GABRP

Summary

GABRP (gamma-aminobutyric acid type A receptor subunit pi, HGNC:4089) is a protein-coding gene on chromosome 5q35.1, encoding Gamma-aminobutyric acid receptor subunit pi (O00591). Pi subunit of the heteropentameric ligand-gated chloride channel gated by gamma-aminobutyric acid (GABA).

The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 2568 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 68 total
• GTEx eGene: eQTL in 20 tissues, sQTL in 4 (q < 0.05)
• ChEMBL bioactivity: 15 clinical-phase molecules tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.35 (unconstrained)
• MANE Select transcript: NM_014211
• Notable: 68 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4089
Approved symbol	GABRP
Name	gamma-aminobutyric acid type A receptor subunit pi
Location	5q35.1
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000094755
Ensembl biotype	protein_coding
OMIM	602729
Entrez	2568

Gene structure

Transcript identifiers

Ensembl transcripts: 13 — 12 protein_coding, 1 retained_intron

MANE Select: ENST00000265294

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 2, TSL 4: 2, TSL 5: 5

ENST00000265294, ENST00000518122, ENST00000518525, ENST00000519137, ENST00000519196, ENST00000519385, ENST00000519598, ENST00000521009, ENST00000521481, ENST00000522868, ENST00000862231, ENST00001109358, ENST00001138055

RefSeq mRNA: 2 — MANE Select: NM_014211 NM_001291985, NM_014211

CCDS: CCDS4375, CCDS75368

Canonical transcript exons

ENST00000265294 — 10 exons

Exon	Start	End
ENSE00002127168	170783725	170783874
ENSE00003888765	170805716	170805853
ENSE00003889817	170797466	170797548
ENSE00003889879	170811956	170814047
ENSE00003891512	170789129	170789247
ENSE00003892133	170794231	170794298
ENSE00003893713	170808600	170808752
ENSE00003895416	170788574	170788668
ENSE00003895461	170809568	170809755
ENSE00003896002	170795208	170795425

Expression profiles

Bgee: expression breadth ubiquitous, 194 present calls, max score 98.97.

FANTOM5 (CAGE): breadth broad, TPM avg 4.0355 / max 2243.9919, expressed in 295 samples.

Highest expression (Bgee): nasal cavity epithelium, epithelium of nasopharynx, nasopharynx, palpebral conjunctiva, lower esophagus mucosa.

Genetic regulation across tissues (GTEx eQTL / sQTL)

GABRP is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 20 tissues and its splicing (sQTL) in 4 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 24 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Pituitary	eqtl	5.2e-17	+0.63	5:170777380:G:C
Stomach	eqtl	1.3e-12	+0.34	5:170783593:AACTCAGGACCAGACGATCTCCAGAC:A
Heart Atrial Appendage	eqtl	2.9e-11	-0.67	5:170788634:T:C
Lung	eqtl	8.9e-09	+0.28	5:170776016:G:A
Adipose Visceral Omentum	eqtl	4.4e-08	-0.35	5:170791794:C:T
Heart Left Ventricle	eqtl	1.0e-06	+0.27	5:170788390:A:C
Esophagus Mucosa	sqtl	1.2e-05	+0.67	5:170791276:A:G
Muscle Skeletal	eqtl	1.4e-05	-0.45	5:170784716:A:T
Skin Sun Exposed Lower leg	sqtl	2.3e-05	-0.49	5:170808845:G:C
Esophagus Muscularis	eqtl	2.8e-05	-0.47	5:170787615:CG:C
Breast Mammary Tissue	eqtl	1.5e-04	+0.14	5:170783593:AACTCAGGACCAGACGATCTCCAGAC:A
Esophagus Mucosa	eqtl	2.3e-04	+0.53	5:170769874:G:A
Artery Tibial	eqtl	2.3e-04	+0.22	5:170787497:A:C
Minor Salivary Gland	eqtl	2.9e-04	+0.34	5:170783816:T:C
Nerve Tibial	eqtl	3.2e-04	+0.27	5:170795919:T:C
Liver	eqtl	6.7e-04	-1.88	5:170743604:G:C
Thyroid	eqtl	2.8e-03	+0.24	5:170784524:C:T
Breast Mammary Tissue	sqtl	5.8e-03	-0.50	5:170795919:T:C
Artery Coronary	eqtl	1.6e-02	-0.32	5:170791794:C:T
Pancreas	eqtl	2.2e-02	-0.31	5:170752344:C:G

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
60162	3.9276	238
60161	0.1079	65

