathogenic	criteria provided, single submitter	3
540540	NM_006567.5(FARS2):c.1109_1111delinsAACCAGAATGAA (p.Trp370_Leu371delinsTer)	Pathogenic	criteria provided, single submitter	1
652282	NM_006567.5(FARS2):c.261G>A (p.Trp87Ter)	Pathogenic	criteria provided, single submitter	1
654274	NM_006567.5(FARS2):c.812del (p.Thr271fs)	Pathogenic	criteria provided, single submitter	1
966064	NM_006567.5(FARS2):c.886C>T (p.Gln296Ter)	Pathogenic	criteria provided, single submitter	1
1351885	NM_006567.5(FARS2):c.999G>A (p.Trp333Ter)	Pathogenic	criteria provided, single submitter	1
1375428	NM_006567.5(FARS2):c.425del (p.Asp142fs)	Pathogenic	criteria provided, single submitter	1
1452947	NM_006567.5(FARS2):c.694del (p.Thr232fs)	Pathogenic	criteria provided, single submitter	1
1455928	NM_006567.5(FARS2):c.877del (p.Gly292_Val293insTer)	Pathogenic	criteria provided, single submitter	1
1946683	NM_006567.5(FARS2):c.929G>A (p.Trp310Ter)	Pathogenic	criteria provided, single submitter	1
2092976	NM_006567.5(FARS2):c.497dup (p.Leu168fs)	Pathogenic	criteria provided, single submitter	1
2134155	NM_006567.5(FARS2):c.1110G>A (p.Trp370Ter)	Pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore FARS2’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 34 predictions of 2,439):

Position(s)	Effect	Δscore	Sites
6:5368548–5368549	acceptor_loss	1.0000	6
6:5369183–5369184	donor_loss	1.0000	3
6:5404540–5404541	acceptor_loss	1.0000	6
6:5431027	acceptor_gain	1.0000
6:5431032	acceptor_gain	1.0000
6:5545341–5545342	donor_loss	1.0000	5
6:5613158	acceptor_gain	1.0000
6:5613163	acceptor_gain	1.0000
6:5613167–5613168	acceptor_loss	1.0000	6
6:5613321–5613322	donor_loss	1.0000	4

AlphaMissense

920 missense substitutions predicted likely pathogenic (of 2,992 scored), across 232 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
F191	8	0.957	0.991
F268	8	0.956	0.992
F270	8	0.948	0.996
D181	8	0.935	0.975
H192	8	0.932	0.991
F369	8	0.927	0.989
F343	8	0.923	0.992
H155	8	0.920	0.973
H187	8	0.911	0.978
D400	8	0.895	0.967
D366	8	0.893	0.943
S411	8	0.893	0.991
N125	8	0.889	0.992
F332	8	0.879	0.967
F171	8	0.876	0.985
H135	8	0.869	0.965
H159	8	0.863	0.942
D176	8	0.862	0.952
F126	7	0.964	0.992
W263	7	0.964	0.994

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	1.38e-07
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	0.000698

Disease associations

OMIM: gene MIM:611592 | disease phenotypes: MIM:614946, MIM:617046, MIM:256000, MIM:104200

GenCC curated gene-disease

4 curated gene-disease records:

Disease	Classification	Inheritance	Records
metabolic disease	Definitive	Autosomal recessive
combined oxidative phosphorylation defect type 14	Strong	Autosomal recessive	3
hereditary spastic paraplegia 77	Strong	Autosomal recessive	3
mitochondrial oxidative phosphorylation disorder	Strong	Autosomal recessive

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

2 validity classifications:

Disease	Classification	Inheritance
Leigh syndrome	Moderate	AR
mitochondrial disease	Definitive	AR

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (15 panels, 13 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

15 panels:

Panel	Rating
DDG2P	green
Early onset or syndromic epilepsy	green
Hereditary spastic paraplegia	green
Hereditary spastic paraplegia, childhood onset	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Likely inborn error of metabolism	green
Mitochondrial disorders	green
Paediatric disorders	green
Possible mitochondrial disorder, nuclear genes	green
Undiagnosed metabolic disorders	green
Unexplained death in infancy and sudden unexplained death in childhood	green
Adult-onset neurological disorders	amber
Hereditary spastic paraplegia, adult onset	amber

Mondo (7): combined oxidative phosphorylation defect type 14 (MONDO:0013986), hereditary spastic paraplegia 77 (MONDO:0014882), Leigh syndrome (MONDO:0009723), mitochondrial encephalomyopathy (MONDO:0004675), autosomal dominant Alport syndrome (MONDO:0007086), mitochondrial oxidative phosphorylation disorder (MONDO:0016387), metabolic disease (MONDO:0005066)

Orphanet (5): Combined oxidative phosphorylation defect type 14 (Orphanet:319519), Autosomal recessive spastic paraplegia type 77 (Orphanet:466722), Leigh syndrome (Orphanet:506), Alport syndrome (Orphanet:63), Autosomal dominant Alport syndrome (Orphanet:88918)

HPO phenotypes

showing 60 of 75 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000011	Neurogenic bladder
HP:0000020	Urinary incontinence
HP:0000252	Microcephaly
HP:0000278	Retrognathia
HP:0000365	Hearing impairment
HP:0000486	Strabismus
HP:0000505	Visual impairment
HP:0000508	Ptosis
HP:0000675	Macrodontia of permanent maxillary central incisor
HP:0001250	Seizure
HP:0001252	Hypotonia
HP:0001258	Spastic paraplegia
HP:0001260	Dysarthria
HP:0001263	Global developmental delay
HP:0001272	Cerebellar atrophy
HP:0001332	Dystonia
HP:0001336	Myoclonus
HP:0001344	Absent speech
HP:0001385	Hip dysplasia
HP:0001510	Growth delay
HP:0001522	Death in infancy
HP:0001873	Thrombocytopenia
HP:0001903	Anemia
HP:0002059	Cerebral atrophy
HP:0002061	Lower limb spasticity
HP:0002067	Bradykinesia
HP:0002068	Neuromuscular dysphagia
HP:0002080	Intention tremor
HP:0002119	Ventriculomegaly
HP:0002120	Cerebral cortical atrophy
HP:0002151	Increased circulating lactate concentration
HP:0002171	Gliosis
HP:0002268	Paroxysmal dystonia
HP:0002353	EEG abnormality
HP:0002376	Developmental regression
HP:0002395	Lower limb hyperreflexia
HP:0002421	Poor head control
HP:0002490	Increased CSF lactate
HP:0002505	Loss of ambulation
HP:0002506	Diffuse cerebral atrophy
HP:0002751	Kyphoscoliosis
HP:0002882	Sudden episodic apnea
HP:0003128	Lactic acidosis
HP:0003355	Aminoaciduria
HP:0003484	Upper limb muscle weakness
HP:0003487	Babinski sign
HP:0003596	Middle age onset
HP:0003623	Neonatal onset
HP:0003677	Slowly progressive
HP:0003800	Muscle abnormality related to mitochondrial dysfunction
HP:0003819	Death in childhood
HP:0005216	Impaired mastication
HP:0006568	Increased hepatic glycogen content
HP:0006999	Basal ganglia gliosis
HP:0007020	Progressive spastic paraplegia
HP:0007210	Lower limb amyotrophy
HP:0007340	Lower limb muscle weakness
HP:0007366	Atrophy/Degeneration affecting the brainstem
HP:0008110	Equinovarus deformity

GWAS associations

7 associations:

Study	Trait	p-value
GCST005577_3	Change in glucose in response to thiazide diuretic treatment in hypertension	2e-7
GCST004032_5	JT interval (sulfonylurea treatment interaction)	4e-7
GCST001957_17	Obesity (early onset extreme)	5e-7
GCST002938_11	Copper levels	9e-7
GCST009391_626	Metabolite levels	4e-6
GCST008163_624	Height	7e-6
GCST009277_8	Subjective response to placebo treatment in childhood asthma (change in cough/wheeze)	8e-6

EFO canonical traits (from GWAS)

6 canonical traits:

EFO ID	Trait name
EFO:0007885	JT interval
EFO:0007922	response to sulfonylurea
EFO:0004468	glucose measurement
EFO:0008344	response to placebo
EFO:0010068	respiratory symptom change measurement
EFO:0010502	indoxyl sulfate measurement

MeSH disease descriptors

3 disease descriptors:

Descriptor	Name	Tree numbers
D007888	Leigh Disease	C10.228.140.163.100.412; C16.320.565.189.412; C16.320.565.202.810.444; C18.452.132.100.412; C18.452.648.189.412; C18.452.648.202.810.444; C18.452.660.520
D008659	Metabolic Diseases	C18.452
D017237	Mitochondrial Encephalomyopathies	C05.651.460.620; C10.228.140.163.540; C10.668.491.500.500; C18.452.132.540; C18.452.660.560.620

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2511 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

6 measured of 6 human assays (21 total across all organisms); most potent 6 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
13N-(3,4-dichlorophenyl)-2-hydroxy-11-oxo-14-phenyl-(1S,2S,9S,12S,13R,14R)-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3(8),4,6-triene-13-carboxamide	IC50	170 nM
13N-(3,4-dichlorophenyl)-2-hydroxy-11-oxo-14-phenyl-(1S,2R,9S,12S,13R,14R)-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3(8),4,6-triene-13-carboxamide	IC50	470 nM
5-(3,4-dichlorophenyl)-3-phenyl-(3R,3aR,6aS)-spiro[perhydrofuro[3,4-c]pyrrole-1,2’-(2’,3’-dihydro-1’H-indene)]-1’,3’,4,6-tetraone	IC50	2000 nM
13N-(3,4-dichlorophenyl)-2,11-dioxo-14-phenyl-(1R,9S,12S,13R,14R)-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3(8),4,6-triene-13-carboxamide	IC50	2600 nM
4-(3,4-dichlorophenylcarbamoyl)-1’,3’-dioxo-5-phenylspiro[tetrahydrofuran-2,2’-(2’,3’-dihydro-1’H-indene)]-3-carboxylic acid	IC50	11000 nM
13N-(3,4-dichlorophenyl)-2-hydroxy-11-oxo-14-phenyl-(1S,12R,13S,14R)-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3(8),4,6-triene-13-carboxamide	IC50	14000 nM

ChEMBL bioactivities

9 potent at pChembl≥5 of 13 total, top 9 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.77	IC50	170	nM	CHEMBL281860
6.58	IC50	260	nM	CHEMBL281860
6.33	IC50	470	nM	CHEMBL284654
6.29	IC50	510	nM	CHEMBL284654
5.70	IC50	2000	nM	CHEMBL27258
5.58	IC50	2600	nM	CHEMBL283182
5.51	IC50	3100	nM	CHEMBL283182
5.31	IC50	4900	nM	CHEMBL25737
5.30	IC50	5000	nM	CHEMBL27258

