FOXG1

Summary

FOXG1 (forkhead box G1, HGNC:3811) is a protein-coding gene on chromosome 14q12, encoding Forkhead box protein G1 (P55316). Transcription repression factor which plays an important role in the establishment of the regional subdivision of the developing brain and in the development of the telencephalon. It is haploinsufficient (ClinGen: sufficient evidence).

This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells.

Source: NCBI Gene 2290 — RefSeq curated summary.

At a glance

• Gene–disease (curated): FOXG1 disorder (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 11
• Clinical variants (ClinVar): 939 total — 179 pathogenic, 85 likely-pathogenic
• Phenotypes (HPO): 105
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• Transcription factor: yes — 17 downstream targets (CollecTRI)
• MANE Select transcript: NM_005249

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3811
Approved symbol	FOXG1
Name	forkhead box G1
Location	14q12
Locus type	gene with protein product
Status	Approved
Aliases	HFK2, QIN, BF1, HFK1, HFK3, HBF-3
Ensembl gene	ENSG00000176165
Ensembl biotype	protein_coding
OMIM	164874
Entrez	2290

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000313071, ENST00000706482

RefSeq mRNA: 1 — MANE Select: NM_005249 NM_005249

CCDS: CCDS9636

Canonical transcript exons

ENST00000313071 — 1 exons

Exon	Start	End
ENSE00004021091	28766787	28770277

Expression profiles

Bgee: expression breadth broad, 100 present calls, max score 99.38.

FANTOM5 (CAGE): breadth broad, TPM avg 11.0050 / max 999.4088, expressed in 408 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
139076	6.8449	355
139079	2.2110	262
139084	0.6379	126
139080	0.5638	94
139078	0.4468	176
139083	0.0681	36
139081	0.0649	18
207173	0.0637	40
139077	0.0615	41
207174	0.0425	22

Top tissues by expression

275 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cortical plate	UBERON:0005343	99.38	gold quality
endothelial cell	CL:0000115	99.33	gold quality
Brodmann (1909) area 23	UBERON:0013554	99.21	gold quality
ganglionic eminence	UBERON:0004023	99.20	gold quality
CA1 field of hippocampus	UBERON:0003881	99.10	gold quality
ventricular zone	UBERON:0003053	99.04	gold quality
middle temporal gyrus	UBERON:0002771	99.01	gold quality
orbitofrontal cortex	UBERON:0004167	98.56	gold quality
entorhinal cortex	UBERON:0002728	98.45	gold quality
Brodmann (1909) area 46	UBERON:0006483	98.36	gold quality
postcentral gyrus	UBERON:0002581	98.30	gold quality
frontal pole	UBERON:0002795	98.11	gold quality
parietal lobe	UBERON:0001872	98.10	gold quality
Brodmann (1909) area 10	UBERON:0013541	98.00	gold quality
superior frontal gyrus	UBERON:0002661	97.59	gold quality
middle frontal gyrus	UBERON:0002702	96.22	gold quality
lateral globus pallidus	UBERON:0002476	96.14	gold quality
occipital lobe	UBERON:0002021	95.83	gold quality
adult organism	UBERON:0007023	95.46	gold quality
primary visual cortex	UBERON:0002436	95.04	gold quality
mucosa of paranasal sinus	UBERON:0005030	93.86	gold quality
temporal lobe	UBERON:0001871	92.64	gold quality
buccal mucosa cell	CL:0002336	92.36	silver quality
cerebral cortex	UBERON:0000956	91.46	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	91.06	gold quality
Ammon’s horn	UBERON:0001954	90.86	gold quality
nasal cavity epithelium	UBERON:0005384	90.77	silver quality
telencephalon	UBERON:0001893	90.72	gold quality
neocortex	UBERON:0001950	90.56	gold quality
embryo	UBERON:0000922	90.39	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-HCAD-5	yes	44.92
E-ANND-3	no	2.07

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

17 targets.

Target	Regulation
CCNA2	Activation
CDKN1A	Repression
CDKN2B
FOXD1	Unknown
FOXG1
GDF11
HES1	Repression
MYH6
NCOA3
PAX6
PGF
RELN	Repression
ROBO1	Repression
SERPINE1	Repression
SLIT3	Repression
TLE1
TLE6

JASPAR motifs

Motif	Name	Family
MA0613.1	FOXG1	FOX

JASPAR matrix evidence (PMIDs): PMID:15342912

Upstream regulators (CollecTRI, top): FOXD1, FOXG1, KDM5B, PAX3, PAX6, ZBTB17

miRNA regulators (miRDB)

