FLOT1

Summary

FLOT1 (flotillin 1, HGNC:3757) is a protein-coding gene on chromosome 6p21.33, encoding Flotillin-1 (O75955). May act as a scaffolding protein within caveolar membranes, functionally participating in formation of caveolae or caveolae-like vesicles.

This gene encodes an protein that localizes to the caveolae, which are small domains on the inner cell membranes. This protein plays a role in vesicle trafficking and cell morphology. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 10211 — RefSeq curated summary.

At a glance

• GWAS associations: 26
• Clinical variants (ClinVar): 65 total
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_005803

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3757
Approved symbol	FLOT1
Name	flotillin 1
Location	6p21.33
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000137312
Ensembl biotype	protein_coding
OMIM	606998
Entrez	10211

Gene structure

Transcript identifiers

Ensembl transcripts: 42 — 35 protein_coding, 4 retained_intron, 2 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000376389, ENST00000413165, ENST00000416018, ENST00000418160, ENST00000438162, ENST00000445853, ENST00000454845, ENST00000470643, ENST00000476729, ENST00000484168, ENST00000484693, ENST00000487376, ENST00000903944, ENST00000903945, ENST00000903946, ENST00000903947, ENST00000903948, ENST00000903949, ENST00000903950, ENST00000903951, ENST00000903952, ENST00000903953, ENST00000903954, ENST00000903955, ENST00000903956, ENST00000903957, ENST00000903958, ENST00000903959, ENST00000903960, ENST00000903961, ENST00000914088, ENST00000914089, ENST00000914090, ENST00000914091, ENST00000914092, ENST00000946577, ENST00000946578, ENST00000946579, ENST00000946580, ENST00000946581, ENST00000946582, ENST00000946583

RefSeq mRNA: 2 — MANE Select: NM_005803 NM_001318875, NM_005803

CCDS: CCDS4688

Canonical transcript exons

ENST00000376389 — 13 exons

Exon	Start	End
ENSE00001780911	30741614	30741704
ENSE00001801398	30730682	30730727
ENSE00001877681	30742527	30742687
ENSE00003473001	30742147	30742203
ENSE00003473819	30741190	30741333
ENSE00003527390	30730022	30730186
ENSE00003531601	30740496	30740591
ENSE00003533433	30740679	30740798
ENSE00003588102	30740158	30740310
ENSE00003589297	30727709	30728145
ENSE00003595092	30741792	30741867
ENSE00003653373	30730428	30730565
ENSE00003786549	30730919	30731100

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 99.22.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 41.7146 / max 663.4058, expressed in 1822 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
72594	30.2841	1813
72593	6.8584	1670
72595	1.8687	1012
72596	0.9767	607
72592	0.7405	498
72591	0.5007	285
72597	0.4854	210

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right adrenal gland	UBERON:0001233	99.22	gold quality
left adrenal gland	UBERON:0001234	99.19	gold quality
left adrenal gland cortex	UBERON:0035825	99.19	gold quality
right adrenal gland cortex	UBERON:0035827	99.18	gold quality
apex of heart	UBERON:0002098	99.05	gold quality
blood	UBERON:0000178	98.85	gold quality
adrenal gland	UBERON:0002369	98.80	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	98.80	gold quality
heart left ventricle	UBERON:0002084	98.79	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	98.79	gold quality
cerebellum	UBERON:0002037	98.76	gold quality
cerebellar cortex	UBERON:0002129	98.76	gold quality
cerebellar hemisphere	UBERON:0002245	98.76	gold quality
right frontal lobe	UBERON:0002810	98.76	gold quality
Brodmann (1909) area 9	UBERON:0013540	98.75	gold quality
anterior cingulate cortex	UBERON:0009835	98.72	gold quality
right hemisphere of cerebellum	UBERON:0014890	98.72	gold quality
primary visual cortex	UBERON:0002436	98.71	gold quality
superior frontal gyrus	UBERON:0002661	98.69	gold quality
right lobe of thyroid gland	UBERON:0001119	98.65	gold quality
hypothalamus	UBERON:0001898	98.65	gold quality
Ammon’s horn	UBERON:0001954	98.65	gold quality
substantia nigra	UBERON:0002038	98.64	gold quality
temporal lobe	UBERON:0001871	98.61	gold quality
amygdala	UBERON:0001876	98.61	gold quality
metanephros cortex	UBERON:0010533	98.60	gold quality
muscle layer of sigmoid colon	UBERON:0035805	98.60	gold quality
right atrium auricular region	UBERON:0006631	98.58	gold quality
heart	UBERON:0000948	98.57	gold quality
myometrium	UBERON:0001296	98.53	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-6142	no	391.04
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

