FLRT1

Summary

FLRT1 (fibronectin leucine rich transmembrane protein 1, HGNC:3760) is a protein-coding gene on chromosome 11q13.1, encoding Leucine-rich repeat transmembrane protein FLRT1 (Q9NZU1). Plays a role in fibroblast growth factor-mediated signaling cascades that lead to the activation of MAP kinases.

This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain.

Source: NCBI Gene 23769 — RefSeq curated summary.

At a glance

• Gene–disease (curated): spastic paraplegia, optic atropy, and neuropathy (Supportive, GenCC)
• GWAS associations: 12
• Clinical variants (ClinVar): 186 total
• Phenotypes (HPO): 20
• MANE Select transcript: NM_013280

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3760
Approved symbol	FLRT1
Name	fibronectin leucine rich transmembrane protein 1
Location	11q13.1
Locus type	gene with protein product
Status	Approved
Aliases	MGC21624, SPG68
Ensembl gene	ENSG00000126500
Ensembl biotype	protein_coding
OMIM	604806
Entrez	23769

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 4 protein_coding

ENST00000246841, ENST00000682287, ENST00000715990, ENST00000909266

RefSeq mRNA: 3 — MANE Select: NM_013280 NM_001384466, NM_001423967, NM_013280

CCDS: CCDS8057

Canonical transcript exons

ENST00000682287 — 3 exons

Exon	Start	End
ENSE00003916832	64035931	64036159
ENSE00003919589	64116219	64119171
ENSE00003921762	64103194	64104181

Expression profiles

Bgee: expression breadth ubiquitous, 188 present calls, max score 89.19.

FANTOM5 (CAGE): breadth broad, TPM avg 1.2136 / max 41.2397, expressed in 304 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
114856	0.8818	280
114858	0.2832	98
114857	0.0487	28

Top tissues by expression

288 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
Brodmann (1909) area 10	UBERON:0013541	89.19	gold quality
olfactory bulb	UBERON:0002264	86.40	silver quality
frontal pole	UBERON:0002795	86.15	gold quality
type B pancreatic cell	CL:0000169	84.92	gold quality
buccal mucosa cell	CL:0002336	84.81	silver quality
paraflocculus	UBERON:0005351	84.33	gold quality
ventral tegmental area	UBERON:0002691	84.31	gold quality
inferior vagus X ganglion	UBERON:0005363	83.99	gold quality
cerebellar vermis	UBERON:0004720	82.96	gold quality
dorsal plus ventral thalamus	UBERON:0001897	82.63	gold quality
diaphragm	UBERON:0001103	82.35	gold quality
globus pallidus	UBERON:0001875	82.23	silver quality
medial globus pallidus	UBERON:0002477	81.99	silver quality
subthalamic nucleus	UBERON:0001906	81.78	gold quality
mucosa of urinary bladder	UBERON:0001259	81.60	gold quality
middle frontal gyrus	UBERON:0002702	81.46	gold quality
renal medulla	UBERON:0000362	80.73	gold quality
lateral globus pallidus	UBERON:0002476	80.50	gold quality
prefrontal cortex	UBERON:0000451	80.46	gold quality
orbitofrontal cortex	UBERON:0004167	80.12	gold quality
lateral nuclear group of thalamus	UBERON:0002736	79.49	silver quality
superior vestibular nucleus	UBERON:0007227	79.46	gold quality
tongue squamous epithelium	UBERON:0006919	79.13	gold quality
hair follicle	UBERON:0002073	78.45	gold quality
dorsal root ganglion	UBERON:0000044	78.07	gold quality
Brodmann (1909) area 46	UBERON:0006483	77.96	gold quality
cortical plate	UBERON:0005343	77.58	gold quality
medulla oblongata	UBERON:0001896	77.50	gold quality
frontal cortex	UBERON:0001870	77.01	gold quality
vena cava	UBERON:0004087	76.76	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.27