Top tissues by expression

showing 100 of 287 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
nasal cavity epithelium	UBERON:0005384	98.97	gold quality
epithelium of nasopharynx	UBERON:0001951	98.32	gold quality
nasopharynx	UBERON:0001728	98.30	gold quality
palpebral conjunctiva	UBERON:0001812	97.63	gold quality
lower esophagus mucosa	UBERON:0035834	97.61	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	96.49	gold quality
endometrium	UBERON:0001295	95.04	gold quality
nasal cavity mucosa	UBERON:0001826	94.86	gold quality
epithelium of mammary gland	UBERON:0003244	94.78	gold quality
mammary duct	UBERON:0001765	94.45	gold quality
mucosa of paranasal sinus	UBERON:0005030	94.09	gold quality
esophagus squamous epithelium	UBERON:0006920	93.67	gold quality
amniotic fluid	UBERON:0000173	93.56	gold quality
epithelium of bronchus	UBERON:0002031	92.07	gold quality
bronchus	UBERON:0002185	91.43	gold quality
pharyngeal mucosa	UBERON:0000355	91.32	gold quality
bronchial epithelial cell	CL:0002328	91.14	gold quality
epithelium of esophagus	UBERON:0001976	90.52	gold quality
mammary gland	UBERON:0001911	90.04	gold quality
thoracic mammary gland	UBERON:0005200	89.96	gold quality
pancreatic ductal cell	CL:0002079	89.61	gold quality
upper leg skin	UBERON:0004262	88.27	gold quality
minor salivary gland	UBERON:0001830	87.92	gold quality
esophagus mucosa	UBERON:0002469	87.21	gold quality
oral cavity	UBERON:0000167	85.03	gold quality
skin of leg	UBERON:0001511	84.68	gold quality
skin of abdomen	UBERON:0001416	82.99	gold quality
vagina	UBERON:0000996	82.63	gold quality
mouth mucosa	UBERON:0003729	81.92	gold quality
zone of skin	UBERON:0000014	81.80	gold quality
gall bladder	UBERON:0002110	81.35	gold quality
tonsil	UBERON:0002372	81.27	gold quality
saliva-secreting gland	UBERON:0001044	80.13	gold quality
buccal mucosa cell	CL:0002336	79.61	gold quality
right uterine tube	UBERON:0001302	79.44	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.16	gold quality
trachea	UBERON:0003126	78.34	gold quality
skin of hip	UBERON:0001554	78.22	gold quality
squamous epithelium	UBERON:0006914	76.98	gold quality
sperm	CL:0000019	75.77	gold quality
urethra	UBERON:0000057	75.59	gold quality
uterus	UBERON:0000995	74.56	gold quality
male germ cell	CL:0000015	73.68	gold quality
oviduct epithelium	UBERON:0004804	72.60	gold quality
upper arm skin	UBERON:0004263	71.43	gold quality
esophagus	UBERON:0001043	70.80	gold quality
metanephros cortex	UBERON:0010533	70.61	gold quality
secondary oocyte	CL:0000655	69.97	gold quality
prostate gland	UBERON:0002367	69.82	gold quality
islet of Langerhans	UBERON:0000006	69.71	gold quality
fallopian tube	UBERON:0003889	69.07	gold quality
decidua	UBERON:0002450	68.89	gold quality
cervix epithelium	UBERON:0004801	68.78	gold quality
cervix squamous epithelium	UBERON:0006922	68.31	gold quality
female reproductive system	UBERON:0000474	66.28	gold quality
duodenum	UBERON:0002114	65.30	gold quality
adenohypophysis	UBERON:0002196	64.87	gold quality
jejunal mucosa	UBERON:0000399	64.62	gold quality
vermiform appendix	UBERON:0001154	63.90	gold quality
uterine cervix	UBERON:0000002	63.85	gold quality
calcaneal tendon	UBERON:0003701	62.54	gold quality
hair follicle	UBERON:0002073	61.52	gold quality
apex of heart	UBERON:0002098	60.75	gold quality
subcutaneous adipose tissue	UBERON:0002190	60.75	gold quality
colonic epithelium	UBERON:0000397	60.66	gold quality
caecum	UBERON:0001153	60.22	gold quality
right lobe of liver	UBERON:0001114	60.21	gold quality
pituitary gland	UBERON:0000007	60.14	gold quality
smooth muscle tissue	UBERON:0001135	59.92	gold quality
heart left ventricle	UBERON:0002084	59.91	gold quality
epithelial cell of pancreas	CL:0000083	59.42	silver quality
sural nerve	UBERON:0015488	59.28	gold quality
cardiac ventricle	UBERON:0002082	59.26	gold quality
rectum	UBERON:0001052	58.96	gold quality
pancreas	UBERON:0001264	58.82	gold quality
embryo	UBERON:0000922	58.81	gold quality
adult mammalian kidney	UBERON:0000082	58.80	gold quality
body of stomach	UBERON:0001161	58.68	gold quality
stomach	UBERON:0000945	58.29	gold quality
small intestine	UBERON:0002108	58.28	gold quality
cortex of kidney	UBERON:0001225	57.47	gold quality
seminal vesicle	UBERON:0000998	57.30	gold quality
left uterine tube	UBERON:0001303	57.15	gold quality
small intestine Peyer’s patch	UBERON:0003454	56.53	gold quality
metanephros	UBERON:0000081	56.33	gold quality
corpus epididymis	UBERON:0004359	56.14	gold quality
body of uterus	UBERON:0009853	56.05	gold quality
liver	UBERON:0002107	55.97	gold quality
heart	UBERON:0000948	55.74	gold quality
mucosa of transverse colon	UBERON:0004991	55.69	gold quality
kidney	UBERON:0002113	55.61	gold quality
myometrium	UBERON:0001296	54.97	gold quality
ectocervix	UBERON:0012249	54.94	gold quality
oocyte	CL:0000023	54.63	silver quality
tendon	UBERON:0000043	54.07	gold quality
ileal mucosa	UBERON:0000331	53.96	silver quality
cortical plate	UBERON:0005343	53.92	gold quality
right atrium auricular region	UBERON:0006631	53.78	gold quality
jejunum	UBERON:0002115	53.62	gold quality
anatomical system	UBERON:0000467	53.53	gold quality

Single-cell (SCXA)

Detected in 13 experiment(s), a significant marker in 10.