40 targeting FLOT1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-12133	99.92	71.82	2006
HSA-MIR-1271-5P	99.91	71.99	1972
HSA-MIR-6499-3P	99.90	66.38	1212
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-182-5P	99.87	74.03	2589
HSA-MIR-5002-5P	99.76	70.84	1763
HSA-MIR-3934-3P	99.76	65.51	1351
HSA-MIR-4428	99.73	66.41	1733
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-6086	99.70	65.38	699
HSA-MIR-6134	99.63	65.68	1537
HSA-MIR-3120-3P	99.54	70.28	2669
HSA-MIR-4519	99.48	66.10	859
HSA-MIR-185-5P	99.35	68.60	2497
HSA-MIR-4644	99.35	69.12	2514
HSA-MIR-5582-5P	99.27	71.42	1879
HSA-MIR-6809-5P	99.13	68.45	1223
HSA-MIR-29A-5P	99.08	68.59	1813
HSA-MIR-4651	99.06	67.57	2002
HSA-MIR-622	98.99	66.48	1050
HSA-MIR-608	98.93	67.83	2013
HSA-MIR-1294	98.91	69.26	1030
HSA-MIR-9986	98.91	69.28	1024
HSA-MIR-873-5P	98.84	66.90	1348
HSA-MIR-4274	98.59	66.10	630
HSA-MIR-31-5P	98.58	68.35	1239

Literature-anchored findings (GeneRIF, showing 40)

