FCN2

Summary

FCN2 (ficolin 2, HGNC:3624) is a protein-coding gene on chromosome 9q34.3, encoding Ficolin-2 (Q15485). Calcium-dependent lectin, which acts as a pattern recognition receptor that initiates the lectin pathway of the complement system, a cascade of proteins that leads to phagocytosis and breakdown of pathogens and signaling that strengthens the adaptive immune system.

The product of this gene belongs to the ficolin family of proteins. This family is characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. This gene is predominantly expressed in the liver, and has been shown to have carbohydrate binding and opsonic activities. Alternatively spliced transcript variants encoding different isoforms have been identified.

Source: NCBI Gene 2220 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 65 total — 1 likely-pathogenic
• MANE Select transcript: NM_004108

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3624
Approved symbol	FCN2
Name	ficolin 2
Location	9q34.3
Locus type	gene with protein product
Status	Approved
Aliases	P35, FCNL, EBP-37, ficolin-2
Ensembl gene	ENSG00000160339
Ensembl biotype	protein_coding
OMIM	601624
Entrez	2220

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 7 protein_coding

ENST00000291744, ENST00000350339, ENST00000855732, ENST00000855733, ENST00000855734, ENST00000855735, ENST00000967320

RefSeq mRNA: 2 — MANE Select: NM_004108 NM_004108, NM_015837

CCDS: CCDS6983

Canonical transcript exons

ENST00000291744 — 8 exons

Exon	Start	End
ENSE00001051599	134883302	134883355
ENSE00001051605	134882526	134882639
ENSE00001247525	134884740	134884772
ENSE00002382498	134886430	134886564
ENSE00002403883	134885768	134885897
ENSE00002413185	134885239	134885366
ENSE00003844765	134887168	134887523
ENSE00003849971	134880810	134880921

Expression profiles

Bgee: expression breadth ubiquitous, 129 present calls, max score 92.66.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.3529 / max 332.5375, expressed in 12 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
99399	0.3529	12

Top tissues by expression

280 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right lobe of liver	UBERON:0001114	92.66	gold quality
liver	UBERON:0002107	92.61	gold quality
right adrenal gland cortex	UBERON:0035827	90.16	gold quality
right adrenal gland	UBERON:0001233	88.81	gold quality
left adrenal gland cortex	UBERON:0035825	87.74	gold quality
left adrenal gland	UBERON:0001234	87.17	gold quality
adrenal cortex	UBERON:0001235	87.10	gold quality
adrenal gland	UBERON:0002369	83.84	gold quality
endometrium epithelium	UBERON:0004811	76.56	gold quality
adrenal tissue	UBERON:0018303	73.72	gold quality
frontal pole	UBERON:0002795	73.13	gold quality
paraflocculus	UBERON:0005351	72.85	gold quality
middle frontal gyrus	UBERON:0002702	72.57	gold quality
spleen	UBERON:0002106	69.97	gold quality
Brodmann (1909) area 10	UBERON:0013541	68.99	gold quality
pituitary gland	UBERON:0000007	66.81	gold quality
triceps brachii	UBERON:0001509	65.73	gold quality
buccal mucosa cell	CL:0002336	65.11	gold quality
omental fat pad	UBERON:0010414	65.01	gold quality
peritoneum	UBERON:0002358	64.95	gold quality
adipose tissue of abdominal region	UBERON:0007808	64.77	gold quality
subcutaneous adipose tissue	UBERON:0002190	64.47	gold quality
adipose tissue	UBERON:0001013	64.32	gold quality
gluteal muscle	UBERON:0002000	63.73	gold quality
prostate gland	UBERON:0002367	63.64	gold quality
connective tissue	UBERON:0002384	63.23	gold quality
right lobe of thyroid gland	UBERON:0001119	62.08	gold quality
adult mammalian kidney	UBERON:0000082	61.91	gold quality
oocyte	CL:0000023	61.85	gold quality
adenohypophysis	UBERON:0002196	61.58	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-MTAB-8495	yes	7098.91
E-MTAB-10553	yes	3231.60
E-HCAD-9	yes	3209.88
E-CURD-122	yes	2811.28
E-ANND-3	no	0.93