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

55 targeting FLRT1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6798-5P	100.00	65.77	699
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-6845-3P	99.94	66.88	1439
HSA-MIR-1236-3P	99.94	68.04	1695
HSA-MIR-6809-3P	99.91	71.45	3814
HSA-LET-7A-2-3P	99.87	70.53	1921
HSA-LET-7G-3P	99.85	70.43	1929
HSA-MIR-544A	99.84	68.66	1965
HSA-MIR-6875-3P	99.82	70.26	2983
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-6885-3P	99.75	70.36	3187
HSA-MIR-1208	99.70	68.28	1533
HSA-MIR-1283	99.69	72.42	3009
HSA-MIR-12124	99.68	69.17	2700
HSA-MIR-5093	99.67	69.26	2291
HSA-MIR-6887-3P	99.66	67.83	1778
HSA-MIR-26A-1-3P	99.64	66.81	788
HSA-MIR-26A-2-3P	99.64	66.82	786
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-5683	99.36	68.59	2083
HSA-MIR-3160-5P	99.28	69.07	1938
HSA-MIR-4667-3P	99.26	65.45	1608
HSA-MIR-4685-5P	99.25	65.99	1563
HSA-MIR-6837-5P	99.25	65.47	1632
HSA-MIR-4763-3P	99.10	67.83	2649
HSA-MIR-6738-3P	99.03	67.14	1326

Literature-anchored findings (GeneRIF, showing 1)

• the phosphorylation state of FLRT1, which is itself FGFR1 dependent, may play a critical role in the potentiation of FGFR1 signalling and may also depend on a SFK-dependent phosphorylation mechanism acting via the FGFR (PMID:20421966)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	flrt1b	ENSDARG00000075597
mus_musculus	Flrt1	ENSMUSG00000047787
rattus_norvegicus	Flrt1	ENSRNOG00000022428

Paralogs (22): DCN (ENSG00000011465), RTN4R (ENSG00000040608), ASPN (ENSG00000106819), FLRT3 (ENSG00000125848), LRRC4 (ENSG00000128594), LRRC4B (ENSG00000131409), PODNL1 (ENSG00000132000), LRTM1 (ENSG00000144771), LRRC4C (ENSG00000148948), LRRTM1 (ENSG00000162951), LRRC15 (ENSG00000172061), PODN (ENSG00000174348), LRRTM4 (ENSG00000176204), BGN (ENSG00000182492), LRRC19 (ENSG00000184434), FLRT2 (ENSG00000185070), GP1BA (ENSG00000185245), RTN4RL1 (ENSG00000185924), RTN4RL2 (ENSG00000186907), NYX (ENSG00000188937), LRRC66 (ENSG00000188993), LRRTM3 (ENSG00000198739)

Protein

Protein identifiers

Leucine-rich repeat transmembrane protein FLRT1 — Q9NZU1 (reviewed: Q9NZU1)

Alternative names: Fibronectin-like domain-containing leucine-rich transmembrane protein 1

All UniProt accessions (1): Q9NZU1

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role in fibroblast growth factor-mediated signaling cascades that lead to the activation of MAP kinases. Promotes neurite outgrowth via FGFR1-mediated activation of downstream MAP kinases. Promotes an increase both in neurite number and in neurite length. May play a role in cell-cell adhesion and cell guidance via its interaction with ADGRL1/LPHN1 and ADGRL3.

Subunit / interactions. Interacts with FGFR1. Interacts (via extracellular domain) with ADGRL1/LPHN1 and ADGRL3 (via olfactomedin-like domain).

Subcellular location. Cell membrane. Endoplasmic reticulum membrane. Cytoplasmic vesicle membrane. Cytoplasm. Perinuclear region. Cell junction. Focal adhesion. Secreted. Cell projection. Neuron projection.

Tissue specificity. Expressed in kidney and brain.

Post-translational modifications. N-glycosylated. Phosphorylated in response to FGFR1 signaling, but is not a direct substrate of FGFR1 or SRC. A mutant where the Tyr phosphorylation sites have been replaced by Phe displays constitutive FGFR1-dependent activation of downstream MAP kinases. Proteolytic cleavage in the juxtamembrane region gives rise to a soluble ectodomain.