Experiment	Marker?	Max mean expression
E-GEOD-75688	yes	1885.88
E-MTAB-6701	yes	1497.58
E-CURD-7	yes	833.32
E-ENAD-21	yes	728.84
E-MTAB-8495	yes	492.67
E-CURD-114	yes	60.18
E-MTAB-10287	yes	50.83
E-HCAD-1	yes	12.27
E-MTAB-9388	yes	8.60
E-MTAB-6819	no	287.66
E-MTAB-7008	no	211.75
E-MTAB-9801	no	3.80
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Esophagus	tissue	161.4	medium
Breast	tissue	142.2	medium
Postcentral gyrus	tissue	115.5
Hippocampus	tissue	96.5	medium
Choroid plexus	tissue	95.8
Locus coeruleus	tissue	92.3
Nucleus accumbens	tissue	88.5
Endometrium 1	tissue	45.6	medium
Tonsil	tissue	39.6	medium
Retina	tissue	39.1
Vagina	tissue	27.4	high
Stomach 1	tissue	25.8	high
Gallbladder	tissue	25.8	high
Pancreas	tissue	22.6	high
Skin 1	tissue	18.6	high
Epididymis	tissue	18.0	medium
Seminal vesicle	tissue	15.7	medium
Small intestine	tissue	15.2	high
Duodenum	tissue	14.5	high
Salivary gland	tissue	14.0	medium
Lung	tissue	13.9	medium
Skeletal muscle	tissue	12.8	medium
Fallopian tube	tissue	12.1	medium
Prostate	tissue	12.0	medium
Bone marrow	tissue	9.3	medium
Placenta	tissue	8.6	high
Testis	tissue	7.7	medium
Cervix	tissue	7.2	high
Spleen	tissue	7.0	not detected
Appendix	tissue	6.9	medium
Liver	tissue	6.7	medium
Thyroid gland	tissue	6.5	medium
Kidney	tissue	5.7	high
Lymph node	tissue	5.4	low
Heart muscle	tissue	5.3	medium
Urinary bladder	tissue	5.3	high
Rectum	tissue	4.6	high
Ovary	tissue	4.3	not detected
Adipose tissue	tissue	4.3	medium
Thymus	tissue	4.3
Colon	tissue	4.0	high
Adrenal gland	tissue	3.4	medium
Smooth muscle	tissue	2.5	low
Tongue	tissue	2.5
Pituitary gland	tissue	1.9
Parathyroid gland	tissue	1.8	medium
Corpus callosum	tissue	1.0
Putamen	tissue	0.5
Substantia nigra	tissue	0.5
Medulla oblongata	tissue	0.4
Thalamus	tissue	0.4
Ventral forebrain	tissue	0.4
Periaqueductal gray	tissue	0.4
Septum	tissue	0.4
Cerebral cortex	tissue	0.3	high
Pons	tissue	0.3
Midbrain	tissue	0.3
Hypothalamus	tissue	0.3
Spinal cord	tissue	0.3
Hippocampal formation	tissue	0.3

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Paraventricular nucleus (142.3), Orbitofrontal gyrus, anterior (132.1), Somatomor cortex, precentral gyrus (white matter) (128.6), Vermis (124.8), Gigantocellular reticular nuclei, pars (121.2).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting GABRP by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 91 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-205-3P	99.92	69.92	3165
HSA-MIR-589-3P	99.91	69.62	2088
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-8087	99.90	69.55	1351
HSA-MIR-6783-3P	99.89	67.92	2059

Functional genomics

gnomAD constraint: pLI 8.37e-16, LOEUF 1.35, missense Z 0.608 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000265294 — one region, missense o/e 0.97.

Literature-anchored findings (GeneRIF, showing 11)

• Data suggest that GABRP is progressively down-regulated with tumour-progression, and that it may be useful as a prognostic marker in breast cancer. (PMID:16187283)
• HOXA10 expression leads to production of a less progestin-responsive GABA receptor subtype pi (PMID:20103740)
• data reveal a GABRP-ERK1/2-cytokeratin axis that maintains the migratory phenotype of basal-like breast cancer (PMID:25012653)
• genetic polymorphism is associated with systemic lupus erythematosus in female patients (PMID:26634217)
• Hypomethylation of the GABRP promoter is associated with aggressive phenotype of ovarian cancer. (PMID:28524180)
• rs505474, rs1398175, and rs4868029 in the GABRA2, GABRA4, and GABRP genes, respectively, allele frequencies were significantly different between patients and controls.Four haplotypes were significantly associated with Bipolar Disorder (TA and AG for rs3815762 and rs4868029 in GABRP, GG for rs11636988 and rs8024256 in GABRB3 and GAGG for rs2197414, rs4921195, rs13188991, and rs11956731 in GABRA6. (PMID:29135068)
• Use of a human embryonic stem cell model to discover GABRP, WFDC2, VTCN1 and ACTC1 as markers of early first trimester human trophoblast. (PMID:32359161)
• GABRP sustains the stemness of triple-negative breast cancer cells through EGFR signaling. (PMID:34023418)
• The Emerging Roles of pi Subunit-Containing GABAA Receptors in Different Cancers. (PMID:34790061)
• GABRP promotes CD44s-mediated gemcitabine resistance in pancreatic cancer. (PMID:35846884)
• GABRP Promotes the Metastasis of Pancreatic Cancer by Activation of the MEK/ERK Signaling Pathway. (PMID:37326897)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Gabrp	ENSMUSG00000020159
rattus_norvegicus	Gabrp	ENSRNOG00000032417