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 40)

• The interaction of L-ficolin/p35 with the full-length mannan-binding lectin (MBL)-associated serine proteases (MASP-1 and -2), N-terminal complement modules and MBL-associated protein 19 has been characterized using surface plasmon resonance spectroscopy. (PMID:12421953)
• L-ficolin-lipoteichoic acid interaction initiates an innate anti-microbial immune response by triggering the lectin pathway of complement activation. (PMID:14707097)
• examined the selectivity of L-ficolin through inhibiting the binding to bacteria or to beads coupled with N-acetylglucosamine (PMID:15331601)
• Two conserved coding SNPs were found in exon 8, leading to amino acid substitutions within the fibrinogen-like domain. (PMID:16076493)
• Ficolins, a kind of pattern-recognition molecule for pathogens in the innate immunity system were examined crystallographically. (PMID:16820685)
• The significant differences in allele frequencies of FCN2 gene SNPs in the promoter lesions among HLA-B51 positive BD patients may reveal the possibility that ficolin may contribute to the innate immunity of BD among HLA-B51 haplotypes in BD patients. (PMID:16839748)
• The X-ray structures of l-ficolin trimeric recognition domains, alone and in complex with various ligands, have been solved. (PMID:17215869)
• Although the five FCN2 polymorphisms were each present in the UK Caucasian population studied, no significant associations were observed between the FCN2 polymorphisms and susceptibility to pneumococcal disease. (PMID:17382393)
• inter-individual variation of Ficolin-2 concentration is associated with polymorphisms in the promoter and the structural part of the FCN2 gene (PMID:17386030)
• in children with recurrent infections,low l-ficolin levels were associated with variant alleles for ss32469536 & rs7851696 & normal alleles for ss32469537 & ss32469544; high l-ficolin levels were associated with variant alleles of ss32469537 & ss32469544 (PMID:17680820)
• Few glycans bound L-ficolin above background level but clear structural requirements were discovered (PMID:18486240)
• l-ficolin participates in host defence during the perinatal period and constitute the first evidence that relative l-ficolin deficiency may contribute to the adverse consequences of prematurity. Some similar trends were found with facets of MBL deficiency (PMID:18950864)
• H-ficolin residue lysine47 is a key component of the interaction with both mannan-binding lectin (MBL)-associated serine proteases and calreticulin, providing a strong indication that MBL and ficolins share homologous binding sites for their partners. (PMID:19109177)
• Distribution of functional FCN2 haplotypes amongpatients is significant different from that among the control subjects. (PMID:19434912)
• These results demonstrate that PTX3 and Ficolin-2 may recruit each other on pathogens. (PMID:19632990)
• increased serum levels in patients with hepatitis C virus (PMID:19728924)
• L-ficolin may confer some protection from microorganisms that exacerbate allergic inflammation in the lung and its relative deficiency may contribute to enhanced susceptibility to respiratory infections. (PMID:19767106)
• Donor and recipient gene polymorphisms in the lectin complement pathway (MBL2, FCN2, MASP2) are major determinants of the risk of clinically significant bacterial infection and mortality after orthotopic liver transplantation. (PMID:20593422)