Miscellaneous. The curated signal sequence though non-canonical is consistent with the proven topology of the mouse ortholog. Has a predicted canonical N-terminal signal sequence that is consistent with the proven topology of the mouse ortholog. Alternative initiation is supported by ribosome profiling data.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9NZU1-2	2	yes
Q9NZU1-1	1

RefSeq proteins (3): NP_001371395, NP_001410896, NP_037412* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000372	LRRNT	Domain
IPR000483	Cys-rich_flank_reg_C	Domain
IPR001611	Leu-rich_rpt	Repeat
IPR003591	Leu-rich_rpt_typical-subtyp	Repeat
IPR003961	FN3_dom	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR032675	LRR_dom_sf	Homologous_superfamily
IPR036116	FN3_sf	Homologous_superfamily
IPR050333	SLRP	Family

Pfam: PF01462, PF13855

UniProt features (25 total): repeat 10, domain 3, disulfide bond 3, glycosylation site 2, topological domain 2, signal peptide 1, chain 1, splice variant 1, sequence conflict 1, transmembrane region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9NZU1-F1	73.46	0.48

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (3): 54–60, 58–67, 332–357

Glycosylation sites (2): 249, 305

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-5654687	Downstream signaling of activated FGFR1

MSigDB gene sets: 206 (showing top): GOBP_DENDRITE_DEVELOPMENT, MYOGENIN_Q6, YAGI_AML_WITH_INV_16_TRANSLOCATION, GOBP_NEURON_PROJECTION_EXTENSION, GOBP_SYNAPSE_ASSEMBLY, REACTOME_SIGNALING_BY_FGFR, GOBP_POSITIVE_REGULATION_OF_SYNAPSE_ASSEMBLY, GOBP_GROWTH, GOBP_NEUROGENESIS, GOBP_REGULATION_OF_CELL_JUNCTION_ASSEMBLY, GOBP_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOBP_POSITIVE_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, chr11q13, EFC_Q6

GO Biological Process (5): cell adhesion (GO:0007155), fibroblast growth factor receptor signaling pathway (GO:0008543), dendrite development (GO:0016358), positive regulation of synapse assembly (GO:0051965), neuron projection extension (GO:1990138)

GO Molecular Function (3): fibroblast growth factor receptor binding (GO:0005104), protein-macromolecule adaptor activity (GO:0030674), protein binding (GO:0005515)

GO Cellular Component (18): obsolete extracellular space (GO:0005615), endoplasmic reticulum membrane (GO:0005789), plasma membrane (GO:0005886), cell-cell junction (GO:0005911), focal adhesion (GO:0005925), cytoplasmic vesicle membrane (GO:0030659), extracellular matrix (GO:0031012), cytoplasmic vesicle (GO:0031410), neuronal cell body membrane (GO:0032809), neuron projection terminus (GO:0044306), perinuclear region of cytoplasm (GO:0048471), extracellular region (GO:0005576), cytoplasm (GO:0005737), endoplasmic reticulum (GO:0005783), membrane (GO:0016020), cell projection (GO:0042995), neuron projection (GO:0043005), anchoring junction (GO:0070161)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Signaling by FGFR1	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	6
cytoplasm	3
cellular process	1
cell surface receptor protein tyrosine kinase signaling pathway	1
cellular response to fibroblast growth factor stimulus	1
neuron projection development	1
anatomical structure development	1
synapse assembly	1
positive regulation of nervous system development	1
regulation of synapse assembly	1
positive regulation of cell junction assembly	1
developmental cell growth	1
neuron projection morphogenesis	1
developmental growth involved in morphogenesis	1
growth factor receptor binding	1
protein binding	1
molecular adaptor activity	1
binding	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
membrane	1
cell periphery	1
anchoring junction	1
cell-substrate junction	1
vesicle membrane	1
cytoplasmic vesicle	1
external encapsulating structure	1
intracellular vesicle	1
neuronal cell body	1
cell body membrane	1
neuron projection	1
intracellular anatomical structure	1
endomembrane system	1
intracellular membrane-bounded organelle	1
plasma membrane bounded cell projection	1
cell junction	1