136 targeting FOXG1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-6759-5P	99.99	66.54	785
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• BF-1 and PAX9 interact with PLU-1 via a novel conserved sequence motif (Ala-X-Ala-Ala-X-Val-Pro-X4-Val-Pro-X8-Pro, termed the VP motif) (PMID:12657635)
• The expression of FOXG1 showed an inverse relationship. FOXG1 copy gain was seen in 55/59 of a validating set of tumors and showed a positive correlation with protein expression representing the first report of FOXG1 dysregulation in medulloblastoma. (PMID:17522785)
• FOXG1 is responsible for the congenital variant of Rett syndrome. (PMID:18571142)
• Two different de novo heterozygous FOXG1-truncating mutations were identified. The subject with the p.Trp308X mutation presented with a severe RTT-like neurodevelopmental disorder, while the p.Tyr400X allele was associated with classical RTT symptoms. (PMID:19564653)
• these results contribute to the clarification of the phenotype associated with FOXG1, confirming its role in the Rett syndrome spectrum. (PMID:19578037)
• two de novo mutations (c.1248C>G, p.Y416X and c.460_461dupG, p.E154GfsX300) were identified in two unrelated girls with Rett syndrome (PMID:19806373)
• We report a series of seven cases of patients with FIXG1 gebe duplications in 14q associated with developmental delay/mental retardation and speech delay as predominant features, as well as developmental epilepsy in the majority. (PMID:20736978)
• 150 patients affected by postnatal microcephaly, and identified two mutations: the c.326C>T (p.P109L) substitution and the c.730C>T transition, which induces the p.R244C mutation within the DNA-binding forkhead domain. (PMID:21280142)
• Transgenic mice lacking microRNAs miR-9-2 and miR-9-3 exhibit multiple defects in their telencephalic structures which may be brought about by dysregulation of Foxg1, Nr2e1, Gsh2, and Meis2 expression. (PMID:21368052)
• The core FOXG1 syndrome phenotype consists of postnatal microcephaly, severe mental retardation, absent language, dyskinesia, and corpus callosum hypogenesis. (PMID:21441262)
• West syndrome was associated with 14q12 duplications harboring FOXG1 (PMID:21536641)
• A small increase in the dosage of FOXG1 could cause infantile spasms. (PMID:21910242)
• Alterations in the kinetics of FoxG1 binding to chromatin might contribute to the pathological effects of FOXG1 mutations. (PMID:22091895)
• FOXG1 mutations are involved in the molecular etiology of the congenital variant of Rett syndrome. (PMID:22129046)
• Foxg1 is critical for dentate gyrus formation, especially during the early postnatal stage. (PMID:22378868)
• The authors show that deletions including 14q13 result in a recognisable phenotype mainly due to haploinsufficiency of two genes (NKX2-1, PAX9). FOXG1 (on chromosome band 14q12) involvement seems to be the main determinant of phenotype severity. (PMID:22636604)
• In fibroblast cells, a cis-acting regulatory sequence located more than 0.6 Mb away from FOXG1 acts as a silencer at the transcriptional level. (PMID:22739344)
• 14q12 microdeletions excluding FOXG1, but leading to its misregulation give rise to a congenital variant Rett syndrome-like phenotype. (PMID:22968132)
• Authors assessed the functional relevance of two genes, FoxG1 and Bmi1, which were significantly enriched in non-Shh/Wnt MBs and showed these genes to mediate MB stem cell self-renewal and tumor initiation in mice. (PMID:23592496)
• Reduced FOXG1 levels in patients’ platelets having translocations or deletions in that region. (PMID:23632790)
• FoxG1 can function as a pro-apoptotic factor in part through suppression of AIB1 coactivator transcription complex formation, thereby reducing the expression of the AIB1 oncogene. (PMID:23660594)
• Our data and review of previous reports highlight dysregulation of FOXG1 pathway as the cause of the “FOXG1 syndrome” developmental disorder (PMID:23956198)
• transcriptional programmes regulated by FOXG1 and Groucho/TLE are important for BTIC-initiated brain tumour growth, implicating FOXG1 and Groucho/TLE in GBM tumourigenesis (PMID:24356439)
• Its mutation causes Rett syndrome.(review) (PMID:24738188)
• Genotype-phenotype studies of FOXG1 may help to elucidate why children develop different forms of developmental epilepsy. (PMID:24836831)
• critical role in the regulation of hepatocellular carcinoma development (PMID:25251503)
• The neurological phenotype of FOXG1 haploinsufficiency shows the features of a dyskinetic encephalopathy of infancy. (PMID:25565401)
• these results implicate the overexpression of a group of neuropeptides in the basal ganglia, hypothalamus, cortex and hippocampus in the pathogenesis FOXG1 behavioral impairments. (PMID:25966633)
• Data suggest that a shift toward GABAergic neuron fate caused by FOXG1 is a developmental precursor of autism spectrum disorder. (PMID:26186191)
• Rett syndrome with early epilepsy and the congenital variant are mainly due to variations in the CDKL5 and FOXG1 genes, respectively (PMID:26239053)
• FOXG1 mutations are associated with familial recurrence in FOXG1-related disorders. (PMID:26364767)
• We propose that the disruption of signaling pathways that promote mature neuronal differentiation by overexpressed FOXG1 is a contributing event in the neoplastic transformation of cerebellar stem cells. (PMID:26433703)
• EGFR mutations remodel the activated enhancer landscape of glioblastoma multiforme, promoting tumorigenesis through a SOX9 and FOXG1-dependent transcriptional regulatory network in vitro and in vivo. (PMID:26455392)
• These findings suggest a central AKT-FOXG1-reelin signaling pathway in focal malformations of cortical development and support pathway inhibitors as potential treatments or therapies for some forms of focal epilepsy. (PMID:26523971)
• Report demonstrates the functional consequences of Foxg1 haploinsufficiency in the visual system of Foxg1+/Cre mice and a visual impairment in a cohort of Rett individuals presenting genetic alteration on FOXG1 (PMID:27001178)
• Abnormal involuntary movements are a major feature of FOXG1 mutations. Our study delineates the spectrum of movement disorders and confirms an expanding clinical phenotype. Symptomatic treatment may be considered for severe or disabling cases, although further research regarding potential treatment strategies is necessary. (PMID:27029630)
• Upregulated miR-200b in cervical cancer was proven to show positive regulation on cervical cancer development by directly targeting FoxG1. (PMID:27044840)
• The genetic etiology of Rett syndrome (RTT) without MECP2, CDKL5, and FOXG1 mutations is heterogeneous, overlaps with other NDDs, and complicated by a high mutation burden. Dysregulation of chromatin structure and abnormal excitatory synaptic signaling may form two common pathological bases of RTT. (PMID:27171548)
• findings demonstrate clear phenotype differences between FOXG1 and MECP2 disorders. (PMID:27640358)
• describe the initial design and characterizations of novel covalent BH3-based agents that potently target Bfl-1 (PMID:28026162)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	foxg1a	ENSDARG00000070769
mus_musculus	Foxg1	ENSMUSG00000020950
rattus_norvegicus	Foxg1	ENSRNOG00000047891