Paralogs (45): GABRA3 (ENSG00000011677), GABRA1 (ENSG00000022355), CHRNA3 (ENSG00000080644), CHRNA4 (ENSG00000101204), GLRA2 (ENSG00000101958), GABRE (ENSG00000102287), CHRNE (ENSG00000108556), GABRA4 (ENSG00000109158), GLRB (ENSG00000109738), GABRR2 (ENSG00000111886), GABRG2 (ENSG00000113327), CHRNB4 (ENSG00000117971), CHRNA2 (ENSG00000120903), CHRNA10 (ENSG00000129749), CHRND (ENSG00000135902), CHRNA1 (ENSG00000138435), GLRA3 (ENSG00000145451), GABRA6 (ENSG00000145863), GABRB2 (ENSG00000145864), GLRA1 (ENSG00000145888), GABRR1 (ENSG00000146276), CHRNB3 (ENSG00000147432), CHRNA6 (ENSG00000147434), HTR3B (ENSG00000149305), GABRA2 (ENSG00000151834), CHRNB2 (ENSG00000160716), GABRG1 (ENSG00000163285), GABRB1 (ENSG00000163288), GABRB3 (ENSG00000166206), CHRFAM7A (ENSG00000166664), HTR3A (ENSG00000166736), CHRNA5 (ENSG00000169684), CHRNB1 (ENSG00000170175), CHRNA9 (ENSG00000174343), CHRNA7 (ENSG00000175344), HTR3C (ENSG00000178084), GABRG3 (ENSG00000182256), GABRR3 (ENSG00000183185), HTR3E (ENSG00000186038), HTR3D (ENSG00000186090), GABRA5 (ENSG00000186297), ZACN (ENSG00000186919), GABRD (ENSG00000187730), CHRNG (ENSG00000196811), GABRQ (ENSG00000268089)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:2387597) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 1 distinct phenotype terms.

Mouse phenotype (MP)	Records
tremors	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Macaca mulatta	D1LYT2	100.0%	Diamond
Drosophila melanogaster	P25123	99.8%	Diamond
Bos taurus	P57695	99.8%	Diamond
Macaca fascicularis	Q4R534	99.8%	Diamond
Pongo abelii	Q5RCC5	99.8%	Diamond
Drosophila simulans	Q9BLY8	99.8%	Diamond
Gallus gallus	P19150	96.9%	Diamond
Danio rerio	O93430	85.6%	Diamond
Musca domestica	Q75NA5	84.3%	Diamond
Haemonchus contortus	P91730	81.4%	Diamond
Caenorhabditis elegans	Q17328	81.4%	Diamond
Lymnaea stagnalis	P26714	58.6%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
RANBP17	protein-coding	64901
KCNIP1-OT1	ncRNA	101928033
KCNIP1	protein-coding	30820
KCNIP1-AS1	ncRNA	105377716
LINC01366	ncRNA	257358
KCNMB1	protein-coding	3779
TLX3	protein-coding	30012

Protein

Protein identifiers

Gamma-aminobutyric acid receptor subunit pi — O00591 (reviewed: O00591)

Alternative names: GABA(A) receptor subunit pi

All UniProt accessions (8): E5RG98, E5RGF7, E5RHF6, E5RHU0, E5RI57, E5RK74, E7EWG0, O00591

UniProt curated annotations — full annotation on UniProt →

Function. Pi subunit of the heteropentameric ligand-gated chloride channel gated by gamma-aminobutyric acid (GABA). GABA-gated chloride channels, also named GABA(A) receptors (GABAAR), consist of five subunits arranged around a central pore and contain GABA active binding site(s) located at the alpha and beta subunit interfaces. When activated by GABA, GABAARs selectively allow the flow of chloride anions across the cell membrane down their electrochemical gradient. Pi-containing GABAARs are mostly located in peripheral tissues. In the uterus, pi subunits modulate uterus contraction by altering the sensitivity of GABAARs to pregnanolone. In the lungs, pi-containing GABAARs contribute to pulmonary fluid transport via luminal secretion of chloride.

Subunit / interactions. Heteropentamer, formed by a combination of alpha (GABRA1-6), beta (GABRB1-3), gamma (GABRG1-3), delta (GABRD), epsilon (GABRE), rho (GABRR1-3), pi (GABRP) and theta (GABRQ) chains, each subunit exhibiting distinct physiological and pharmacological properties.

Subcellular location. Cell membrane. Apical cell membrane.

Tissue specificity. Most abundant in non-neuronal tissues including the uterus, ovaries and also expressed in lung, thymus and prostate. Expressed in the hippocampus.

Activity regulation. Allosterically potentiated by alphaxalone. Allosterically inhibited by pregnenolone sulfate. Inhibited by lanthanum. High sensitivity to inhibition by zinc. The binding of pi subunit with other GABAAR subunits alters the receptor sensitivity to modulatory agents such as pregnanolone.

Domain organisation. GABAARs subunits share a common topological structure: a peptide sequence made up of a long extracellular N-terminal, four transmembrane domains, intracellular or cytoplasmic domain located between the third and the fourth transmembrane domains.

Similarity. Belongs to the ligand-gated ion channel (TC 1.A.9) family. Gamma-aminobutyric acid receptor (TC 1.A.9.5) subfamily. GABRP sub-subfamily.

RefSeq proteins (2): NP_001278914, NP_055026* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006028	GABAA/Glycine_rcpt	Family
IPR006029	Neurotrans-gated_channel_TM	Domain
IPR006201	Neur_channel	Family
IPR006202	Neur_chan_lig-bd	Domain
IPR008100	GABAAp_rcpt	Family
IPR018000	Neurotransmitter_ion_chnl_CS	Conserved_site
IPR036719	Neuro-gated_channel_TM_sf	Homologous_superfamily
IPR036734	Neur_chan_lig-bd_sf	Homologous_superfamily
IPR038050	Neuro_actylchol_rec	Homologous_superfamily
IPR047032	GABAAR_pi_TM	Domain

Pfam: PF02931, PF02932

Catalyzed reactions (Rhea)

• chloride(in) = chloride(out) (RHEA:29823)

UniProt features (48 total): strand 14, helix 12, glycosylation site 5, turn 4, topological domain 4, transmembrane region 4, sequence variant 2, signal peptide 1, chain 1, disulfide bond 1

Structure

Experimental structures (PDB)

2 structures by resolution:

PDB	Title	Method	Resolution (Å)
8VSZ	CryoEM structure of human GABAA receptor pi (GABRP) apo state	ELECTRON MICROSCOPY	3.07
8VV0	CryoEM structure of human GABAA receptor pi (GABRP) in complex with GABA	ELECTRON MICROSCOPY	3.1