Protein interactions and networks

STRING

1132 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
FLRT1	UNC5A	Q6ZN44	854
FLRT1	FN1	P02751	767
FLRT1	ADGRL1	O94910	605
FLRT1	NID1	P14543	596
FLRT1	MACROD2	A1Z1Q3	587
FLRT1	ROBO1	Q9Y6N7	520
FLRT1	ERVFRD-1	P60508	492
FLRT1	ERV3-1	Q14264	492
FLRT1	ADGRL3	Q9HAR2	478
FLRT1	UNC5D	Q6UXZ4	471
FLRT1	CNTN3	Q9P232	421
FLRT1	ADGRL2	O95490	419
FLRT1	FNDC10	F2Z333	404
FLRT1	OSTN	P61366	401
FLRT1	PAX6	P26367	387

IntAct

9 interactions, top by confidence:

A	B	Type	Score
FLRT1	TCAF2	psi-mi:“MI:0914”(association)	0.530
VASN	AP3B1	psi-mi:“MI:0914”(association)	0.530
APP	FLRT1	psi-mi:“MI:0915”(physical association)	0.400
flrt3	FLRT1	psi-mi:“MI:0915”(physical association)	0.400
FLRT1	GPR35	psi-mi:“MI:0915”(physical association)	0.370
FLRT1	ADGRL1	psi-mi:“MI:0914”(association)	0.350
FLRT1	FLRT2	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (57): LPHN3 (Affinity Capture-MS), FLRT3 (Affinity Capture-MS), RADIL (Affinity Capture-MS), PCDH17 (Affinity Capture-MS), LPHN1 (Affinity Capture-MS), PCDHGC3 (Affinity Capture-MS), PIK3CA (Affinity Capture-MS), BLZF1 (Affinity Capture-MS), FAM115C (Affinity Capture-MS), PCDH7 (Affinity Capture-MS), PIK3CB (Affinity Capture-MS), PIK3R1 (Affinity Capture-MS), LPHN2 (Affinity Capture-MS), PIK3R2 (Affinity Capture-MS), PIK3R3 (Affinity Capture-MS)

ESM2 similar proteins: A0N0X6, A4IIW9, B0BLW3, B1H134, B1H234, B4F7C5, D3ZAL8, D3ZTV3, D4A7P2, E5DHB5, F1NUK7, F7D3V9, O43155, O43300, O94898, P58681, Q32Q07, Q3SXY7, Q3URE9, Q504C1, Q50L44, Q52KR2, Q5R482, Q5R6T0, Q5RDJ4, Q61809, Q66HV9, Q6RKD8, Q6UXK5, Q70AK3, Q7L985, Q80XG9, Q80ZD7, Q80ZD8, Q80ZD9, Q86VH4, Q86VH5, Q8BGA3, Q8BGT1, Q8BLU0

Diamond homologs: B1H134, B1H234, D3ZTV3, F1NUK7, G5EFX6, G5EG78, O43155, O88280, P19879, P20774, P24014, P58874, P79119, P83286, Q5R6T0, Q5RAC4, Q5RBL2, Q62000, Q6PEZ8, Q6RKD8, Q70AK3, Q810C1, Q8BGT1, Q8BLU0, Q8MJF1, Q96PX8, Q9DE65, Q9NR97, Q9NZU0, Q9NZU1, Q9UBM4, Q9W6H0, A8WGA3, D4ABX8, O42235, O55226, O60938, O75093, O88279, O94769

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

186 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	121
Likely benign	43
Benign	19

Top pathogenic / likely-pathogenic (0)

SpliceAI

1379 predictions. Top by Δscore:

Variant	Effect	Δscore
11:64103326:GAC:G	donor_gain	0.9900
11:64105934:GGTCC:G	donor_gain	0.9900
11:64103439:GCGGG:G	donor_gain	0.9600
11:64104995:T:TA	donor_gain	0.9500
11:64103581:G:GT	donor_gain	0.9400
11:64104180:AGGTA:A	donor_loss	0.9400
11:64104181:GG:G	donor_loss	0.9400
11:64104182:GTA:G	donor_loss	0.9400
11:64104183:T:G	donor_loss	0.9400
11:64104996:C:A	donor_gain	0.9400
11:64104178:GGAG:G	donor_gain	0.9300
11:64104179:GAGG:G	donor_gain	0.9300
11:64107589:A:C	acceptor_gain	0.9300
11:64103507:A:T	donor_gain	0.9100
11:64117884:CA:C	donor_gain	0.9100
11:64117885:AA:A	donor_gain	0.9100
11:64115776:C:G	donor_gain	0.8700
11:64105006:T:TA	donor_gain	0.8600
11:64104534:G:GA	donor_gain	0.8500
11:64115552:GAAT:G	acceptor_gain	0.8500
11:64059546:TCC:T	donor_gain	0.8400
11:64103295:G:GT	donor_gain	0.8400
11:64104971:A:AC	donor_gain	0.8400
11:64069745:G:GC	donor_gain	0.8300
11:64103296:A:T	donor_gain	0.8300
11:64103574:C:G	donor_gain	0.8300
11:64104008:GGC:G	donor_gain	0.8300
11:64105935:GTCC:G	donor_gain	0.8300
11:64105936:TCCT:T	donor_gain	0.8300
11:64104184:AAG:A	donor_loss	0.8100

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000004213 (11:64088296 C>T), RS1000042637 (11:64076537 G>A,C), RS1000075501 (11:64046752 A>G,T), RS1000087954 (11:64099027 G>A), RS1000111039 (11:64075171 C>A,T), RS1000113862 (11:64083623 G>A), RS1000124498 (11:64060193 C>A,T), RS1000166700 (11:64057719 T>C,G), RS1000175657 (11:64040875 A>G), RS1000187516 (11:64096286 T>C), RS1000242715 (11:64101940 C>A,T), RS1000270937 (11:64115906 A>G), RS1000338494 (11:64088024 G>A), RS1000371817 (11:64109096 C>T), RS1000429424 (11:64048062 CCAGCCTGGCTCTCAGGCCTG>C)

Disease associations

OMIM: gene MIM:604806 | disease phenotypes: MIM:303350

GenCC curated gene-disease

Disease	Classification	Inheritance
spastic paraplegia, optic atropy, and neuropathy	Supportive	Autosomal recessive

Mondo (3): peripheral neuropathy (MONDO:0005244), hereditary spastic paraplegia (MONDO:0019064), spastic paraplegia, optic atropy, and neuropathy (MONDO:0012297)

Orphanet (1): Hereditary spastic paraplegia (Orphanet:685)

HPO phenotypes

20 total (20 of 20 shown, HPO-id order):

HPO	Term
HP:0000543	Optic disc pallor
HP:0000639	Nystagmus
HP:0000648	Optic atrophy
HP:0000975	Hyperhidrosis
HP:0001260	Dysarthria
HP:0001288	Gait disturbance
HP:0001761	Pes cavus
HP:0002071	Abnormality of extrapyramidal motor function
HP:0002166	Impaired vibration sensation in the lower limbs
HP:0002194	Delayed gross motor development
HP:0002267	Exaggerated startle response
HP:0002600	Hyporeflexia of lower limbs
HP:0002650	Scoliosis
HP:0002828	Multiple joint contractures
HP:0003380	Decreased number of peripheral myelinated nerve fibers
HP:0003477	Peripheral axonal neuropathy
HP:0003693	Distal amyotrophy
HP:0007020	Progressive spastic paraplegia
HP:0007054	Proximal hyperreflexia
HP:0008944	Distal lower limb amyotrophy

GWAS associations

12 associations (top):

Study	Trait	p-value
GCST001725_12	Inflammatory bowel disease	4.000000e-11
GCST010136_47	Fruit consumption	9.000000e-10
GCST010637_32	Urate levels	1.000000e-09
GCST011345_16	Triglyceride levels	1.000000e-08
GCST90020024_386	A body shape index	5.000000e-08
GCST90020025_1864	Waist-to-hip ratio adjusted for BMI	2.000000e-09
GCST90020025_1868	Waist-to-hip ratio adjusted for BMI	3.000000e-09
GCST90020025_1871	Waist-to-hip ratio adjusted for BMI	2.000000e-12
GCST90020027_1485	Waist-hip index	2.000000e-09
GCST90020027_1487	Waist-hip index	3.000000e-09
GCST90020027_1488	Waist-hip index	4.000000e-12
GCST90020029_321	Waist circumference adjusted for body mass index	3.000000e-08