• Flotillin-1, a marker of rafts, accumulates in lysosomes of neurons in Alzheimer’s disease (PMID:14708344)
• ATP-binding cassette, sub-family A (ABC1), member 1 forms a complex with syntaxin 13 and flotillin-1, residing at the plasma membrane and in phagosomes (PMID:15469992)
• It is significant that there is an increased gene expression of flotillin-1 in the Parkinson substantia nigra/ventral tegmental area compared to controls. (PMID:15545008)
• Recombinant flotillin-1 was purified and characterized in in large quantity and high purity. (PMID:15939299)
• Myocilins with mutations such as G364V, K423E, and Y437H on the domain failed to interact with flotillin-1. (PMID:16198165)
• Flotillin-1 small interfering RNA (siRNA) inhibited both clathrin-independent uptake of cholera toxin and endocytosis of a GPI-linked protein. We propose that flotillin-1 is one determinant of a clathrin-independent endocytic pathway in mammalian cells. (PMID:16341206)
• flotillin-1 may recruit amyloid beta (A4) precursor protein to lipid rafts and therefore participate in the localization and processing of APP (PMID:16480949)
• The results showed that flotillin-1 can interact with arginase1, and hence arginase activity was up-regulated by 26.8%. (PMID:17113085)
• These lines of evidence suggested that a Gq-coupled receptor activates specifically p38 MAPK through lipid rafts and Src kinase activation, in which flotillins positively modulate the Gq signaling. (PMID:17307333)
• Flotillin-1 accumulation at the pathogen Mycobacterium marinum replication niche and its rupture were also observed in human peripheral blood monocytes. (PMID:17587329)
• Coassembly of flotillin1 and flotillin2 into microdomains induces membrane curvature, the formation of plasma-membrane invaginations morphologically similar to caveolae, and the accumulation of intracellular vesicles. (PMID:17600709)
• These data suggest that flotillin-1 regulates caveolin-1 level by preventing its lysosomal degradation in intestinal epithelial cells. (PMID:19121286)
• Endocytosis of flotillins is regulated by the Src family kinase Fyn. (PMID:19258392)
• The hetero-oligomerization with flotillin 1 is necessary for the translocation of flotillin 2, which does not take place in the absence of flotillin 1. (PMID:19318123)
• the cellular pathways used by transportan and transportan 10 (TP10) for protein transduction (PMID:19348413)
• Flotillin-1 and -2 associate with PSGL-1 in resting and in stimulated neutrophils are importantly involved in neutrophil uropod formation and/or stabilization (PMID:19404397)
• Data show that the BCG phagosome is relatively depleted in LAMP-2, NPC1, flotillin-1, vATPase, and syntaxin 3. (PMID:19815536)
• In hematopoietic cells, flotillins provide intrinsic cues that govern segregation of certain microdomain-associated molecules during immune cell polarization. (PMID:20027317)
• flotillins have a role in NPC1L1-mediated cholesterol uptake and NPC1L1-flotillins-postive cholesterol-enriched membrane microdomains are involved in the mechanism for efficient cholesterol absorption (PMID:21187433)
• Flot1-enriched membrane microdomains are required for protein kinase C-regulated internalization of the DA transporter (DAT) and the glial glutamate transporter EAAT2. (PMID:21399631)
• FLOT1 plays an important role in promoting proliferation and tumorigenesis of human breast cancer and may represent a novel prognostic biomarker and therapeutic target for the disease. (PMID:21447726)
• Chlamydia pneumoniae intracellular growth was attenuated in the flotillin-1-silenced cells. (PMID:22215737)
• receptor-tyrosine kinases may also rely on flotillin-1 upon activation, thus suggesting a general role for flotillin-1 as a novel factor in receptor-tyrosine kinase/MAP kinase signaling. (PMID:22232557)
• a novel signaling network containing FRS2, CAP and flotillin-1 (PMID:22235335)
• Report role for flotillin 1/2 in interactions of lung epithelial cells with silica nanoparticles. (PMID:22669515)
• we describe how flotillin-1 and -2 contribute to the stabilization of ErbB2 at the cell surface in breast cancer tissue (PMID:22869152)
• results support predominant formation of flotillin-1 and -2 hetero-oligomers in resting and chemokine-stimulated human T-cells which may importantly contribute to structuring of the uropod. (PMID:23012365)
• The FLOT1 is abundantly expressed in term villous placental CTs and endothelial cells, and in comparison, expression of these proteins in the ST is reduced. (PMID:23064789)
• Flotillin-1 plays an important role in Oral squamous cell carcinoma (OSCC) development. (PMID:23581411)
• These data here provide direct evidences for the molecular interaction and endocytosis of PrP(C) with Flot-1 in the presence of copper ions. (PMID:23625312)
• Flotillin-1 interacted with PrPc and promote the endocytosis of PrPc. (PMID:23627023)
• FLOT1 is associated with aggressive characteristics of HCC (PMID:23840303)
• Human group V secretory phospholipase A2 is associated with lipid rafts and internalized in a flotillindependent pathway. (PMID:24042857)
• We have identified flotillin 1 and 2 as new partners of the cadherin complexes (PMID:24046456)
• Patients with higher FLOT1 expression had shorter overall survival time, whereas those with lower FLOT1 expression had longer survival time (PMID:24277378)
• EGFR overexpression and increase in signaling correlates with flotillin-1 expresion. (PMID:24304721)
• study demonstrated that miR-124 might be a tumor suppressor in breast cancer via the regulation of FLOT1 (PMID:24330780)
• Flotillin-1 mRNA expression is up-regulated in non-small cell lung cancer patients. (PMID:24533441)
• overexpression of FLOT1 can be found in tongue squamous cell cancer patients with higher pathological stage, T classification, N classification or recurrence (PMID:24695539)
• Depletion of either flotillin-1 or flotillin-2 resulted in downregulation of ErbB3 and a selective reduction of ErbB2-ErbB3 receptor complexes. (PMID:24747692)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	flot1a	ENSDARG00000001710
danio_rerio	flot1b	ENSDARG00000037998
mus_musculus	Flot1	ENSMUSG00000059714
rattus_norvegicus	Flot1	ENSRNOG00000000826
drosophila_melanogaster	Flo1	FBGN0024754