PubChem BioAssay actives

9 with measured affinity, of 35 total; 5 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(1S,2S,9S,12S,13R,14R)-N-(3,4-dichlorophenyl)-2-hydroxy-11-oxo-14-phenyl-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3,5,7-triene-13-carboxamide	157612: Compound was evaluated for the inhibitory activity against Escherichia coli phenylalanyl-tRNA synthetase	ic50	0.1700	uM
(1S,2R,9S,12S,13R,14R)-N-(3,4-dichlorophenyl)-2-hydroxy-11-oxo-14-phenyl-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3,5,7-triene-13-carboxamide	157612: Compound was evaluated for the inhibitory activity against Escherichia coli phenylalanyl-tRNA synthetase	ic50	0.4700	uM
(1R,3aS,6aR)-5-(3,4-dichlorophenyl)-1-phenylspiro[3a,6a-dihydro-1H-furo[3,4-c]pyrrole-3,2’-indene]-1’,3’,4,6-tetrone	157612: Compound was evaluated for the inhibitory activity against Escherichia coli phenylalanyl-tRNA synthetase	ic50	2.0000	uM
(1R,9S,12S,13R,14R)-N-(3,4-dichlorophenyl)-2,11-dioxo-14-phenyl-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3,5,7-triene-13-carboxamide	157613: Compound was evaluated for the inhibitory activity against Staphylococcus aureus phenylalanyl-tRNA synthetase	ic50	2.6000	uM
(1S,12R,13S,14R)-N-(3,4-dichlorophenyl)-2-hydroxy-11-oxo-14-phenyl-10,15-dioxatetracyclo[7.6.0.01,12.03,8]pentadeca-3,5,7-triene-13-carboxamide	157612: Compound was evaluated for the inhibitory activity against Escherichia coli phenylalanyl-tRNA synthetase	ic50	4.9000	uM

CTD chemical–gene interactions

35 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression	8
Valproic Acid	affects cotreatment, increases expression, decreases methylation	4
Aflatoxin B1	decreases expression, increases methylation, affects expression, affects methylation	4
bisphenol A	affects cotreatment, decreases methylation, decreases expression	2
Acetaminophen	affects cotreatment, decreases expression	2
Cisplatin	affects expression, decreases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	2
aristolochic acid I	increases expression, decreases expression	1
methyleugenol	decreases expression	1
2,5,2’,5’-tetrachlorobiphenyl	increases expression	1
sodium arsenite	decreases expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
aflatoxin B2	decreases methylation	1
nickel sulfate	increases expression	1
epigallocatechin gallate	decreases expression, affects cotreatment	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
teriflunomide	decreases expression	1
jinfukang	increases expression	1
(+)-JQ1 compound	decreases expression	1
Decitabine	affects expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Air Pollutants	affects expression, increases abundance	1
Atrazine	decreases expression	1
Benzene	decreases expression	1
Ethyl Methanesulfonate	decreases expression	1
Fluorouracil	decreases expression	1
Formaldehyde	decreases expression	1
Lipopolysaccharides	affects cotreatment, decreases expression	1

ChEMBL screening assays

3 unique, capped per target: 3 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL768844	Binding	Compound was evaluated for the inhibitory activity against Escherichia coli phenylalanyl-tRNA synthetase	A series of heterocyclic inhibitors of phenylalanyl-tRNA synthetases with antibacterial activity. — *Bioorg Med Chem Lett*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 600 trials:

NCT	Phase	Status	Title
NCT00192621	Phase 4	COMPLETED	Seronegatives and Metabolic Abnormalities Protocol 2 (SAMA002): Study to Compare the Effect of Kaletra and Combivir® in HIV-Negative Healthy Subjects
NCT01443806	Phase 4	COMPLETED	Characterisation of the Human Carboxylesterase 1 (CES1) Mutations in Thailand
NCT02645279	Phase 4	UNKNOWN	Comparison of Oral 30 % Dextrose and iv Midazolam Sedation During MRI in Neonates
NCT04653779	Phase 4	UNKNOWN	A Clinical Trial to Evaluate the Preference Regarding Convenience of Medication and Efficacy/Safety of SUGAMET®XR Tablet 5/1000mg
NCT05084079	Phase 4	UNKNOWN	Different Initial Insulin Dose Regimens on Time to Achieve Glycemic Targets and Treatment Safety in SIIT
NCT05855577	Phase 4	UNKNOWN	Motor Function Efficacy of Pharmacological Treatments Targeting Energy Metabolism, in Parkinson’s Patients
NCT06003153	Phase 4	RECRUITING	GLUCOSE-MGH: Genetic Links Understood Through Challenge With Oral Semaglutide Exposure at MGH
NCT06009653	Phase 4	WITHDRAWN	Effects of Tirzepatide Plus Intensive Lifestyle Therapy on Body Weight and Metabolic Health in Latinos With Obesity
NCT00000374	Phase 4	COMPLETED	Treatment for First-Episode Schizophrenia
NCT00001656	Phase 4	COMPLETED	Comparison of Clozapine vs Olanzapine in Childhood-Onset Psychotic Disorders
NCT00007774	Phase 4	COMPLETED	To Determine if Olanzapine is More Cost Effective Than Haloperidol for the Treatment of Schizophrenia
NCT00014001	Phase 4	COMPLETED	CATIE- Schizophrenia Trial
NCT00018668	Phase 4	COMPLETED	Antipsychotic Response in Schizophrenia
NCT00034801	Phase 4	COMPLETED	Olanzapine Versus Active Comparator in the Treatment of Depression in Patients With Schizophrenia
NCT00034905	Phase 4	COMPLETED	A Comparison of Seroquel vs. Risperidone in Schizophrenia
NCT00036088	Phase 4	COMPLETED	Olanzapine Versus An Active Comparator in the Treatment of Schizophrenia
NCT00044187	Phase 4	COMPLETED	The Assessment of a Weight-Gain Agent for the Treatment of Olanzapine-Associated Anti-Obesity Agent in Patients With Schizophrenia, Schizophreniform Disorder, Schizoaffective Disorder, and Bipolar I Disorder
NCT00044655	Phase 4	COMPLETED	Switching Medication to Treat Schizophrenia
NCT00048828	Phase 4	COMPLETED	Treating Drug-Resistant Childhood Schizophrenia
NCT00053703	Phase 4	COMPLETED	Treatment of Early Onset Schizophrenia Spectrum Disorders (TEOSS)
NCT00056498	Phase 4	COMPLETED	Risperidone Treatment in Schizophrenia Patients Who Are Currently Taking Clozapine
NCT00061802	Phase 4	COMPLETED	Efficacy and Safety of Two Atypical Antipsychotics vs. Placebo in Patients With an Acute Exacerbation of Either Schizophrenia or Schizoaffective Disorder
NCT00080327	Phase 4	COMPLETED	Study of Three Doses of Aripiprazole in Patients With Acute Schizophrenia
NCT00088049	Phase 4	COMPLETED	Study of Olanzapine vs. Aripiprazole in the Treatment of Schizophrenia
NCT00090012	Phase 4	COMPLETED	Comparison of Continuing Olanzapine to Switching to Quetiapine in Overweight or Obese Patients With Schizophrenia and Schizoaffective Disorder
NCT00100776	Phase 4	COMPLETED	Efficacy of High Dose Olanzapine for the Treatment of Schizophrenia and Schizoaffective Disorder
NCT00103571	Phase 4	COMPLETED	Olanzapine Versus Aripiprazole in the Treatment of Acutely Ill Patients With Schizophrenia
NCT00108368	Phase 4	COMPLETED	The Effects of Risperidone and Olanzapine on Thinking
NCT00114595	Phase 4	COMPLETED	Ethyl-Eicosapentaenoic Acid and Tardive Dyskinesia