Paralogs (4): FOXP2 (ENSG00000128573), FOXP4 (ENSG00000137166), FOXF2 (ENSG00000137273), FOXI1 (ENSG00000168269)

Protein

Protein identifiers

Forkhead box protein G1 — P55316 (reviewed: P55316)

Alternative names: Brain factor 1, Brain factor 2, Forkhead box protein G1A, Forkhead box protein G1B, Forkhead box protein G1C, Forkhead-related protein FKHL1, Forkhead-related protein FKHL2, Forkhead-related protein FKHL3

All UniProt accessions (1): P55316

UniProt curated annotations — full annotation on UniProt →

Function. Transcription repression factor which plays an important role in the establishment of the regional subdivision of the developing brain and in the development of the telencephalon.

Subunit / interactions. Interacts with KDM5B. Interacts with GRG6/TLE6. Interacts with TLE1; the interaction is inhibited by interaction with TLE6/GRG6.

Subcellular location. Nucleus.

Tissue specificity. Expression is restricted to the neurons of the developing telencephalon.

Disease relevance. Rett syndrome congenital variant (RTTCV) [MIM:613454] A severe neurodevelopmental disorder with features of classic Rett syndrome but earlier onset in the first months of life. Clinical features include progressive microcephaly, hypotonia, irresponsiveness and irritability in the neonatal period, intellectual disability, psychomotor regression and stereotypical movements. The disease is caused by variants affecting the gene represented in this entry.

RefSeq proteins (1): NP_005240* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001766	Fork_head_dom	Domain
IPR018122	TF_fork_head_CS_1	Conserved_site
IPR030456	TF_fork_head_CS_2	Conserved_site
IPR036388	WH-like_DNA-bd_sf	Homologous_superfamily
IPR036390	WH_DNA-bd_sf	Homologous_superfamily
IPR047208	FOXG1	Family

Pfam: PF00250

UniProt features (62 total): sequence conflict 30, sequence variant 7, compositionally biased region 6, helix 5, region of interest 4, strand 4, mutagenesis site 3, chain 1, DNA-binding region 1, turn 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
7CBY	X-RAY DIFFRACTION	1.65

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P55316-F1	58.79	0.16

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Mutagenesis-validated functional residues (3):

Position	Phenotype
388–389	abolishes interaction with kdm5b.
394–395	abolishes interaction with kdm5b.
404	abolishes interaction with kdm5b.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-9022692	Regulation of MECP2 expression and activity
R-HSA-9617828	FOXO-mediated transcription of cell cycle genes

MSigDB gene sets: 467 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_UP, GOBP_FOREBRAIN_NEURON_DEVELOPMENT, GGGACCA_MIR133A_MIR133B, RNGTGGGC_UNKNOWN, LI_CISPLATIN_RESISTANCE_DN, LEE_NEURAL_CREST_STEM_CELL_DN, FREAC2_01, GOBP_NEURON_RECOGNITION, GOBP_NEGATIVE_REGULATION_OF_NEURON_DIFFERENTIATION, BENPORATH_ES_WITH_H3K27ME3, PAL_PRMT5_TARGETS_UP, TGCACTT_MIR519C_MIR519B_MIR519A, AAGTCCA_MIR422B_MIR422A, LI_WILMS_TUMOR, GOBP_POSITIVE_REGULATION_OF_NEURON_DIFFERENTIATION