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O00591-F1	79.36	0.51

Human Protein Atlas

Protein class: Predicted membrane proteins, Predicted intracellular proteins, FDA approved drug targets, Small molecule drugs, UniProt - Evidence at transcript level

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1)

Type	Positions
Disulfide bond	160–174

Glycosylation sites (5)

Type	Positions
N-linked (glcnac…) asparagine	43, 102, 145, 196, 228

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 159 (showing top): MODULE_64, GOBP_INORGANIC_ANION_TRANSPORT, GOBP_CELL_CELL_SIGNALING, SMID_BREAST_CANCER_ERBB2_DN, MARTINEZ_RB1_TARGETS_UP, GOBP_CHLORIDE_TRANSPORT, YANG_BREAST_CANCER_ESR1_DN, MCBRYAN_PUBERTAL_BREAST_3_4WK_UP, KEGG_NEUROACTIVE_LIGAND_RECEPTOR_INTERACTION, GOBP_SYNAPTIC_SIGNALING, TURASHVILI_BREAST_DUCTAL_CARCINOMA_VS_DUCTAL_NORMAL_DN, RICKMAN_HEAD_AND_NECK_CANCER_A, GOCC_APICAL_PLASMA_MEMBRANE, TGGNNNNNNKCCAR_UNKNOWN, MODULE_6

GO Biological Process (5): synaptic transmission, GABAergic (GO:0051932), chloride transmembrane transport (GO:1902476), monoatomic ion transport (GO:0006811), chloride transport (GO:0006821), monoatomic ion transmembrane transport (GO:0034220)

GO Molecular Function (6): GABA-A receptor activity (GO:0004890), GABA-gated chloride ion channel activity (GO:0022851), transmembrane signaling receptor activity (GO:0004888), monoatomic ion channel activity (GO:0005216), extracellular ligand-gated monoatomic ion channel activity (GO:0005230), chloride channel activity (GO:0005254)

GO Cellular Component (7): plasma membrane (GO:0005886), apical plasma membrane (GO:0016324), chloride channel complex (GO:0034707), synapse (GO:0045202), GABA-A receptor complex (GO:1902711), membrane (GO:0016020), GABA-ergic synapse (GO:0098982)

GO top-level categories

27 GO namespaces:

Category	Terms
chemical synaptic transmission	1
chloride transport	1
monoatomic anion transmembrane transport	1
transport	1
monoatomic anion transport	1
inorganic anion transport	1
monoatomic ion transport	1
transmembrane transport	1
GABA receptor activity	1
chloride channel activity	1
transmitter-gated monoatomic ion channel activity	1
ligand-gated monoatomic anion channel activity	1
signaling receptor activity	1
monoatomic ion transmembrane transporter activity	1
channel activity	1
ligand-gated monoatomic ion channel activity	1
monoatomic anion channel activity	1
chloride transmembrane transporter activity	1
membrane	1
cell periphery	1
apical part of cell	1
plasma membrane region	1
monoatomic ion channel complex	1
cell junction	1
GABA receptor complex	1
cellular anatomical structure	1
synapse	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 2 of 18 annotations. The rest are phylogenetic / computational / electronic (IEA).

2 experimentally-supported GO terms:

GO term	NS	Evidence
GABA-A receptor activity	MF	direct assay
GABA-gated chloride ion channel activity	MF	direct assay

Protein interactions and networks

STRING

showing 17 of 700 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GABRP	CLINT1	Q14677	646
GABRP	SLC6A3	Q01959	593
GABRP	TFAP2A	P05549	539
GABRP	VTCN1	Q7Z7D3	533
GABRP	TBXT	O15178	511
GABRP	ISL1	P20663	499
GABRP	WNT6	Q9Y6F9	471
GABRP	TFAP2C	Q92754	431
GABRP	IGFBP3	P17936	429
GABRP	NR3C1	P04150	389
GABRP	NANOS3	P60323	382
GABRP	TFAP2B	Q92481	379
GABRP	GABBR2	O75899	378
GABRP	STC1	P52823	370
GABRP	ISL2	Q96A47	370
GABRP	HEY1	Q9Y5J3	370
GABRP	DPPA3	Q6W0C5	370

IntAct

BioGRID (4 interactions; top human partners by supporting records): DDX58 (Affinity Capture-RNA), HIST1H1E (Cross-Linking-MS (XL-MS)), PARP10 (Proximity Label-MS), TNKS (Proximity Label-MS)

Disease & clinical

Genetic variants

Variant evidence for GABRP: 68 ClinVar records (0 pathogenic / likely pathogenic); 1 PharmGKB clinical annotation; 2 GWAS associations.

ClinVar

68 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	58
Likely benign	5
Benign	1

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 44 predictions of 680):

Position(s)	Effect	Δscore	Sites
5:170783875–170783876	donor_loss	1.0000	5
5:170794299–170794300	donor_loss	1.0000	5
5:170795206–170795207	acceptor_loss	1.0000	6
5:170795426–170795427	donor_loss	1.0000	4
5:170797549–170797550	donor_loss	1.0000	5
5:170788669–170788670	donor_loss	0.9900	5
5:170794229–170794230	acceptor_loss	0.9900	6
5:170794300	donor_loss	0.9900
5:170795187	acceptor_gain	0.9900
5:170797464–170797465	acceptor_loss	0.9900	6

