GID8

Summary

GID8 (GID complex subunit 8 homolog, HGNC:15857) is a protein-coding gene on chromosome 20q13.33, encoding Glucose-induced degradation protein 8 homolog (Q9NWU2). Core component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1.

Predicted to enable protein homodimerization activity. Involved in positive regulation of canonical Wnt signaling pathway and positive regulation of cell population proliferation. Located in cell junction; cytosol; and nucleoplasm. Part of ubiquitin ligase complex.

Source: NCBI Gene 54994 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 28 total
• MANE Select transcript: NM_017896

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:15857
Approved symbol	GID8
Name	GID complex subunit 8 homolog
Location	20q13.33
Locus type	gene with protein product
Status	Approved
Aliases	FLJ20602, bA305P22.1, TWA1
Ensembl gene	ENSG00000101193
Ensembl biotype	protein_coding
OMIM	611625
Entrez	54994

Gene structure

Transcript identifiers

Ensembl transcripts: 21 — 20 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000266069, ENST00000497101, ENST00000874929, ENST00000874930, ENST00000874931, ENST00000874932, ENST00000874933, ENST00000874934, ENST00000874935, ENST00000874936, ENST00000874937, ENST00000874938, ENST00000939484, ENST00000939485, ENST00000939486, ENST00000939487, ENST00000939488, ENST00000939489, ENST00000947377, ENST00000947378, ENST00000947379

RefSeq mRNA: 1 — MANE Select: NM_017896 NM_017896

CCDS: CCDS13510

Canonical transcript exons

ENST00000266069 — 5 exons

Exon	Start	End
ENSE00000663347	62942987	62943183
ENSE00000663348	62943495	62943692
ENSE00000856539	62941491	62941620
ENSE00000856540	62944739	62948475
ENSE00001044068	62938147	62938253

Expression profiles

Bgee: expression breadth ubiquitous, 283 present calls, max score 96.44.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 38.0268 / max 185.4971, expressed in 1822 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
185775	19.1767	1806
185774	16.0679	1788
185776	1.7217	750
185778	0.8584	511
185777	0.2022	81

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
esophagus squamous epithelium	UBERON:0006920	96.44	gold quality
pharyngeal mucosa	UBERON:0000355	96.31	gold quality
epithelium of esophagus	UBERON:0001976	95.93	gold quality
tibia	UBERON:0000979	94.98	gold quality
penis	UBERON:0000989	94.85	gold quality
lower esophagus mucosa	UBERON:0035834	94.83	gold quality
palpebral conjunctiva	UBERON:0001812	94.30	gold quality
esophagus mucosa	UBERON:0002469	93.24	gold quality
nipple	UBERON:0002030	93.16	gold quality
epithelium of nasopharynx	UBERON:0001951	93.03	gold quality
squamous epithelium	UBERON:0006914	92.94	gold quality
superior surface of tongue	UBERON:0007371	92.25	gold quality
skin of abdomen	UBERON:0001416	92.19	gold quality
body of tongue	UBERON:0011876	91.95	gold quality
tongue	UBERON:0001723	91.93	gold quality
skin of leg	UBERON:0001511	91.87	gold quality
oocyte	CL:0000023	91.80	gold quality
cortical plate	UBERON:0005343	91.60	gold quality
zone of skin	UBERON:0000014	91.53	gold quality
amniotic fluid	UBERON:0000173	91.50	gold quality
gingiva	UBERON:0001828	91.45	gold quality
germinal epithelium of ovary	UBERON:0001304	91.37	gold quality
gingival epithelium	UBERON:0001949	91.29	gold quality
eye	UBERON:0000970	91.15	gold quality
ganglionic eminence	UBERON:0004023	91.03	gold quality
tongue squamous epithelium	UBERON:0006919	91.00	silver quality
parietal pleura	UBERON:0002400	90.86	gold quality
vagina	UBERON:0000996	90.74	gold quality
ovary	UBERON:0000992	90.62	gold quality
pleura	UBERON:0000977	90.61	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.68
E-GEOD-100618	no	286.82
E-MTAB-7249	no	253.84

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

122 targeting GID8, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-539-5P	99.93	70.30	2855
HSA-MIR-450B-5P	99.92	71.48	3175
HSA-MIR-1305	99.91	71.43	3443
HSA-MIR-3065-3P	99.87	70.25	1407
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-5582-3P	99.86	72.48	4221

Literature-anchored findings (GeneRIF, showing 3)