GO Biological Process (25): negative regulation of transcription by RNA polymerase II (GO:0000122), positive regulation of neuroblast proliferation (GO:0002052), regulation of transcription by RNA polymerase II (GO:0006357), regulation of mitotic cell cycle (GO:0007346), neuroblast proliferation (GO:0007405), brain development (GO:0007420), dorsal/ventral pattern formation (GO:0009953), axon midline choice point recognition (GO:0016199), pyramidal neuron migration to cerebral cortex (GO:0021852), inner ear morphogenesis (GO:0042472), negative regulation of neuron differentiation (GO:0045665), positive regulation of neuron differentiation (GO:0045666), positive regulation of cell cycle (GO:0045787), negative regulation of DNA-templated transcription (GO:0045892), neuron fate determination (GO:0048664), regulation of DNA-templated transcription (GO:0006355), regulation of gene expression (GO:0010468), central nervous system neuron differentiation (GO:0021953), central nervous system neuron development (GO:0021954), cerebral cortex development (GO:0021987), neurogenesis (GO:0022008), forebrain development (GO:0030900), cell morphogenesis involved in neuron differentiation (GO:0048667), regulation of cell cycle (GO:0051726), regulation of neural precursor cell proliferation (GO:2000177)

GO Molecular Function (6): DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA binding (GO:0003677), sequence-specific double-stranded DNA binding (GO:1990837), DNA-binding transcription factor activity (GO:0003700), protein binding (GO:0005515), sequence-specific DNA binding (GO:0043565)

GO Cellular Component (3): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Transcriptional Regulation by MECP2	1
FOXO-mediated transcription	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	3
neuron differentiation	3
regulation of transcription by RNA polymerase II	2
transcription by RNA polymerase II	2
regulation of cell cycle	2
central nervous system development	2
regulation of neuron differentiation	2
DNA-templated transcription	2
cellular anatomical structure	2
negative regulation of DNA-templated transcription	1
neuroblast proliferation	1
positive regulation of neurogenesis	1
regulation of neuroblast proliferation	1
positive regulation of neural precursor cell proliferation	1
mitotic cell cycle	1
generation of neurons	1
neural precursor cell proliferation	1
animal organ development	1
head development	1
regionalization	1
axon choice point recognition	1
cerebral cortex radial glia-guided migration	1
pyramidal neuron development	1
radial glia-guided pyramidal neuron migration	1
ear morphogenesis	1
embryonic morphogenesis	1
inner ear development	1
negative regulation of cell differentiation	1
positive regulation of cell differentiation	1
cell cycle	1
positive regulation of cellular process	1
negative regulation of RNA biosynthetic process	1
cell fate determination	1
neuron fate commitment	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
gene expression	1
regulation of macromolecule biosynthetic process	1
central nervous system neuron differentiation	1
neuron development	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

14 interactions, top by confidence:

A	B	Type	Score
FOXG1	RBM33	psi-mi:“MI:0915”(physical association)	0.400
TLE1	FOXG1	psi-mi:“MI:0915”(physical association)	0.400
	GNAT3	psi-mi:“MI:0915”(physical association)	0.400
LNPK	FOXG1	psi-mi:“MI:0915”(physical association)	0.400
FOXG1	DDX39A	psi-mi:“MI:0914”(association)	0.350
FOXG1	TCERG1	psi-mi:“MI:0914”(association)	0.350
THSD4	KRBA1	psi-mi:“MI:0914”(association)	0.350
PROZ	ARVCF	psi-mi:“MI:0914”(association)	0.350
FBLN5	ZNF320	psi-mi:“MI:0914”(association)	0.350
PROZ	MAP2K7	psi-mi:“MI:0914”(association)	0.350
FOXG1	EEF1G	psi-mi:“MI:0915”(physical association)	0.000
FOXG1	GDF9	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (92): FOXG1 (Two-hybrid), FOXG1 (Affinity Capture-MS), CHD4 (Affinity Capture-MS), HOXD13 (Affinity Capture-MS), POLE (Affinity Capture-MS), ADNP (Affinity Capture-MS), ZMYM3 (Affinity Capture-MS), KDM1A (Affinity Capture-MS), SMARCA5 (Affinity Capture-MS), SMPD4 (Affinity Capture-MS), BTAF1 (Affinity Capture-MS), PDS5A (Affinity Capture-MS), SCRIB (Affinity Capture-MS), HEATR1 (Affinity Capture-MS), LRWD1 (Affinity Capture-MS)