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0008111	diet measurement
EFO:0004531	urate measurement
EFO:0004530	triglyceride measurement
EFO:0007789	BMI-adjusted waist circumference
EFO:0007788	BMI-adjusted waist-hip ratio

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D015419	Spastic Paraplegia, Hereditary	C10.500.300.820; C10.574.500.495.820; C10.668.829.800.300.820; C16.131.666.300.820; C16.320.400.375.820
C563702	Spastic Paraplegia, Optic Atrophy, and Neuropathy (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

19 total (human), top 19 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
trichostatin A	affects cotreatment, increases expression	3
Nickel	decreases expression	2
Tretinoin	decreases expression	2
entinostat	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
jinfukang	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Cisplatin	increases expression, affects cotreatment	1
Estradiol	affects expression	1
Plant Extracts	decreases expression, affects cotreatment	1
Tamoxifen	affects expression	1
Tobacco Smoke Pollution	decreases expression	1
Triclosan	increases expression	1
Valproic Acid	affects expression	1
Cyclosporine	increases expression	1
Okadaic Acid	increases expression	1
Raloxifene Hydrochloride	affects expression	1
S-Nitrosoglutathione	decreases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00380965	PHASE4	COMPLETED	Evaluation of the Efficacy of Cesamet™ for the Treatment of Pain in Patients With Chemotherapy-Induced Neuropathy
NCT00487981	PHASE4	TERMINATED	Spinal Cord Stimulation for Painful Diabetic Neuropathy
NCT00904202	PHASE4	COMPLETED	A Study Of Lidocaine Patch 5% Alone, Gabapentin Alone, And Lidocaine Patch 5% And Gabapentin In Combination For The Relief Of Pain In Patients With Diverse Peripheral Neuropathic Pain Conditions
NCT01192113	PHASE4	COMPLETED	Safety and Efficacy of Mecobalamin Injection in Peripheral Neuropathies Patients (Study JGAZSY091109)
NCT01373983	PHASE4	COMPLETED	Intrathecal Bolus Doses of Ziconotide
NCT01458015	PHASE4	TERMINATED	Tapentadol Versus Oxycodone - a Mechanism-based Treatment Approach in Neuropathic Pain
NCT02074267	PHASE4	COMPLETED	Clinical Study for Assessment of the Efficacy of Gabapentin (Carbatin and Neurontin) in Patients With Neuropathy Pain
NCT02372149	PHASE4	UNKNOWN	IVIg for Demyelination in Diabetes Mellitus
NCT02670161	PHASE4	ENROLLING_BY_INVITATION	Quality Improvement and Practice Based Research in Neurology Using the EMR
NCT07022938	PHASE4	COMPLETED	Nutritional Supplement for Treating Chemotherapy Induced Neuropathy
NCT07025005	PHASE4	RECRUITING	Fenofibrate Role in the Prophylaxis From Peripheral Neuropathy Induced by Bortezomib, Lenalidomide and Dexamethasone (VRd) Protocol in the Treatment of Patients With Multiple Myeloma (MM)
NCT00058071	PHASE3	COMPLETED	Amifostine in Treating Peripheral Neuropathy in Patients Who Have Received Chemotherapy for Cancer
NCT00125268	PHASE3	TERMINATED	Near Infrared Light for the Treatment of Painful Peripheral Neuropathy
NCT00195013	PHASE3	COMPLETED	Randomized Placebo-Controlled Trial of Glutamine for Breast Cancer Patients With Peripheral Neuropathy
NCT00232141	PHASE3	COMPLETED	Study of Pregabalin Versus Placebo in the Treatment of Nerve Pain Associated With HIV Neuropathy
NCT00264875	PHASE3	COMPLETED	Open Label Safety And Efficacy Study Of Pregabalin In Subjects With Nerve Pain Asociated With Human Immunodeficiency Virus (HIV) Neuropathy