Paralogs (1): FLOT2 (ENSG00000132589)

Protein

Protein identifiers

Flotillin-1 — O75955 (reviewed: O75955)

All UniProt accessions (7): O75955, A2AB09, A2AB10, A2AB11, A2AB12, A2AB13, Q5ST80

UniProt curated annotations — full annotation on UniProt →

Function. May act as a scaffolding protein within caveolar membranes, functionally participating in formation of caveolae or caveolae-like vesicles.

Subunit / interactions. Heterooligomeric complex of flotillin-1 and flotillin-2 and caveolin-1 and caveolin-2. Interacts with ECPAS.

Subcellular location. Cell membrane. Endosome. Membrane. Caveola. Melanosome. Membrane raft.

Similarity. Belongs to the band 7/mec-2 family. Flotillin subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
O75955-1	1	yes
O75955-2	2

RefSeq proteins (2): NP_001305804, NP_005794* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001107	Band_7	Domain
IPR027705	Flotillin_fam	Family
IPR036013	Band_7/SPFH_dom_sf	Homologous_superfamily

Pfam: PF01145

UniProt features (9 total): modified residue 4, sequence conflict 2, chain 1, splice variant 1, sequence variant 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
9BQ2	ELECTRON MICROSCOPY	3.5
9L3G	ELECTRON MICROSCOPY	3.58

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75955-F1	81.80	0.42

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (4): 19, 163, 385, 387

Function

Pathways and Gene Ontology

Reactome pathways

6 pathways

ID	Pathway
R-HSA-5213460	RIPK1-mediated regulated necrosis
R-HSA-5675482	Regulation of necroptotic cell death
R-HSA-8849932	Synaptic adhesion-like molecules
R-HSA-8980692	RHOA GTPase cycle
R-HSA-9013026	RHOB GTPase cycle
R-HSA-9013106	RHOC GTPase cycle

MSigDB gene sets: 384 (showing top): CREL_01, GOBP_POSITIVE_REGULATION_OF_ENDOCYTOSIS, GOBP_NEUROTRANSMITTER_UPTAKE, GOBP_MEMBRANE_BIOGENESIS, GOCC_VACUOLAR_MEMBRANE, GOBP_CANONICAL_NF_KAPPAB_SIGNAL_TRANSDUCTION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_PLASMA_MEMBRANE_ORGANIZATION, DITTMER_PTHLH_TARGETS_UP, GOBP_REGULATION_OF_SMALL_GTPASE_MEDIATED_SIGNAL_TRANSDUCTION, GOCC_CELL_SURFACE, GOBP_NEUROTRANSMITTER_TRANSPORT, KYNG_DNA_DAMAGE_DN, GOBP_NEUROGENESIS

GO Biological Process (18): regulation of receptor internalization (GO:0002090), axonogenesis (GO:0007409), extracellular matrix disassembly (GO:0022617), positive regulation of synaptic transmission, dopaminergic (GO:0032226), adherens junction organization (GO:0034332), regulation of Rho protein signal transduction (GO:0035023), intracellular signal transduction (GO:0035556), positive regulation of canonical NF-kappaB signal transduction (GO:0043123), cell-cell adhesion mediated by cadherin (GO:0044331), plasma membrane raft assembly (GO:0044854), plasma membrane raft organization (GO:0044857), positive regulation of endocytosis (GO:0045807), regulation of neurotransmitter uptake (GO:0051580), caveola assembly (GO:0070836), protein localization to plasma membrane (GO:0072659), positive regulation of cell junction assembly (GO:1901890), positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049), positive regulation of cell-cell adhesion (GO:0022409)