• FCN2 polymorphisms in patients on peritoneal dialysis is associated with staphylococcal peritonitis. (PMID:20682603)
• No FCN2 promoter haplotypes were significantly distributed between mild and severe malaria cases (PMID:20937340)
• deposited in skin lesions of pemphigus (PMID:21327568)
• MBL2 and FCN2 risk alleles of donor liver and recipient constitute independent risk factors for cytomegalovirus infection after orthotopic liver transplantation. (PMID:21334396)
• Cord blood MBL concentrations were significantly lower in intrauterine-growth-restriction (IUGR) cases than controls. No differences in H- and L-ficolin concentrations were observed between groups. (PMID:22082351)
• The very first study on Vietnamese cohort associates both Ficolin-2 serum levels and FCN2 haplotypes to hepatitis B virus infection and subsequent disease progression. (PMID:22140517)
• Data show no association of donor and recipient MBL2 and MASP2 genotype with allograft outcome, and analysis of SNPs and haplotypes in the FCN2 gene of the donor and recipient did not reveal an association with transplant outcome. (PMID:22173059)
• The association between L-ficolin and thrombocytopenia suggests a pathogenic role for L-ficolin in thrombocytopenia in systemic lupus erythematosus. (PMID:22350641)
• results provide a basis for a future study that could confirm or disprove possible relationships between FCN2 gene polymorphisms with cutaneous leishmaniasis (PMID:22457818)
• The genotype distribution of three functional SNP variants (-986 G > A, -602 G > A and -4A > G) of ficolin 2 differed significantly between the white, black, and Asian groups. The SNP variants were highly linked to each other. (PMID:22594803)
• The purpose of this study was to determine whether circulating levels of ficolin-2 and ficolin-3 are altered in normal pregnancy and pre-eclampsia. (PMID:22670778)
• These findings demonstrate that FCN2 promoter variants (-986G>A and -4A>G) influence ficolin-2 serum levels and susceptibility to schistosomiasis. (PMID:22693230)
• Ficolin-2 Ala258Ser polymorphism in the donor independently predicts improved graft outcome. (PMID:22892990)
• Our findings suggest that early increased ficolin-2 is highly correlated with hepatic inflammation and rapid viral response. (PMID:23298162)
• the expected positive association of complement genes with leprosy susceptibility and clinical outcomes in Han Chinese. (PMID:23423485)
• Variant FCN2 gene alleles of -64 and +6424 (in strong linkage disequlibrium) are known to be associated with low L-ficolin level or activity. (PMID:23525825)
• Patients with chronic Chagas disease presented with decreased L-ficolin plasma levels that were associated with the 258S polymorphism. (PMID:23593180)
• this study reports for thefirst time the relationship between full FCN2 genotypes and serumprotein concentrations and discuss the relevance of these findings fordisease association studies (PMID:23619474)
• Data indicate that in contrast to serum level, the expression of Ficolin-2 (FCN2) was significantly lower in ovarian cancer (OC). (PMID:23744477)
• Data indicate that Ficolin-2 blood concentration dependents on sampling procedures. (PMID:23911396)
• Ficolin-2 defends against virulent Mycobacteria tuberculosis infection in vivo, and its insufficiency is associated with infection in humans. (PMID:24040095)
• bloodstream infections collected prospectively were associated with MBL2 and FCN2 genotypic variants over the first year after kidney transplantation (PMID:24182802)