ESM2 similar proteins: A0A8V0YY16, A0JPN1, A1YG01, A2D4R4, A2D649, A2T6H5, A2T6Z0, A2T7J2, A3KNJ3, A7MB54, A8MTJ6, B5RHS5, D3Z120, O54743, P09027, P14653, P17919, P31249, P32183, P35584, P55316, P55318, P56260, Q00939, Q12946, Q12947, Q12948, Q12951, Q1A1A1, Q1A1A2, Q1A1A3, Q1A1A4, Q1A1A5, Q1A1A6, Q28D67, Q28HT3, Q3I5G5, Q3Y598, Q60987, Q61080

Diamond homologs: A0A078BQN7, A0A1W2PRP0, A0A8V0YY16, A1L1S5, A3KNJ3, A8MTJ6, A8XJN7, B5RHS5, D3Z120, F1R8Z9, O00358, O17617, O43638, O54743, O60129, O88470, P32027, P32028, P32030, P32315, P42128, P55316, P56260, P58012, P79772, P85037, P91278, Q00939, Q01167, Q02360, Q12946, Q12947, Q12948, Q12950, Q12951, Q12952, Q13461, Q19802, Q1A1A1, Q1A1A2

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
CSNK1A1	up-regulates	FOXG1	phosphorylation
KDM5B	“up-regulates activity”	FOXG1	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

939 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	179
Likely pathogenic	85
Uncertain significance	289
Likely benign	253
Benign	71

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1068106	NM_005249.5(FOXG1):c.645C>A (p.Phe215Leu)	Pathogenic
1070076	NM_005249.5(FOXG1):c.943_949dup (p.His317fs)	Pathogenic
1070476	NM_005249.5(FOXG1):c.469A>T (p.Lys157Ter)	Pathogenic
1073524	NM_005249.5(FOXG1):c.654C>A (p.Tyr218Ter)	Pathogenic
1073841	NC_000014.8:g.(?29236486)(29237955_?)del	Pathogenic
1074213	NM_005249.5(FOXG1):c.1410del (p.Leu471fs)	Pathogenic
1303502	NM_005249.5(FOXG1):c.923G>A (p.Trp308Ter)	Pathogenic
1319875	NM_005249.5(FOXG1):c.1111G>T (p.Glu371Ter)	Pathogenic
1320045	NM_005249.5(FOXG1):c.559A>G (p.Asn187Asp)	Pathogenic
1322933	NM_005249.5(FOXG1):c.1095_1114del (p.Arg366fs)	Pathogenic
1324422	NM_005249.5(FOXG1):c.634del (p.Ile211_Met212insTer)	Pathogenic
1325744	NM_005249.5(FOXG1):c.222_223dup (p.Pro75fs)	Pathogenic
1325746	NM_005249.5(FOXG1):c.385del (p.Glu129fs)	Pathogenic
1325747	NM_005249.5(FOXG1):c.430G>T (p.Glu144Ter)	Pathogenic
1325750	NM_005249.5(FOXG1):c.517G>T (p.Glu173Ter)	Pathogenic
1325751	NM_005249.5(FOXG1):c.543G>C (p.Lys181Asn)	Pathogenic
1325752	NM_005249.5(FOXG1):c.545C>A (p.Pro182Gln)	Pathogenic
1325754	NM_005249.5(FOXG1):c.565C>T (p.Leu189Phe)	Pathogenic
1325757	NM_005249.5(FOXG1):c.592_594del (p.Pro198del)	Pathogenic
1325758	NM_005249.5(FOXG1):c.611_618del (p.Leu204fs)	Pathogenic
1325762	NM_005249.5(FOXG1):c.921C>G (p.Tyr307Ter)	Pathogenic
1325763	NM_005249.5(FOXG1):c.974dup (p.Leu325fs)	Pathogenic
1325764	NM_005249.5(FOXG1):c.1141del (p.Ala381fs)	Pathogenic
1338970	NM_005249.5(FOXG1):c.512dup (p.Glu173fs)	Pathogenic
1343076	NM_005249.5(FOXG1):c.748G>C (p.Gly250Arg)	Pathogenic
1350942	NM_005249.5(FOXG1):c.692A>G (p.His231Arg)	Pathogenic
13867	NM_005249.5(FOXG1):c.765G>A (p.Trp255Ter)	Pathogenic
13869	NM_005249.5(FOXG1):c.624C>G (p.Tyr208Ter)	Pathogenic
13871	NM_005249.5(FOXG1):c.924G>A (p.Trp308Ter)	Pathogenic
13872	NM_005249.5(FOXG1):c.1200C>G (p.Tyr400Ter)	Pathogenic

SpliceAI

229 predictions. Top by Δscore:

Variant	Effect	Δscore
14:28766014:G:GG	donor_gain	0.9900
14:28765802:G:GT	donor_gain	0.9800
14:28766012:GA:G	donor_gain	0.9800
14:28766010:TCGAG:T	donor_loss	0.9600
14:28766012:GAGT:G	donor_loss	0.9600
14:28766013:AGTA:A	donor_loss	0.9600
14:28766014:GTA:G	donor_loss	0.9600
14:28766015:TAA:T	donor_loss	0.9600
14:28766010:TCGA:T	donor_gain	0.9500
14:28766011:CGA:C	donor_gain	0.9400
14:28766012:GAG:G	donor_gain	0.9400
14:28766016:AA:A	donor_loss	0.9400
14:28766017:AGTAA:A	donor_loss	0.9300
14:28766009:ATCGA:A	donor_gain	0.9100
14:28766935:G:GT	donor_gain	0.9100
14:28765803:A:T	donor_gain	0.8600
14:28765813:C:G	donor_gain	0.8400
14:28767073:A:AG	acceptor_gain	0.8400
14:28765789:A:T	donor_gain	0.8100
14:28765816:ATAT:A	donor_gain	0.8000
14:28765818:A:G	donor_gain	0.7800
14:28766017:A:AG	donor_gain	0.7700
14:28766018:G:GG	donor_gain	0.7700
14:28765797:A:T	donor_gain	0.7500
14:28765796:G:GT	donor_gain	0.7400
14:28765802:G:T	donor_gain	0.7400
14:28767078:CTG:C	acceptor_gain	0.7400
14:28766007:G:GT	donor_gain	0.7000
14:28767080:G:GC	acceptor_gain	0.7000
14:28766018:G:C	donor_loss	0.6900

AlphaMissense

3204 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
14:28767820:A:C	K181Q	1.000
14:28767820:A:G	K181E	1.000
14:28767821:A:T	K181M	1.000
14:28767822:G:C	K181N	1.000
14:28767822:G:T	K181N	1.000
14:28767823:C:A	P182T	1.000
14:28767823:C:T	P182S	1.000
14:28767824:C:A	P182Q	1.000
14:28767824:C:G	P182R	1.000
14:28767824:C:T	P182L	1.000
14:28767829:T:A	F184I	1.000
14:28767829:T:C	F184L	1.000
14:28767829:T:G	F184V	1.000
14:28767830:T:C	F184S	1.000
14:28767830:T:G	F184C	1.000
14:28767831:C:A	F184L	1.000
14:28767831:C:G	F184L	1.000
14:28767832:A:C	S185R	1.000
14:28767832:A:G	S185G	1.000
14:28767832:A:T	S185C	1.000
14:28767833:G:A	S185N	1.000
14:28767833:G:T	S185I	1.000
14:28767834:C:A	S185R	1.000
14:28767834:C:G	S185R	1.000
14:28767835:T:A	Y186N	1.000
14:28767835:T:C	Y186H	1.000
14:28767835:T:G	Y186D	1.000
14:28767836:A:G	Y186C	1.000
14:28767838:A:C	N187H	1.000
14:28767838:A:G	N187D	1.000

dbSNP variants (sampled 300 via entrez): RS1001013377 (14:28766894 T>A), RS1001210724 (14:28770595 A>C), RS1001642335 (14:28767863 G>A,C), RS1002340717 (14:28770453 T>C), RS1002379160 (14:28770080 G>A,C), RS1002470743 (14:28766130 C>A), RS1003002227 (14:28765931 G>A), RS1003046779 (14:28765691 A>G), RS1004242225 (14:28766383 G>C), RS1004424042 (14:28764958 T>G), RS1004455095 (14:28765244 A>G), RS1004546223 (14:28767591 C>CCAG,CCAGCCG), RS1004741003 (14:28766263 C>G), RS1007439223 (14:28767405 CCACCACCCCCAG>C,CCACCACCCCCAGCACCACCCCCAG), RS1007757128 (14:28770050 TATAA>T)

Disease associations

OMIM: gene MIM:164874 | disease phenotypes: MIM:613454, MIM:607432, MIM:312750, MIM:616239

GenCC curated gene-disease

Disease	Classification	Inheritance
Rett syndrome, congenital variant	Definitive	Autosomal dominant
FOXG1 disorder	Definitive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
FOXG1 disorder	Definitive	AD

Mondo (12): FOXG1 disorder (MONDO:0100040), lissencephaly spectrum disorders (MONDO:0018838), Rett syndrome (MONDO:0010726), intellectual disability (MONDO:0001071), congenital nervous system disorder (MONDO:0002320), autism spectrum disorder (MONDO:0005258), microcephaly (MONDO:0001149), combined oxidative phosphorylation defect type 24 (MONDO:0014547), stereotypic movement disorder (MONDO:0002265), strabismus (MONDO:0003432), neurodevelopmental disorder (MONDO:0700092), (MONDO:0013270)

Orphanet (8): Atypical Rett syndrome (Orphanet:3095), FOXG1 syndrome (Orphanet:561854), Lissencephaly (Orphanet:48471), Rett syndrome (Orphanet:778), Combined oxidative phosphorylation defect type 24 (Orphanet:444458), FOXG1 syndrome due to intragenic alteration (Orphanet:598164), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