AlphaMissense

1,260 missense substitutions predicted likely pathogenic (of 2,917 scored), across 282 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D94	8	0.994	0.998
D119	8	0.993	0.998
D170	8	0.993	0.997
D108	8	0.986	0.996
H131	8	0.985	0.992
F264	8	0.983	0.998
D307	8	0.983	0.993
D415	8	0.974	0.988
N137	8	0.970	0.996
F422	8	0.962	0.994
S180	8	0.958	0.999
F236	8	0.946	0.996
D187	8	0.944	0.984
D81	8	0.942	0.984
F99	8	0.942	0.998
F426	8	0.937	0.996
F318	8	0.930	0.990
F314	8	0.908	0.990
M285	8	0.906	0.994
F316	8	0.880	0.978

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Pancreatic Adenocarcinoma (TCGA)	unfavorable	0.000175
Kidney Renal Clear Cell Carcinoma (TCGA)	unfavorable	0.000322

Disease associations

OMIM: gene MIM:602729 | disease phenotypes:

GWAS associations

2 associations:

Study	Trait	p-value
GCST012490_523	Femur bone mineral density x serum urate levels interaction	6e-9
GCST012118_2	Response to immune checkpoint inhibitors in melanoma (immune-related adverse events)	6e-6

EFO canonical traits (from GWAS)

3 canonical traits:

EFO ID	Trait name
EFO:0011053	immune system toxicity
EFO:0600023	response to immune checkpoint inhibitor
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2093872 (PROTEIN COMPLEX GROUP)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 447,242 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

15 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL3183409	APALUTAMIDE	4	4,347
CHEMBL207538	BREXANOLONE	4	1,647
CHEMBL452	CLONAZEPAM	4	33,611
CHEMBL12	DIAZEPAM	4	92,923
CHEMBL1082407	ENZALUTAMIDE	4	10,210
CHEMBL407	FLUMAZENIL	4	7,208
CHEMBL1568698	GANAXOLONE	4	1,695
CHEMBL1544	LIOTHYRONINE	4	23,991
CHEMBL454095	ABECARNIL	2	566
CHEMBL8260	BAICALEIN	2	8,718
CHEMBL268254	DELORAZEPAM	2	1,315
CHEMBL275638	FLAVONE	2	89,655
CHEMBL287631	PROGABIDE	2	3,882
CHEMBL96	GAMMA-AMINOBUTYRIC ACID	1	161,661
CHEMBL273481	MUSCIMOL	1	5,813

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB clinical annotations

1 annotations by evidence level (1 strongest → 4):

Variant	Association	Level	Drugs	Phenotypes
rs10036156	Efficacy	3	antidepressants;Selective serotonin reuptake inhibitors;venlafaxine	Major Depressive Disorder

PharmGKB variants

1 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs10036156	GABRP	3	0.00	1	antidepressants;Selective serotonin reuptake inhibitors;venlafaxine

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: lgic — GABA_A receptors

ChEMBL bioactivities

474 potent at pChembl≥5 of 511 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.00	IC50	0.1	nM	CHEMBL454349
9.80	IC50	0.16	nM	CHEMBL309517
9.70	IC50	0.2	nM	CHEMBL4747460
9.62	IC50	0.24	nM	CHEMBL79037
9.40	IC50	0.3981	nM	CGS-8216
9.40	IC50	0.4	nM	CHEMBL1271047
9.34	IC50	0.46	nM	CHEMBL78730
9.31	IC50	0.49	nM	CHEMBL76263
9.30	IC50	0.5	nM	CHEMBL5266498
9.30	IC50	0.5	nM	CHEMBL5290464
9.30	IC50	0.5	nM	CHEMBL5280240
9.30	IC50	0.5	nM	CHEMBL49141
9.30	IC50	0.5	nM	CHEMBL1518572
9.22	IC50	0.6026	nM	CGS-9896
9.22	IC50	0.6	nM	CHEMBL419096
9.12	IC50	0.76	nM	CHEMBL540583
9.10	IC50	0.79	nM	CHEMBL77226
9.10	IC50	0.8	nM	CHEMBL5265845
9.10	IC50	0.8	nM	CHEMBL5291368
9.10	IC50	0.8	nM	CHEMBL5271392
9.07	Ki	0.85	nM	CLONAZEPAM
9.05	Ki	0.9	nM	FLUMAZENIL
9.05	IC50	0.9	nM	CHEMBL5285377
9.00	Ki	1	nM	CHEMBL3410222
9.00	IC50	1	nM	BETA-CCM
9.00	IC50	1	nM	CHEMBL454606
9.00	IC50	1	nM	CHEMBL1337028
9.00	IC50	1	nM	CHEMBL509197
9.00	IC50	1	nM	ABECARNIL
9.00	Ki	1	nM	CHEMBL54341
9.00	Ki	1	nM	CHEMBL348367
8.96	IC50	1.1	nM	CHEMBL444586
8.77	Ki	1.7	nM	CHEMBL154342
8.74	IC50	1.8	nM	CHEMBL444050
8.70	IC50	2	nM	MUSCIMOL
8.66	IC50	2.2	nM	CHEMBL80610
8.64	IC50	2.3	nM	FIPRONIL
8.55	IC50	2.8	nM	CHEMBL75642
8.55	Ki	2.8	nM	CHEMBL372281
8.55	IC50	2.8	nM	DELORAZEPAM
8.52	Ki	3	nM	CHEMBL265547
8.52	IC50	3	nM	CHEMBL510764
8.52	IC50	3	nM	CHEMBL5266558
8.52	IC50	3	nM	CHEMBL2262044
8.52	IC50	3	nM	CHEMBL499814
8.52	IC50	3	nM	CHEMBL1161036
8.48	IC50	3.3	nM	CHEMBL75642
8.40	IC50	3.981	nM	CHEMBL301605
8.40	Ki	4	nM	CHEMBL330116
8.40	Ki	4	nM	CHEMBL3407528