Cross-species orthologs

0 orthologs

Paralogs (25): TNC (ENSG00000041982), FCN1 (ENSG00000085265), ANGPT2 (ENSG00000091879), ANGPT4 (ENSG00000101280), FGL1 (ENSG00000104760), FN1 (ENSG00000115414), TNR (ENSG00000116147), ANGPTL1 (ENSG00000116194), TNN (ENSG00000120332), FGL2 (ENSG00000127951), FIBCD1 (ENSG00000130720), ANGPTL6 (ENSG00000130812), ANGPTL3 (ENSG00000132855), ANGPTL2 (ENSG00000136859), FCN3 (ENSG00000142748), FNDC7 (ENSG00000143107), ANGPT1 (ENSG00000154188), MFAP4 (ENSG00000166482), ANGPTL4 (ENSG00000167772), TNXB (ENSG00000168477), FGG (ENSG00000171557), FGA (ENSG00000171560), FGB (ENSG00000171564), ANGPTL7 (ENSG00000171819), ANGPTL5 (ENSG00000187151)

Protein

Protein identifiers

Ficolin-2 — Q15485 (reviewed: Q15485)

Alternative names: 37 kDa elastin-binding protein, Collagen/fibrinogen domain-containing protein 2, Ficolin-B, Ficolin-beta, Hucolin, L-ficolin, Serum lectin p35

All UniProt accessions (1): Q15485

UniProt curated annotations — full annotation on UniProt →

Function. Calcium-dependent lectin, which acts as a pattern recognition receptor that initiates the lectin pathway of the complement system, a cascade of proteins that leads to phagocytosis and breakdown of pathogens and signaling that strengthens the adaptive immune system. Specifically recognizes and binds carbohydrates on the pathogen surface, activating the MASP1 serine protease and initiating the proteolytic cascade of the lectin complement pathway. Specifically binds N-Acetylglucosamine (GlcNAc), as well as phosphocholine and lipoteichoic acid moieties on the surface of pathogens. Enhances phagocytosis of S.typhimurium by neutrophils, suggesting an opsonic effect.

Subunit / interactions. Homotrimer. Interacts with elastin. Interacts with MASP1 and MASP2. Interacts with CR1.

Subcellular location. Secreted. Cell surface.

Tissue specificity. Expressed by the liver and secreted in plasma.

Domain organisation. The fibrinogen-like domain (FBG) contains calcium-binding sites that may be involved in carbohydrate binding.

Similarity. Belongs to the ficolin lectin family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q15485-1	1	yes
Q15485-2	2

RefSeq proteins (2): NP_004099, NP_056652 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002181	Fibrinogen_a/b/g_C_dom	Domain
IPR008160	Collagen	Repeat
IPR014716	Fibrinogen_a/b/g_C_1	Homologous_superfamily
IPR020837	Fibrinogen_CS	Conserved_site
IPR036056	Fibrinogen-like_C	Homologous_superfamily
IPR050373	Fibrinogen_C-term_domain	Family

Pfam: PF00147, PF01391

UniProt features (57 total): strand 21, helix 6, binding site 5, sequence variant 5, modified residue 3, disulfide bond 3, turn 3, glycosylation site 2, domain 2, sequence conflict 2, signal peptide 1, chain 1, splice variant 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

13 structures.

PDB	Method	Resolution (Å)
2J1G	X-RAY DIFFRACTION	1.95
4R9J	X-RAY DIFFRACTION	2.1
2J3U	X-RAY DIFFRACTION	2.15
4NYT	X-RAY DIFFRACTION	2.25
4R9T	X-RAY DIFFRACTION	2.25
2J0Y	X-RAY DIFFRACTION	2.35
2J3G	X-RAY DIFFRACTION	2.5
2J3O	X-RAY DIFFRACTION	2.65
2J61	X-RAY DIFFRACTION	2.7
2J2P	X-RAY DIFFRACTION	2.8
2J3F	X-RAY DIFFRACTION	2.8
2J0G	X-RAY DIFFRACTION	2.85
2J0H	X-RAY DIFFRACTION	2.85

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15485-F1	86.33	0.71

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (5): 255; 241–242; 249; 251; 253

Post-translational modifications (3): 77, 80, 86

Disulfide bonds (3): 98–126, 105–133, 257–270

Glycosylation sites (2): 240, 300

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-166662	Lectin pathway of complement activation
R-HSA-166663	Initial triggering of complement
R-HSA-2855086	Ficolins bind to repetitive carbohydrate structures on the target cell surface

MSigDB gene sets: 122 (showing top): REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_POSITIVE_REGULATION_OF_ENDOCYTOSIS, GOCC_COLLAGEN_TRIMER, REACTOME_CREATION_OF_C4_AND_C2_ACTIVATORS, GOCC_CELL_SURFACE, GOBP_APOPTOTIC_CELL_CLEARANCE, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_REGULATION_OF_VESICLE_MEDIATED_TRANSPORT, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_REGULATION_OF_IMMUNE_RESPONSE, MODULE_75, GOBP_COMPLEMENT_ACTIVATION, GOBP_DEFENSE_RESPONSE_TO_OTHER_ORGANISM, MODULE_379, HSIAO_LIVER_SPECIFIC_GENES