105 total (30 of 105 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000158	Macroglossia
HP:0000219	Thin upper lip vermilion
HP:0000232	Everted lower lip vermilion
HP:0000252	Microcephaly
HP:0000253	Progressive microcephaly
HP:0000286	Epicanthus
HP:0000303	Mandibular prognathia
HP:0000319	Smooth philtrum
HP:0000348	High forehead
HP:0000411	Protruding ear
HP:0000414	Bulbous nose
HP:0000494	Downslanted palpebral fissures
HP:0000504	Abnormality of vision
HP:0000508	Ptosis
HP:0000546	Retinal degeneration
HP:0000581	Blepharophimosis
HP:0000639	Nystagmus
HP:0000648	Optic atrophy
HP:0000668	Hypodontia
HP:0000708	Atypical behavior
HP:0000717	Autism
HP:0000733	Motor stereotypy
HP:0000737	Irritability
HP:0000750	Delayed speech and language development
HP:0000817	Reduced eye contact
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001252	Hypotonia

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST000783_5	Multiple sclerosis–Brain Glutamate Levels	2.000000e-06
GCST000785_28	Longevity	1.000000e-06
GCST001179_14	Plasma omega-3 polyunsaturated fatty acid levels (docosapentaenoic acid)	5.000000e-07
GCST002447_1	Resting oxygen saturation in chronic osbtructive pulmonary disease (pulse oxymetry)	5.000000e-08
GCST002932_18	Manganese levels	8.000000e-06
GCST006575_33	Takayasu arteritis	5.000000e-06
GCST007326_25	Number of sexual partners	4.000000e-08
GCST007327_9	Smoking status (ever vs never smokers)	2.000000e-08
GCST009391_240	Metabolite levels	9.000000e-06
GCST011494_63	Daytime nap	6.000000e-16
GCST011494_64	Daytime nap	1.000000e-14

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0006809	docosapentaenoic acid measurement
EFO:0005682	oxygen saturation measurement
EFO:0004318	smoking behavior
EFO:0010493	glycodeoxycholate measurement
EFO:0007828	daytime rest measurement

MeSH disease descriptors (7)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D054082	Lissencephaly	C10.500.507.450.499; C16.131.666.507.450.499
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
D065886	Neurodevelopmental Disorders	F03.625
D015518	Rett Syndrome	C10.597.606.360.455.937; C16.320.322.500.937; C16.320.400.525.937
D019956	Stereotypic Movement Disorder	F03.625.984
D013285	Strabismus	C10.292.562.887; C11.590.810

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

49 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases expression, increases expression, increases methylation, affects cotreatment	8
trichostatin A	decreases expression, increases expression, affects expression	3
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression, decreases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
methylmercuric chloride	increases expression	1
bisphenol A	increases methylation	1
2-methyl-4-isothiazolin-3-one	increases expression	1
ascorbate-2-phosphate	decreases expression, affects binding, affects cotreatment	1
butyraldehyde	increases expression	1
potassium chromate(VI)	increases expression	1
rutecarpine	decreases expression	1
4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	affects cotreatment, decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
diallyl trisulfide	increases expression	1
U 0126	decreases reaction, increases expression	1
entinostat	decreases expression	1
Chir 99021	affects cotreatment, decreases expression, affects binding	1
mirdametinib	affects cotreatment, decreases expression	1
dorsomorphin	decreases expression, affects cotreatment	1
bisphenol S	increases methylation	1
XAV939	affects binding, affects cotreatment, decreases expression	1
1-(4-(4-propionylpiperazin-1-yl)-3-(trifluoromethyl)phenyl)-9-(quinolin-3-yl)benzo(h)(1,6)naphthyridin-2(1H)-one	decreases reaction, increases expression	1
LDN 193189	increases expression, affects cotreatment	1
(+)-JQ1 compound	affects cotreatment, decreases expression	1
3-(4-pyridyl)-1H-indole	affects cotreatment, decreases expression	1
theaflavin-3,3’-digallate	affects expression	1
Erlotinib Hydrochloride	decreases reaction, increases expression, decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Air Pollutants	affects methylation, increases abundance	1
Ascorbic Acid	affects cotreatment, decreases expression, affects binding	1

Cellosaurus cell lines

51 cell lines: 16 transformed cell line, 15 finite cell line, 14 induced pluripotent stem cell, 3 embryonic stem cell, 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A1UJ	GM27315	Transformed cell line	Female
CVCL_A1UP	GM27321	Transformed cell line	Female
CVCL_A1UQ	GM27322	Transformed cell line	Female
CVCL_A1UT	GM27373	Transformed cell line	Male
CVCL_A1UW	GM27379	Transformed cell line	Male
CVCL_A2A0	SEES3-1V human FOXG1, clone1	Embryonic stem cell	Male
CVCL_A2A1	SEES3-1V human FOXG1, clone2	Embryonic stem cell	Male
CVCL_A2A2	SEES3-1V human FOXG1, clone3	Embryonic stem cell	Male
CVCL_A2QH	GM27434	Transformed cell line	Male
CVCL_A2QQ	GM27612	Finite cell line	Female