PubChem BioAssay actives

409 with measured affinity, of 877 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-(4-methoxyphenyl)-1H-pyrazolo[4,3-c]quinolin-3-one	40988: Inhibition on Benzodiazepine receptor	ic50	0.0001	uM
ethyl 4-(methoxymethyl)-5-phenylmethoxy-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0002	uM
ethyl 4-methyl-5-propan-2-yloxy-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0004	uM
2-phenyl-3aH-pyrazolo[4,3-c]quinolin-3-one	40988: Inhibition on Benzodiazepine receptor	ic50	0.0004	uM
ethyl 4-(methoxymethyl)-6-phenylmethoxy-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0005	uM
ethyl 4-(methoxymethyl)-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0005	uM
ethyl 6-methoxy-4-(methoxymethyl)-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0005	uM
ethyl 4-(methoxymethyl)-6-propoxy-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0005	uM
ethyl 6-hydroxy-4-(methoxymethyl)-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0005	uM
2-(4-chlorophenyl)-3aH-pyrazolo[4,3-c]quinolin-3-one	40988: Inhibition on Benzodiazepine receptor	ic50	0.0006	uM
5-[[3-(1,3-benzodioxol-5-yl)-6-iminopyridazin-1-yl]methyl]-1,2-thiazol-3-one;hydrobromide	72153: Affinity for gamma-aminobutyric-acid A receptor measured by its ability to displace [3H]gabazine antagonist from rat brain preparations.	ic50	0.0008	uM
propan-2-yl 16-(methoxymethyl)-3,6,11,14-tetrazatetracyclo[8.7.0.02,7.012,17]heptadeca-1(10),2,4,6,8,12,14,16-octaene-15-carboxylate	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0008	uM
propan-2-yl 4-(methoxymethyl)-6,9,14,21-tetrazapentacyclo[11.8.0.02,10.03,8.015,20]henicosa-1(21),2,4,6,8,10,12,15(20)-octaene-5-carboxylate	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0008	uM
propan-2-yl 15-(methoxymethyl)-4-propan-2-yl-5-oxa-10,13-diazatetracyclo[7.7.0.02,6.011,16]hexadeca-1(9),2(6),3,7,11,13,15-heptaene-14-carboxylate	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0008	uM
Clonazepam	239299: Displacement of [3H]flumazenil from bovine benzodiazepine receptor GABA-A channel of brain membranes	ki	0.0008	uM
15-(methoxymethyl)-14-(5-methyl-1,2-oxazol-3-yl)-4-propan-2-yl-5-oxa-3,10,13-triazatetracyclo[7.7.0.02,6.011,16]hexadeca-1(9),2(6),3,7,11,13,15-heptaene	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0009	uM
Flumazenil	239299: Displacement of [3H]flumazenil from bovine benzodiazepine receptor GABA-A channel of brain membranes	ki	0.0009	uM
ethyl 9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0010	uM
methyl 9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0010	uM
propyl 9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0010	uM
tert-butyl 9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0010	uM
7-chloro-5-methyl-3-(2-phenylethynyl)-4H-imidazo[1,5-a][1,4]benzodiazepin-6-one	1196597: Displacement of [3H]flumazenil from rat cortex GABAA receptor BDZ binding site expressed in HEK293 cells by competition binding assay	ki	0.0010	uM
6-bromo-2-(3-nitrophenyl)chromen-4-one	72729: Binding affinity towards benzodiazepine site in GABAA receptor	ki	0.0010	uM
(2-methoxyphenyl)methyl 8-chloro-5-oxido-3,3a-dihydropyrazolo[5,1-c][1,2,4]benzotriazin-5-ium-3-carboxylate	41860: Binding affinity towards Benzodiazepine receptor from bovine brain membrane using [3H]Ro-151788 as radioligand	ki	0.0010	uM
propan-2-yl 4-(methoxymethyl)-6-phenylmethoxy-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0010	uM
(2-methoxyphenyl)methyl 8-chloropyrazolo[5,1-c][1,2,4]benzotriazine-3-carboxylate	41860: Binding affinity towards Benzodiazepine receptor from bovine brain membrane using [3H]Ro-151788 as radioligand	ki	0.0017	uM
5-(aminomethyl)-1,2-oxazol-3-one	72155: Binding affinity in vivo for gamma-aminobutyric-acid A receptor measured by its ability to displace [3H]-GABA agonist from rat brain preparations after iv injection.	ic50	0.0020	uM
Fipronil	242615: In vitro insecticidal activity as inhibition of [3H]EBOB binding to Gamma-aminobutyric acid GABA-A receptor of housefly neuronal membranes	ic50	0.0023	uM
9-chloro-2-phenyl-6H-triazolo[1,2-a][1,2,4]benzotriazine-1,5-dione	239299: Displacement of [3H]flumazenil from bovine benzodiazepine receptor GABA-A channel of brain membranes	ki	0.0028	uM
7-chloro-5-(2-chlorophenyl)-1,3-dihydro-1,4-benzodiazepin-2-one	40974: In vitro displacement of [3H]-diazepam from GABA-A Benzodiazepine receptor	ic50	0.0028	uM
3-isothiocyanato-9H-pyrido[3,4-b]indole	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0030	uM
9H-pyrido[3,4-b]indole-3-carbonitrile	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0030	uM
3-(6,7-difluoro-1,3-benzoxazol-2-yl)-1,3a,4,5,6,7,8,8a-octahydrocyclohepta[d]imidazol-2-one	40986: Binding affinity against GABA-A benzodiazepine receptor	ki	0.0030	uM
(5aR,7R,9aS,11aS)-2-amino-7-hydroxy-9a,11a-dimethyl-3,3a,3b,4,5,5a,6,7,8,9,9b,11-dodecahydronaphtho[2,1-e]indol-10-one	72153: Affinity for gamma-aminobutyric-acid A receptor measured by its ability to displace [3H]gabazine antagonist from rat brain preparations.	ic50	0.0030	uM
3-propoxy-9H-pyrido[3,4-b]indole	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0030	uM
1-(9H-pyrido[3,4-b]indol-3-yl)butan-1-one	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0030	uM
8-fluoro-5-methyl-3-(2-phenylethynyl)-4H-imidazo[1,5-a][1,4]benzodiazepin-6-one	1196597: Displacement of [3H]flumazenil from rat cortex GABAA receptor BDZ binding site expressed in HEK293 cells by competition binding assay	ki	0.0040	uM
methyl 6-hydroxy-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0040	uM
2-phenyl-6H-[1,2,4]triazolo[1,5-c]quinazolin-5-one	40986: Binding affinity against GABA-A benzodiazepine receptor	ki	0.0040	uM
17-chloro-9,12,20-triazapentacyclo[11.7.0.02,10.03,8.014,19]icosa-1(13),2(10),3,5,7,11,14,16,18-nonaene	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0040	uM
5-nitro-9,12,20-triazapentacyclo[11.7.0.02,10.03,8.014,19]icosa-1(13),2(10),3,5,7,11,14,16,18-nonaene	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0040	uM
5-bromo-9,12,20-triazapentacyclo[11.7.0.02,10.03,8.014,19]icosa-1(13),2(10),3,5,7,11,14,16,18-nonaene	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0040	uM
17-methoxy-9,12,20-triazapentacyclo[11.7.0.02,10.03,8.014,19]icosa-1(13),2(10),3,5,7,11,14,16,18-nonaene	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0040	uM
9,12,20-triazapentacyclo[11.7.0.02,10.03,8.014,19]icosa-1(13),2(10),3,5,7,11,14,16,18-nonaene	1932305: Inhibition of GABAA receptor (unknown origin)	ic50	0.0040	uM
methyl 6-(benzylamino)-9H-pyrido[3,4-b]indole-3-carboxylate	1932290: Displacement of [3H]flunitrazepam from GABAA (unknown origin ) receptor by radioligand binding assay	ic50	0.0040	uM
Diazepam	1934094: Inhibition of GABA-A receptor (unknown origin)	ic50	0.0042	uM
4-acetyl-13-(4-chlorophenyl)-5-thia-13,14-diazatricyclo[8.4.0.02,6]tetradeca-1(10),2(6),3-trien-12-one	40977: Binding affinity for GABA-A Benzodiazepine receptor	ki	0.0042	uM
1-[2,6-dichloro-4-(trifluoromethyl)phenyl]-4-(trifluoromethylsulfinyl)pyrazole	242615: In vitro insecticidal activity as inhibition of [3H]EBOB binding to Gamma-aminobutyric acid GABA-A receptor of housefly neuronal membranes	ic50	0.0042	uM
2-amino-N-[4-chloro-2-(2-chlorobenzoyl)phenyl]acetamide	40974: In vitro displacement of [3H]-diazepam from GABA-A Benzodiazepine receptor	ic50	0.0048	uM
3-(7-fluoro-1,3-benzoxazol-2-yl)-1,3a,4,5,6,7,8,8a-octahydrocyclohepta[d]imidazol-2-one	40986: Binding affinity against GABA-A benzodiazepine receptor	ki	0.0050	uM