NCT00369564	PHASE3	COMPLETED	Glutamic Acid in Reducing Nerve Damage Caused by Vincristine in Young Patients With Cancer
NCT00471445	PHASE3	COMPLETED	Topical Amitriptyline and Ketamine Cream in Treating Peripheral Neuropathy Caused by Chemotherapy in Cancer Patients
NCT00489411	PHASE3	COMPLETED	Duloxetine in Treating Peripheral Neuropathy Caused by Chemotherapy in Patients With Cancer
NCT00710554	PHASE3	COMPLETED	A Study of Sativex® for Pain Relief of Peripheral Neuropathic Pain, Associated With Allodynia
NCT00711880	PHASE3	COMPLETED	A Study of Sativex® for Relief of Peripheral Neuropathic Pain Associated With Allodynia.
NCT00713323	PHASE3	COMPLETED	A Study to Compare the Safety and Tolerability of Sativex® in Patients With Neuropathic Pain.
NCT00713817	PHASE3	COMPLETED	A Study to Determine the Maintenance of Effect After Long-term Treatment of Sativex® in Subjects With Neuropathic Pain
NCT00775645	PHASE3	COMPLETED	S0715: Acetyl-L-Carnitine in Preventing Neuropathy in Women With Stage I, II, or IIIA Breast Cancer Undergoing Chemo
NCT00872352	PHASE3	UNKNOWN	Evaluation of Bortezomib Induced Peripheral Neuropathy of Multiple Myeloma (MM) Patients
NCT00998738	PHASE3	TERMINATED	Calcium and Magnesium in Preventing Peripheral Neuropathy Caused by Ixabepilone in Patients With Breast Cancer
NCT01049217	PHASE3	TERMINATED	Pregabalin Versus Placebo In The Treatment Of Neuropathic Pain Associated With HIV Neuropathy
NCT01099449	PHASE3	COMPLETED	Calcium Gluconate and Magnesium Sulfate in Preventing Neurotoxicity in Patients With Colon Cancer or Rectal Cancer Receiving Oxaliplatin-Based Combination Chemotherapy
NCT01288937	PHASE3	TERMINATED	A Placebo Controlled, Randomized, Double Blind Trial of Milnacipran for the Treatment of Idiopathic Neuropathy Pain
NCT01492920	PHASE3	WITHDRAWN	Acetyl-L-Carnitine Hydrochloride in Preventing Peripheral Neuropathy in Patients With Recurrent Ovarian Epithelial Cancer, Primary Peritoneal Cavity Cancer, or Fallopian Tube Cancer Undergoing Chemotherapy
NCT01775449	PHASE3	COMPLETED	Prevention of Oxaliplatin-induced Neuropathic Pain by a Specific Diet
NCT02024191	PHASE3	UNKNOWN	The Role of Glutamine for Preventing Oxaliplatin-Induced Peripheral Neuropathy
NCT02217267	PHASE3	COMPLETED	Long Term Outcome After Serial Lidocaine Infusion in Peripheral Neuropathic Pain
NCT02294149	PHASE3	UNKNOWN	Vit D3 and Omega 3 in Chemo Induced Neuropathy
NCT02311907	PHASE3	COMPLETED	Glutathione in Preventing Peripheral Neuropathy Caused by Paclitaxel and Carboplatin in Patients With Ovarian Cancer, Fallopian Tube Cancer, and/or Primary Peritoneal Cancer
NCT06071936	PHASE3	UNKNOWN	Efficacy and Tolerability of AP707 in Patients With Chronic Pain Due to Traumatic or Post-operative Peripheral Neuropathy
NCT06071975	PHASE3	UNKNOWN	Long Term Efficacy and Tolerability of AP707 in Patients With Chronic Pain Due to Diabetic Polyneuropathy
NCT06071988	PHASE3	UNKNOWN	Long Term Efficacy and Tolerability of AP707 in Patients With Chronic Pain Due to Traumatic or Post-operative Peripheral Neuropathy
NCT06072573	PHASE3	UNKNOWN	Efficacy and Tolerability of AP707 in Patients With Chronic Pain Due to Diabetic Polyneuropathy
NCT07287592	PHASE3	NOT_YET_RECRUITING	Glutamine for the Prophylaxis of Vincristine-induced Neuropathy in Children and Adolescents With Cancer.