• The results identify Twa1 as a previously undescribed regulator of the Wnt pathway for promoting colorectal tumorigenesis by facilitating beta-catenin nuclear retention. (PMID:28829046)
• findings revealed that TWA1 plays an important role in the development of gastric cancer (PMID:31591053)
• YTHDF1 regulates GID8-mediated glutamine metabolism to promote colorectal cancer progression in m6A-dependent manner. (PMID:39151722)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	gid8a	ENSDARG00000022768
danio_rerio	gid8b	ENSDARG00000037589
mus_musculus	Gid8	ENSMUSG00000027573
rattus_norvegicus	Gid8	ENSRNOG00000082598
drosophila_melanogaster	Hou	FBGN0030944
caenorhabditis_elegans		WBGENE00018757

Paralogs (3): RANBP9 (ENSG00000010017), RANBP10 (ENSG00000141084), SPRYD3 (ENSG00000167778)

Protein

Protein identifiers

Glucose-induced degradation protein 8 homolog — Q9NWU2 (reviewed: Q9NWU2)

Alternative names: Two hybrid-associated protein 1 with RanBPM

All UniProt accessions (1): Q9NWU2

UniProt curated annotations — full annotation on UniProt →

Function. Core component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1. Acts as a positive regulator of Wnt signaling pathway by promoting beta-catenin (CTNNB1) nuclear accumulation.

Subunit / interactions. Homodimer; may also form higher oligomers. Identified in the CTLH complex that contains GID4, RANBP9 and/or RANBP10, MKLN1, MAEA, RMND5A (or alternatively its paralog RMND5B), GID8, ARMC8, WDR26 and YPEL5. Within this complex, MAEA, RMND5A (or alternatively its paralog RMND5B), GID8, WDR26, and RANBP9 and/or RANBP10 form the catalytic core, while GID4, MKLN1, ARMC8 and YPEL5 have ancillary roles. Interacts with RANBP9. Part of a complex consisting of RANBP9, MKLN1 and GID8. Interacts with CTNNB1, AXIN1 and GSK3B.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Up-regulated in colorectal cancer tissues (at protein level).

Post-translational modifications. Polyubiquitinated through ‘Lys-48’-polyubiquitin chains, leading to proteasomal degradation in the absence of Wnt stimulation.

Similarity. Belongs to the GID8 family.

RefSeq proteins (1): NP_060366* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006594	LisH	Conserved_site
IPR006595	CTLH_C	Domain
IPR013144	CRA_dom	Domain
IPR024964	CTLH/CRA	Domain
IPR050618	Ubq-SigPath_Reg	Family

Pfam: PF08513, PF10607

UniProt features (17 total): helix 8, turn 4, domain 2, chain 1, region of interest 1, sequence conflict 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
7NSC	ELECTRON MICROSCOPY	3.3

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9NWU2-F1	92.08	0.87

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9861718	Regulation of pyruvate metabolism

MSigDB gene sets: 126 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_UP, GSE18804_SPLEEN_MACROPHAGE_VS_TUMORAL_MACROPHAGE_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, DARWICHE_SKIN_TUMOR_PROMOTER_DN, DARWICHE_PAPILLOMA_RISK_LOW_DN, DARWICHE_PAPILLOMA_RISK_HIGH_DN, DARWICHE_SQUAMOUS_CELL_CARCINOMA_DN, GOBP_REGULATION_OF_WNT_SIGNALING_PATHWAY, GTGCCTT_MIR506, GOBP_CANONICAL_WNT_SIGNALING_PATHWAY, GOBP_POSITIVE_REGULATION_OF_CANONICAL_WNT_SIGNALING_PATHWAY, GOBP_PROTEASOMAL_PROTEIN_CATABOLIC_PROCESS, GOBP_POSITIVE_REGULATION_OF_WNT_SIGNALING_PATHWAY, BIDUS_METASTASIS_UP

GO Biological Process (4): positive regulation of cell population proliferation (GO:0008284), Wnt signaling pathway (GO:0016055), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), positive regulation of canonical Wnt signaling pathway (GO:0090263)

GO Molecular Function (2): protein homodimerization activity (GO:0042803), protein binding (GO:0005515)

GO Cellular Component (6): ubiquitin ligase complex (GO:0000151), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), cell junction (GO:0030054)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Pyruvate metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
cell surface receptor signaling pathway	1
ubiquitin-dependent protein catabolic process	1
proteasomal protein catabolic process	1
positive regulation of Wnt signaling pathway	1
canonical Wnt signaling pathway	1
regulation of canonical Wnt signaling pathway	1
identical protein binding	1
protein dimerization activity	1
binding	1
intracellular protein-containing complex	1
transferase complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
cytoplasm	1