GO Molecular Function (3): protease binding (GO:0002020), ionotropic glutamate receptor binding (GO:0035255), protein binding (GO:0005515)

GO Cellular Component (31): uropod (GO:0001931), lysosomal membrane (GO:0005765), endosome (GO:0005768), early endosome (GO:0005769), microtubule organizing center (GO:0005815), plasma membrane (GO:0005886), caveola (GO:0005901), cell-cell junction (GO:0005911), adherens junction (GO:0005912), focal adhesion (GO:0005925), external side of plasma membrane (GO:0009897), membrane (GO:0016020), basolateral plasma membrane (GO:0016323), flotillin complex (GO:0016600), lamellipodium (GO:0030027), cytoplasmic vesicle (GO:0031410), centriolar satellite (GO:0034451), sarcolemma (GO:0042383), melanosome (GO:0042470), cell-cell contact zone (GO:0044291), membrane raft (GO:0045121), presynaptic active zone (GO:0048786), extracellular exosome (GO:0070062), dopaminergic synapse (GO:0098691), glutamatergic synapse (GO:0098978), GABA-ergic synapse (GO:0098982), COP9 signalosome (GO:0008180), cortical actin cytoskeleton (GO:0030864), plasma membrane raft (GO:0044853), synapse (GO:0045202), presynapse (GO:0098793)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
RHO GTPase cycle	3
Regulated Necrosis	1
RIPK1-mediated regulated necrosis	1
Protein-protein interactions at synapses	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
cell-cell adhesion	2
positive regulation of cellular component organization	2
plasma membrane bounded cell projection	2
cell-cell junction	2
plasma membrane	2
receptor internalization	1
regulation of receptor-mediated endocytosis	1
cell morphogenesis involved in neuron differentiation	1
neuron projection morphogenesis	1
axon development	1
cellular component disassembly	1
extracellular matrix organization	1
synaptic transmission, dopaminergic	1
regulation of synaptic transmission, dopaminergic	1
positive regulation of synaptic transmission	1
cell-cell junction organization	1
Rho protein signal transduction	1
regulation of small GTPase mediated signal transduction	1
intracellular anatomical structure	1
signal transduction	1
canonical NF-kappaB signal transduction	1
regulation of canonical NF-kappaB signal transduction	1
positive regulation of intracellular signal transduction	1
membrane raft assembly	1
plasma membrane raft organization	1
plasma membrane organization	1
membrane raft organization	1
endocytosis	1
regulation of endocytosis	1
positive regulation of transport	1
neurotransmitter uptake	1
regulation of neurotransmitter transport	1
plasma membrane raft assembly	1
protein localization to membrane	1
protein localization to cell periphery	1
cell junction assembly	1
positive regulation of cellular component biogenesis	1
regulation of cell junction assembly	1
positive regulation of cell-cell adhesion	1

Protein interactions and networks

STRING

1596 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
FLOT1	CD63	P08962	945
FLOT1	CD81	P18582	906
FLOT1	MYOC	Q99972	898
FLOT1	PTOV1	Q86YD1	891
FLOT1	CAV1	Q03135	886
FLOT1	TSG101	Q99816	874
FLOT1	CD9	P21926	870
FLOT1	STOM	P27105	864
FLOT1	GNPAT	O15228	786
FLOT1	NGB	Q9NPG2	773
FLOT1	OLFM3	Q96PB7	765
FLOT1	CNTNAP1	P78357	762
FLOT1	FLOT2	Q14254	762
FLOT1	B4E171	B4E171	729
FLOT1	SDCBP	O00560	721

IntAct

280 interactions, top by confidence:

A	B	Type	Score
PCGF2	CBX4	psi-mi:“MI:0914”(association)	0.840
FLOT2	FLOT1	psi-mi:“MI:0915”(physical association)	0.770
ETV6	LRP6	psi-mi:“MI:0914”(association)	0.730
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
FLOT1	HTT	psi-mi:“MI:0915”(physical association)	0.670
CDCA3	CTDSPL	psi-mi:“MI:0914”(association)	0.670
TCIRG1	ATP6AP2	psi-mi:“MI:0914”(association)	0.640
APP	FLOT1	psi-mi:“MI:0915”(physical association)	0.580
FLOT1	APP	psi-mi:“MI:0915”(physical association)	0.580
FLOT1	COX5B	psi-mi:“MI:0915”(physical association)	0.560
FLOT1	FAM90A1	psi-mi:“MI:0915”(physical association)	0.560
FLOT1	NME7	psi-mi:“MI:0915”(physical association)	0.560
FLOT1	BANP	psi-mi:“MI:0915”(physical association)	0.560
FLOT1	CCDC102B	psi-mi:“MI:0915”(physical association)	0.560
EMP3	FLOT1	psi-mi:“MI:0915”(physical association)	0.540
FLOT1	EMP3	psi-mi:“MI:2364”(proximity)	0.540
FLOT1	EMP3	psi-mi:“MI:0915”(physical association)	0.540
SLC4A1	FLOT1	psi-mi:“MI:0914”(association)	0.530

BioGRID (606): FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), CAV1 (Co-localization), FLOT1 (Proximity Label-MS), FLOT1 (Proximity Label-MS), FLOT1 (Proximity Label-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS)

ESM2 similar proteins: A3QMC6, A9UMS3, H1VAN0, H1VPS8, H2FLJ1, O04331, O08917, O13127, O35129, O49460, O60121, O61491, O75477, O75955, O94550, P16148, P24156, P26659, P27105, P40961, P50085, P50093, P54116, P72655, P77306, Q28DX1, Q2HJ97, Q32LL2, Q4FZT0, Q54GI9, Q54Q31, Q5RB19, Q5RBL4, Q5RCJ9, Q5XIH7, Q5ZMN3, Q7YR41, Q8TAV4, Q91X78, Q99623

Diamond homologs: A6QLR4, O08917, O13127, O32076, O42305, O61491, O61492, O75955, Q08DN8, Q14254, Q5RBL4, Q5TM70, Q60634, Q767L6, Q7YR41, Q98TZ8, Q9Z1E1, Q9Z2S9, Q8LNW4, Q8LNW6, D2XNR0, Q4V3D6, Q501E6, Q9LV90, D2XNQ8, D2XNQ9, D2XNR1, D2XNR2, Q9AV57

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
SRC	“up-regulates activity”	FLOT1	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 205 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Signaling by FLT3 ITD and TKD mutants	6	34.4×	3e-06
Signaling by FLT3 fusion proteins	7	30.1×	1e-06
Signaling by phosphorylated juxtamembrane, extracellular and kinase domain KIT mutants	7	27.3×	2e-06
Downstream signal transduction	7	20.0×	8e-06
FLT3 Signaling	6	15.6×	2e-04
Signaling by SCF-KIT	8	14.9×	8e-06
Signaling by FGFR1 in disease	6	13.2×	4e-04
RHOQ GTPase cycle	6	8.2×	3e-03

GO biological processes:

GO term	Partners	Fold	FDR
regulation of long-term neuronal synaptic plasticity	5	28.5×	1e-03
regulation of multicellular organism growth	5	18.6×	2e-03
endocytosis	11	6.0×	2e-03
cilium assembly	11	4.7×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

65 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	42
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1461 predictions. Top by Δscore:

Variant	Effect	Δscore
6:30730035:ACG:A	donor_gain	1.0000
6:30730036:CGC:C	donor_gain	1.0000
6:30730089:T:TA	donor_gain	1.0000
6:30730090:C:A	donor_gain	1.0000
6:30730183:CCAC:C	acceptor_gain	1.0000
6:30730184:CACC:C	acceptor_gain	1.0000
6:30730187:C:A	acceptor_loss	1.0000
6:30730397:T:TA	donor_gain	1.0000
6:30730439:T:TA	donor_gain	1.0000
6:30730561:CGCAT:C	acceptor_gain	1.0000
6:30730676:A:C	donor_gain	1.0000
6:30730917:A:AC	donor_gain	1.0000
6:30730918:C:CC	donor_gain	1.0000
6:30730918:CTT:C	donor_gain	1.0000
6:30730918:CTTCT:C	donor_gain	1.0000
6:30730920:T:TA	donor_gain	1.0000
6:30731100:CCT:C	acceptor_loss	1.0000
6:30731101:C:CA	acceptor_loss	1.0000
6:30731102:T:A	acceptor_loss	1.0000
6:30740152:TCTGA:T	donor_loss	1.0000
6:30740153:CTGAC:C	donor_loss	1.0000
6:30740154:TGAC:T	donor_loss	1.0000
6:30740155:GAC:G	donor_loss	1.0000
6:30740156:A:C	donor_loss	1.0000
6:30740157:C:CA	donor_loss	1.0000
6:30740307:CTTC:C	acceptor_gain	1.0000
6:30740308:TTC:T	acceptor_gain	1.0000
6:30740309:TC:T	acceptor_gain	1.0000
6:30740310:CC:C	acceptor_gain	1.0000
6:30740310:CCTG:C	acceptor_loss	1.0000

AlphaMissense

2779 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
6:30740525:C:G	A181P	1.000
6:30740726:C:G	G143R	1.000
6:30740737:A:G	L139P	1.000
6:30740749:G:T	A135D	1.000
6:30741228:C:G	G106R	1.000
6:30741618:G:T	A69D	1.000
6:30740540:C:G	A176P	0.999
6:30740558:C:G	A170P	0.999
6:30740572:C:T	G165E	0.999
6:30740573:C:G	G165R	0.999
6:30740573:C:T	G165R	0.999
6:30740584:A:G	L161S	0.999
6:30740709:G:C	S148R	0.999
6:30740709:G:T	S148R	0.999
6:30740711:T:G	S148R	0.999
6:30740725:C:A	G143V	0.999
6:30740725:C:T	G143D	0.999
6:30740750:C:G	A135P	0.999
6:30740772:G:C	F127L	0.999
6:30740772:G:T	F127L	0.999
6:30740773:A:G	F127S	0.999
6:30740774:A:G	F127L	0.999
6:30740782:C:A	R124M	0.999
6:30741216:C:G	A110P	0.999
6:30741217:C:A	R109S	0.999
6:30741217:C:G	R109S	0.999
6:30741218:C:A	R109M	0.999
6:30741218:C:G	R109T	0.999
6:30741221:T:G	Q108P	0.999
6:30741225:G:C	H107D	0.999

dbSNP variants (sampled 300 via entrez): RS1000011447 (6:30733354 T>C), RS1000214172 (6:30743854 G>A,C), RS1001100498 (6:30743309 A>G), RS1001525518 (6:30727909 C>A,G,T), RS1001533409 (6:30743107 T>C,G), RS1001554976 (6:30727554 T>C), RS1001783491 (6:30727825 C>T), RS1001851085 (6:30729342 G>A), RS1001976802 (6:30729127 T>G), RS1002288271 (6:30742448 C>T), RS1002297206 (6:30735174 G>C), RS1002323051 (6:30742102 A>G), RS1002328273 (6:30734893 G>T), RS1002578222 (6:30731053 C>G,T), RS1003117453 (6:30737849 TGCCTCACCTCCATATTTATA>T,TGCCTCACCTCCATATTTATAGCCTCACCTCCATATTTATA)

Disease associations

OMIM: gene MIM:606998 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

26 associations (top):