Clinical trials (associated diseases)

286 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT00069550	PHASE3	UNKNOWN	Independent Studies of Dextromethorphan and of Donepezil Hydrochloride for Rett Syndrome
NCT00261508	PHASE3	COMPLETED	A Study of the Effectiveness and Safety of Risperidone Versus Placebo in the Treatment of Children With Autistic Disorder and Other Pervasive Developmental Disorders (PDD)
NCT03848832	PHASE3	TERMINATED	Efficacy and Safety of Cannabidiol Oral Solution (GWP42003-P, CBD-OS) in Patients With Rett Syndrome
NCT03941444	PHASE3	COMPLETED	ANAVEX2-73 Study in Patients With Rett Syndrome
NCT04181723	PHASE3	COMPLETED	Study of Trofinetide for the Treatment of Girls and Women With Rett Syndrome (LAVENDER™)
NCT04252586	PHASE3	TERMINATED	A Long-term Safety Study of Cannabidiol Oral Solution (GWP42003-P, CBD-OS) in Patients With Rett Syndrome
NCT04279314	PHASE3	COMPLETED	Open-Label Extension Study of Trofinetide for the Treatment of Girls and Women With Rett Syndrome
NCT04776746	PHASE3	TERMINATED	Open-Label Extension Study of Trofinetide for Rett Syndrome
NCT05606614	PHASE3	RECRUITING	A Phase 1/2/3 Study of TSHA-102 Gene Therapy in Females With Rett Syndrome (REVEAL Pivotal Study)
NCT05898620	PHASE3	RECRUITING	A Novel, Regulated Gene Therapy (NGN-401) Study for Females With Rett Syndrome
NCT06840496	PHASE3	RECRUITING	To Investigate the Efficacy of Treatment With Oral NA-921 (Bionetide) Versus Placebo in Females With Rett Syndrome
NCT07480564	PHASE3	RECRUITING	Safety and Preliminary Efficacy of TSHA-102 Gene Therapy in Pediatric Females Aged >2 to <4 Years With Rett Syndrome
NCT07503444	PHASE3	NOT_YET_RECRUITING	A Phase 3 Study of Fenfluramine Hydrochloride in Rett Syndrome
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT00593957	PHASE2	TERMINATED	Trial of Dextromethorphan in Rett Syndrome
NCT00990691	PHASE2	COMPLETED	Pilot Study of the Effects of the Desipramine on the Neurovegetative Parameters of the Child With Rett Syndrome
NCT01520363	PHASE2	COMPLETED	Placebo Controlled Trial of Dextromethorphan in Rett Syndrome
NCT01703533	PHASE2	COMPLETED	A Safety Study of NNZ-2566 in Patients With Rett Syndrome
NCT01777542	PHASE2	COMPLETED	Treatment of Rett Syndrome With Recombinant Human IGF-1
NCT01822249	PHASE2	COMPLETED	Phase 2 Study of EPI-743 for Treatment of Rett Syndrome
NCT02153723	PHASE2	COMPLETED	Pharmacological Treatment of Rett Syndrome With Glatiramer Acetate (Copaxone)
NCT02563860	PHASE2	COMPLETED	Pharmacological Treatment of Rett Syndrome With Statins
NCT02696044	PHASE2	UNKNOWN	Treatment of Mitochondrial Dysfunction in Rett Syndrome With Triheptanoin
NCT02715115	PHASE2	COMPLETED	A Safety Study of NNZ-2566 in Pediatric Rett Syndrome
NCT03059160	PHASE2	UNKNOWN	Open Label Trial of Triheptanoin (UX007) in Treatment of Rett Syndrome.
NCT03633058	PHASE2	COMPLETED	A Study to Evaluate Ketamine for the Treatment of Rett Syndrome
NCT03758924	PHASE2	COMPLETED	Study of ANAVEX2-73 in Patients With Rett Syndrome
NCT04041713	PHASE2	NOT_YET_RECRUITING	A Pilot Study of an Antioxidant Cocktail vs. Placebo in the Treatment of Children and Adolescents With Rett Syndrome
NCT05625568	PHASE2	UNKNOWN	Study of VYNT-0126 in the Treatment of Rett Syndrome in Adult Patients
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT01253317	PHASE1	COMPLETED	Treatment of Rett Syndrome With rhIGF-1 (Mecasermin [rDNA]Injection)
NCT02023424	PHASE1	UNKNOWN	An Open Label, Exploratory Study to Investigate the Treatment Effect of Glatiramer Acetate on Girls Woth Rett Syndrome
NCT02562820	PHASE1	TERMINATED	An Exploratory Trial of Ketamine for the Treatment of Rett Syndrome