GO Biological Process (15): complement activation, lectin pathway (GO:0001867), cell surface pattern recognition receptor signaling pathway (GO:0002752), proteolysis (GO:0006508), opsonization (GO:0008228), recognition of apoptotic cell (GO:0043654), defense response to Gram-negative bacterium (GO:0050829), defense response to Gram-positive bacterium (GO:0050830), positive regulation of opsonization (GO:1903028), activation of membrane attack complex (GO:0001905), immune system process (GO:0002376), complement activation (GO:0006956), zymogen activation (GO:0031638), killing of cells of another organism (GO:0031640), innate immune response (GO:0045087), protein maturation (GO:0051604)

GO Molecular Function (11): antigen binding (GO:0003823), signaling receptor binding (GO:0005102), pattern recognition receptor activity (GO:0038187), proteoglycan binding (GO:0043394), metal ion binding (GO:0046872), calcium-dependent protein binding (GO:0048306), lipoteichoic acid immune receptor activity (GO:0070892), carbohydrate derivative binding (GO:0097367), mannan binding (GO:2001065), protein binding (GO:0005515), carbohydrate binding (GO:0030246)

GO Cellular Component (8): extracellular region (GO:0005576), collagen trimer (GO:0005581), obsolete extracellular space (GO:0005615), external side of plasma membrane (GO:0009897), extracellular exosome (GO:0070062), blood microparticle (GO:0072562), symbiont cell surface (GO:0106139), serine-type endopeptidase complex (GO:1905370)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Creation of C4 and C2 activators	1
Complement cascade	1
Lectin pathway of complement activation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	4
protein binding	3
complement activation	2
protein metabolic process	2
immune effector process	2
phagocytosis, recognition	2
defense response to bacterium	2
cellular anatomical structure	2
innate immune response	1
innate immune response activating cell surface receptor signaling pathway	1
pattern recognition receptor signaling pathway	1
apoptotic cell clearance	1
positive regulation of immune effector process	1
opsonization	1
positive regulation of phagocytosis	1
regulation of opsonization	1
biological_process	1
activation of immune response	1
humoral immune response	1
protein activation cascade	1
protein processing	1
cell killing	1
disruption of cell in another organism	1
immune response	1
defense response to symbiont	1
gene expression	1
signaling receptor activity	1
carbohydrate derivative binding	1
cation binding	1
calcium ion binding	1
pattern recognition receptor activity	1
lipoteichoic acid binding	1
polysaccharide binding	1
protein-containing complex	1
plasma membrane	1
cell surface	1
side of membrane	1
extracellular vesicle	1
extracellular region	1
other organism part	1

Protein interactions and networks

STRING

796 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
FCN2	F8W876	F8W876	998
FCN2	MBL2	P11226	994
FCN2	MASP2	O00187	989
FCN2	CALR	P27797	888
FCN2	PTX3	P26022	885
FCN2	COLEC10	Q9Y6Z7	883
FCN2	KIR3DL1	P43629	802
FCN2	FCN3	O75636	766
FCN2	CRP	P02741	745
FCN2	ELN	P15502	739
FCN2	C1S	P09871	737
FCN2	C1R	P00736	724
FCN2	COLEC11	Q9BWP8	711
FCN2	C3	P01024	705
FCN2	SERPING1	P05155	663

IntAct

53 interactions, top by confidence:

A	B	Type	Score
PTX3	CFH	psi-mi:“MI:0914”(association)	0.820
PTX3	FCN2	psi-mi:“MI:0407”(direct interaction)	0.710
PTX3	FCN2	psi-mi:“MI:0914”(association)	0.710
FCN2	FCN3	psi-mi:“MI:0915”(physical association)	0.700
FCN3	FCN2	psi-mi:“MI:0915”(physical association)	0.700
fbpB	FCN2	psi-mi:“MI:0407”(direct interaction)	0.620
CR1	MASP1	psi-mi:“MI:0407”(direct interaction)	0.620
MASP1	FCN2	psi-mi:“MI:0407”(direct interaction)	0.560
FCN2	LRP1	psi-mi:“MI:0407”(direct interaction)	0.560
LRP1	FCN2	psi-mi:“MI:0407”(direct interaction)	0.560
FCN1	POTEF	psi-mi:“MI:0914”(association)	0.530
	FCN2	psi-mi:“MI:0407”(direct interaction)	0.440

BioGRID (8): FCN2 (Affinity Capture-MS), FCN2 (Affinity Capture-MS), FCN2 (Affinity Capture-MS), FCN2 (Reconstituted Complex), FCN2 (Reconstituted Complex), FCN2 (Co-fractionation), FCN2 (Co-fractionation), FCN2 (Co-fractionation)

ESM2 similar proteins: D8VNS7, D8VNS8, D8VNS9, D8VNT0, E2IYB3, O00602, O43827, O70165, O70497, O95841, P02675, P02679, P02680, P04115, P12799, P12804, P14480, P17634, P19477, P55083, P55918, P57756, P85031, P86239, Q08830, Q0P4P2, Q14314, Q15485, Q1RMR1, Q29041, Q29042, Q29RY7, Q3SZZ7, Q5EA66, Q5I2E5, Q5M8C6, Q5XK91, Q640P2, Q6AX44, Q71KU9

Diamond homologs: A0A8J8, A2AV25, D8VNS7, D8VNS8, D8VNS9, D8VNT0, E2IYB3, E9PV24, O00602, O08538, O15123, O18920, O35460, O35462, O35608, O43827, O70165, O70497, O75636, O77802, O93526, O95841, P02671, P02675, P02676, P02678, P02679, P02680, P04115, P06399, P10039, P12799, P12804, P14448, P14480, P17634, P19477, P21520, P22105, P24821

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
FCN2	“up-regulates activity”	MASP1	binding
PAMPs	“up-regulates activity”	FCN2	binding
FCN2	“up-regulates activity”	MASP2	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 22 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Initial triggering of complement	5	187.8×	1e-09

GO biological processes:

GO term	Partners	Fold	FDR
proteolysis	5	9.5×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

65 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	1
Uncertain significance	54
Likely benign	2
Benign	7

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
3256929	NM_004108.3(FCN2):c.559+1G>T	Likely pathogenic

SpliceAI

1210 predictions. Top by Δscore:

Variant	Effect	Δscore
9:134884858:G:GT	donor_gain	1.0000
9:134885362:GGACC:G	donor_gain	1.0000
9:134885363:GACCG:G	donor_gain	1.0000
9:134885367:G:GG	donor_gain	1.0000
9:134885851:G:GT	donor_gain	1.0000
9:134885851:G:T	donor_gain	1.0000
9:134885896:GG:G	donor_gain	1.0000
9:134885897:GG:G	donor_gain	1.0000
9:134886425:A:AG	acceptor_gain	1.0000
9:134886425:AACAG:A	acceptor_gain	1.0000
9:134886426:A:G	acceptor_gain	1.0000
9:134886427:CAG:C	acceptor_loss	1.0000
9:134886428:A:AG	acceptor_gain	1.0000
9:134886428:A:T	acceptor_loss	1.0000
9:134886428:AG:A	acceptor_gain	1.0000
9:134886429:G:GT	acceptor_gain	1.0000
9:134886429:GG:G	acceptor_gain	1.0000
9:134886429:GGA:G	acceptor_gain	1.0000
9:134886521:G:GT	donor_gain	1.0000
9:134886560:TGCGG:T	donor_gain	1.0000
9:134886561:GCGG:G	donor_gain	1.0000
9:134886561:GCGGG:G	donor_gain	1.0000
9:134886563:GG:G	donor_gain	1.0000
9:134886563:GGGT:G	donor_loss	1.0000
9:134886564:GG:G	donor_gain	1.0000
9:134886564:GGT:G	donor_loss	1.0000
9:134886565:G:GG	donor_gain	1.0000
9:134886565:GTGA:G	donor_loss	1.0000
9:134886566:T:A	donor_loss	1.0000
9:134880917:TCCAG:T	donor_loss	0.9900