Study	Trait	p-value
GCST000853_3	Ulcerative colitis	4.000000e-06
GCST002711_2	Sleep duration	2.000000e-08
GCST002884_3	Cutaneous lupus erythematosus	1.000000e-13
GCST004521_114	Autism spectrum disorder or schizophrenia	3.000000e-17
GCST004521_117	Autism spectrum disorder or schizophrenia	3.000000e-15
GCST004521_121	Autism spectrum disorder or schizophrenia	3.000000e-13
GCST004521_132	Autism spectrum disorder or schizophrenia	2.000000e-09
GCST004521_171	Autism spectrum disorder or schizophrenia	4.000000e-14
GCST004521_2	Autism spectrum disorder or schizophrenia	2.000000e-16
GCST004521_209	Autism spectrum disorder or schizophrenia	5.000000e-16
GCST004521_210	Autism spectrum disorder or schizophrenia	5.000000e-15
GCST004521_211	Autism spectrum disorder or schizophrenia	5.000000e-15
GCST004521_263	Autism spectrum disorder or schizophrenia	7.000000e-17
GCST004521_265	Autism spectrum disorder or schizophrenia	7.000000e-14
GCST004521_27	Autism spectrum disorder or schizophrenia	1.000000e-09
GCST004521_295	Autism spectrum disorder or schizophrenia	6.000000e-18
GCST004521_3	Autism spectrum disorder or schizophrenia	2.000000e-15
GCST004521_48	Autism spectrum disorder or schizophrenia	1.000000e-09
GCST004521_56	Autism spectrum disorder or schizophrenia	1.000000e-22
GCST004521_70	Autism spectrum disorder or schizophrenia	8.000000e-20
GCST004521_79	Autism spectrum disorder or schizophrenia	1.000000e-16
GCST006269_912	General cognitive ability	2.000000e-08
GCST007201_384	Schizophrenia	9.000000e-16
GCST008533_1	Decreased fine motor function in Charcot-Marie-Tooth disease 1A (eating with utensils)	1.000000e-06
GCST008820_1	Handedness (non-right-handed vs right-handed)	3.000000e-08
GCST90020028_844	Hip circumference adjusted for BMI	2.000000e-08

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0004337	intelligence
EFO:0010132	decreased fine motor function
EFO:0009902	handedness
EFO:0008039	BMI-adjusted hip circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5209841 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,538 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1232461	MOLIBRESIB	2	1,538

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs3909184	FLOT1		0.00	0

ChEMBL bioactivities

1 potent at pChembl≥5 of 1 total, top 1 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.35	IC50	450	nM	MOLIBRESIB

PubChem BioAssay actives

1 with measured affinity, of 6 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[(4S)-6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-[1,2,4]triazolo[4,3-a][1,4]benzodiazepin-4-yl]-N-ethylacetamide	2178918: Inhibition of FLOT1 (unknown origin) incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	ic50	0.4500	uM

CTD chemical–gene interactions

57 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, affects expression	3
bisphenol A	affects expression, increases expression	2
sodium arsenite	increases expression	2
Estradiol	affects cotreatment, increases expression, decreases expression	2
Tretinoin	increases expression	2
Cyclosporine	increases expression	2
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
triphenyl phosphate	affects expression	1
decabromobiphenyl ether	decreases expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
cobaltous chloride	decreases expression	1
tetrabromobisphenol A	decreases expression	1
ochratoxin A	affects cotreatment, decreases expression	1
cupric chloride	decreases expression	1
nickel sulfate	increases expression	1
coumarin	decreases phosphorylation	1
tamibarotene	increases expression	1
microcystin RR	increases expression	1
2-palmitoylglycerol	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
jinfukang	increases expression	1
LDN 193189	increases expression, affects cotreatment	1
Resveratrol	increases expression	1
Norethindrone Acetate	affects cotreatment, increases expression	1

ChEMBL screening assays

7 unique, capped per target: 7 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5209729	Binding	Thermal Shift Assay. Domain: start/stop: P801-L1158	Tm Shift (DSF) assay results for EUbOPEN Chemogenomics Library 3

Cellosaurus cell lines

5 cell lines: 4 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2X7	Abcam HEK293T FLOT1 KO	Transformed cell line	Female
CVCL_E2QD	HeLa FLOT1 KO clone 2	Cancer cell line	Female
CVCL_E2QE	HeLa FLOT1 KO clone 7	Cancer cell line	Female
CVCL_SN73	HAP1 FLOT1 (-) 1	Cancer cell line	Male
CVCL_XN81	HAP1 FLOT1 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.