NCT00130923	Phase 4	COMPLETED	Risperidone Long-acting Versus Oral Risperidone in Patients With Schizophrenia and Alcohol Use Disorder
NCT00137020	Phase 4	COMPLETED	Clinical Effect Of Cross Titration Of Antipsychotics With Ziprasidone In Schizophrenia Or Schizoaffective Disorder
NCT00140166	Phase 4	COMPLETED	Treatment of Acute Schizophrenia With Vitamin Therapy
NCT00145847	Phase 4	COMPLETED	Naltrexone Treatment of Alcohol Abuse in Schizophrenia
NCT00148564	Phase 4	COMPLETED	Energy Homeostasis Under Treatment With Atypical Antipsychotics
NCT00156715	Phase 4	COMPLETED	Efficacy of Quetiapine in the Treatment of Patients With Schizophrenia and a Comorbid Substance Use Disorder
NCT00158223	Phase 4	COMPLETED	Effectiveness of Pimozide in Augmenting the Effects of Clozapine in the Treatment of Schizophrenia
NCT00159081	Phase 4	COMPLETED	One Year Drug Treatment in First-Episode Schizophrenia
NCT00159120	Phase 4	COMPLETED	Maintenance Treatment vs. Stepwise Drug Discontinuation in First-Episode Schizophrenia
NCT00159133	Phase 4	COMPLETED	Prodrome-Based Early Intervention With Antipsychotics vs. Benzodiazepines in First-Episode Schizophrenia
NCT00159757	Phase 4	TERMINATED	12 Week Open, Non-Comparative Switch Study Of Oral Ziprazidone In Previously Treated Schizophrenic Patients
NCT00167817	Phase 4	COMPLETED	Effect of Switch to Aripiprazole on Health and Smoking Parameters in Patients With Schizophrenia: A Pilot Study
NCT00169026	Phase 4	TERMINATED	Alcoholism and Schizophrenia: Effects of Clozapine
NCT00169039	Phase 4	TERMINATED	Clozapine Versus Chlorpromazine for Treatment-Unresponsive Schizophrenia
NCT00169065	Phase 4	COMPLETED	Effectiveness of Clozapine Versus Olanzapine for Treatment-resistant Schizophrenia
NCT00169091	Phase 4	TERMINATED	Clozapine Versus Haloperidol for Treating the First Episode of Schizophrenia
NCT00176423	Phase 4	COMPLETED	Efficacy Study of Galantamine for Cognitive Impairments in Schizophrenia
NCT00176436	Phase 4	COMPLETED	Atomoxetine for Treatment of Weight Gain in Olanzapine or Clozapine Patients
NCT00177008	Phase 4	COMPLETED	Aripiprazole for the Treatment of Schizophrenia With Co-Morbid Social Anxiety
NCT00177580	Phase 4	COMPLETED	Improving Symptoms of Schizophrenia and Schizoaffective Disorder by Supplementing Medications With Pravastatin
NCT00182442	Phase 4	COMPLETED	Cognition, Functioning and Quality of Life
NCT00182494	Phase 4	UNKNOWN	Diabetes Prevention Program in Schizophrenia [DPPS]
NCT00183625	Phase 4	COMPLETED	Supported Employment and Skills Training in Conjunction With Pharmacotherapy in Schizophrenia Patients
NCT00186771	Phase 4	UNKNOWN	Magnetic Stimulation as a Treatment for Auditory Hallucinations in Schizophrenia
NCT00190749	Phase 4	COMPLETED	Safety Study of Olanzapine and a Comparator in Patients With Schizophrenia and Schizoaffective Disorder
NCT00191555	Phase 4	COMPLETED	Efficacy Study of Switching Stabilized Schizophrenic Patients From Conventional to Atypical Antipsychotic Treatment
NCT00194025	Phase 4	COMPLETED	Valproate in Late Life Schizophrenia
NCT00199940	Phase 4	COMPLETED	Safety And Efficacy Study Of Ziprasidone In Pediatric Psychotic Illness
NCT00202306	Phase 4	COMPLETED	Indicated Prevention of Psychotic Disorders With Low-dose Lithium
NCT00203788	Phase 4	COMPLETED	Improving Work Outcome in People With Recent-onset Schizophrenia
NCT00204061	Phase 4	COMPLETED	Early Pharmacological and Psychological Intervention for Late Prodromal States of Psychosis

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for FARS2 across ~30M SureChEMBL compounds — explore on Sugi Predict.