CTD chemical–gene interactions

34 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, decreases methylation	5
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression, affects expression	4
Tretinoin	decreases expression, increases expression	4
bisphenol A	affects expression, decreases expression, increases activity	3
Estradiol	affects expression, affects cotreatment, decreases expression, increases activity	3
mercuric bromide	increases expression, affects cotreatment	2
Ethinyl Estradiol	affects expression, decreases expression	2
Nickel	decreases expression	2
Progesterone	increases expression, affects cotreatment, decreases expression, affects localization, affects reaction	2
Tobacco Smoke Pollution	affects expression, decreases expression	2
trichostatin A	increases expression	1
cordycepin	decreases expression	1
tebuconazole	decreases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
(+)-JQ1 compound	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Zoledronic Acid	decreases expression	1
Panobinostat	affects cotreatment, increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	increases expression, affects cotreatment, increases abundance	1
Benzo(a)pyrene	decreases methylation, affects methylation	1
Cadmium	decreases expression, increases abundance	1
Calcitriol	increases expression	1
Copper	affects cotreatment, decreases expression	1
Cytarabine	increases expression	1
DDT	decreases expression, increases activity	1
Demecolcine	increases expression	1
Diethylhexyl Phthalate	increases expression	1

ChEMBL screening assays

185 unique, capped per target: 166 binding, 15 functional, 3 toxicity, 1 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3363914	Binding	Displacement of [3H]Muscimol from rat GABAA receptor at 10 uM after 90 mins by microbeta counting analysis	Griseorhodins D-F, neuroactive intermediates and end products of post-PKS tailoring modification in Griseorhodin biosynthesis. — *J Nat Prod*
CHEMBL4810229	ADMET	Inhibition of GABA A receptor (unknown origin) at 0.1 to 1 uM	Discovery of Pemigatinib: A Potent and Selective Fibroblast Growth Factor Receptor (FGFR) Inhibitor. — *J Med Chem*
CHEMBL5335653	Toxicity	Antagonist activity at GABA-A (unknown origin)	Discovery of a Novel Bifunctional Steroid Analog, YXG-158, as an Androgen Receptor Degrader and CYP17A1 Inhibitor for the Treatment of Enzalutamide-Resistant Prostate Cancer. — *J Med Chem*

Cellosaurus cell lines

1 cell lines: 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_YA49	IDG-HEK293T-GABRP-V5-OE	Transformed cell line	Female

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for GABRP across ~30M SureChEMBL compounds — explore on Sugi Predict.