AlphaMissense

2025 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
9:134885834:T:C	F166L	0.990
9:134885836:C:A	F166L	0.990
9:134885836:C:G	F166L	0.990
9:134887352:G:C	W293C	0.990
9:134887352:G:T	W293C	0.990
9:134885801:T:C	F155L	0.989
9:134885803:C:A	F155L	0.989
9:134885803:C:G	F155L	0.989
9:134887200:T:C	F243L	0.984
9:134887202:C:A	F243L	0.984
9:134887202:C:G	F243L	0.984
9:134887269:T:A	W266R	0.984
9:134887269:T:C	W266R	0.984
9:134887271:G:C	W266C	0.984
9:134887271:G:T	W266C	0.984
9:134887350:T:A	W293R	0.982
9:134887350:T:C	W293R	0.982
9:134887377:A:C	S302R	0.980
9:134887379:C:A	S302R	0.980
9:134887379:C:G	S302R	0.980
9:134885361:T:A	W142R	0.978
9:134885361:T:C	W142R	0.978
9:134885855:T:C	F173L	0.978
9:134885857:C:A	F173L	0.978
9:134885857:C:G	F173L	0.978
9:134885363:G:C	W142C	0.977
9:134885363:G:T	W142C	0.977
9:134885858:T:A	W174R	0.977
9:134885858:T:C	W174R	0.977
9:134885334:T:A	C133S	0.976

dbSNP variants (sampled 300 via entrez): RS1000145286 (9:134865027 C>A,T), RS1000219027 (9:134867538 C>A), RS1000245704 (9:134862723 G>A), RS1000264962 (9:134886694 A>G), RS1000368298 (9:134864367 A>C), RS1000584051 (9:134862127 CGTGTGTGTGTGCATGTCTGCGTGCAT>C), RS1000694011 (9:134875266 C>G), RS1000694887 (9:134870085 G>A,C,T), RS1000800121 (9:134874652 C>T), RS1000838852 (9:134877947 G>A,C,T), RS1000892750 (9:134872394 T>C), RS1000959316 (9:134884906 G>A), RS1001029272 (9:134882467 G>A), RS1001117383 (9:134867842 A>G), RS1001541708 (9:134877649 T>A,C)

Disease associations

OMIM: gene MIM:601624 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST006585_1103	Blood protein levels	1.000000e-164
GCST006585_2185	Blood protein levels	2.000000e-48

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

2 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs3124955	Efficacy	3	duloxetine	Major Depressive Disorder
rs3128624	Efficacy	3	duloxetine	Major Depressive Disorder

PharmGKB variants

2 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs3124955	FCN2	3	0.00	1	duloxetine
rs3128624	FCN2	3	0.00	1	duloxetine

CTD chemical–gene interactions

15 total (human), top 15 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
2,2’,4,4’-tetrabromodiphenyl ether	increases expression, decreases expression	2
Benzo(a)pyrene	decreases expression, increases expression	2
2,4,6-tribromophenol	increases expression	1
bisphenol A	decreases expression	1
decabromobiphenyl ether	increases expression	1
tetrabromobisphenol A	increases expression	1
chromium hexavalent ion	increases expression	1
CGP 52608	affects binding, increases reaction	1
Acetaminophen	decreases expression	1
Diazinon	increases methylation	1
Methotrexate	increases expression	1
Valproic Acid	increases methylation	1
Aflatoxin B1	decreases expression	1
Cadmium Chloride	increases expression	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.