Protein interactions and networks

STRING

720 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GID8	RMND5A	Q9H871	993
GID8	ARMC8	Q8IUR7	985
GID8	MKLN1	Q9UL63	984
GID8	GID4	Q8IVV7	934
GID8	WDR26	Q9H7D7	923
GID8	MPHOSPH8	Q99549	858
GID8	MAEA	Q7L5Y9	804
GID8	RMND5B	Q96G75	776
GID8	RANBP9	Q96S59	759
GID8	RANBP10	Q6VN20	727
GID8	YPEL5	P62699	691
GID8	PAFAH1B1	P43034	608
GID8	TPX2	Q9ULW0	598
GID8	SLCO6A1	Q86UG4	589
GID8	UBE2H	P37286	571

IntAct

163 interactions, top by confidence:

A	B	Type	Score
RMND5A	GID8	psi-mi:“MI:0915”(physical association)	0.880
GID8	MAEA	psi-mi:“MI:0914”(association)	0.730
ARMC8	GID8	psi-mi:“MI:0915”(physical association)	0.670
GID8	PGRMC2	psi-mi:“MI:0914”(association)	0.640
CCDC120	AIP	psi-mi:“MI:0914”(association)	0.640
CRIPTO	AIP	psi-mi:“MI:0914”(association)	0.640
NDUFS6	NDUFS8	psi-mi:“MI:0914”(association)	0.640
SLX4	ERCC1	psi-mi:“MI:0914”(association)	0.640
RANBP10	MAEA	psi-mi:“MI:0914”(association)	0.640
RANBP9	YPEL5	psi-mi:“MI:0914”(association)	0.640
PRG2	YPEL5	psi-mi:“MI:0914”(association)	0.640
CAMKV	AP3B1	psi-mi:“MI:0914”(association)	0.640
NCKIPSD	GEMIN2	psi-mi:“MI:0914”(association)	0.640
OSBPL5	NAGLU	psi-mi:“MI:0914”(association)	0.640
GID8	HTRA2	psi-mi:“MI:0914”(association)	0.610
INSL6	POTEF	psi-mi:“MI:0914”(association)	0.530
PRG3	ZNF324	psi-mi:“MI:0914”(association)	0.530
GPS2	DCTN6	psi-mi:“MI:0914”(association)	0.530
PIGT	ZNF609	psi-mi:“MI:0914”(association)	0.530
PRICKLE3	SIAH2	psi-mi:“MI:0914”(association)	0.530
BMP1	TLL1	psi-mi:“MI:0914”(association)	0.530
SPINK7	UBB	psi-mi:“MI:0914”(association)	0.530
NME1	NME2P1	psi-mi:“MI:0914”(association)	0.530

BioGRID (218): GID8 (Affinity Capture-RNA), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), GID8 (Affinity Capture-MS), RANBP10 (Co-fractionation), RANBP9 (Co-fractionation), GID8 (Proximity Label-MS), GID8 (Affinity Capture-MS)

ESM2 similar proteins: A4RK04, A7SWD3, A8NY27, B0WAM5, B3M4D9, B3NDH5, B4GR63, B4IXG1, B4KY00, B4KZ45, B4LEJ0, B4LG58, B4MX71, B4MYA1, B4N3B0, B4PK98, B4QMY7, O08700, O42897, O45228, O61820, O77410, P41810, P59015, P93043, P97390, Q10446, Q1HQY6, Q1MTP1, Q2F5R8, Q2M0S3, Q32L52, Q54B82, Q54X16, Q5B3U7, Q5ZKQ7, Q6FM46, Q7SI58, Q8VWK0, Q9C5Z3

Diamond homologs: A7SWD3, E7FGY2, F4HYD7, P69566, Q10446, Q28FM1, Q32L52, Q4Z8K6, Q54X16, Q5ZKQ7, Q6PC55, Q84WK5, Q96S59, Q9D7M1, Q9NWU2, Q9PTY5, Q6C435, Q0CA25, Q5F398, Q7S2X0, A1L252, Q1LUS8, Q2H991, Q3MHJ2, Q4R9A8, Q4VC33, Q5R532, Q5RKJ1, Q6GR10, Q7L5Y9, Q7SXR3, Q9URU9, A1C9R2, A1CZJ5, A2R9P6, A4RK04, Q0TYW1, Q1DTI6, Q4WTQ4, Q5AS80

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 177 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Regulation of pyruvate metabolism	9	41.1×	2e-10
Pyruvate metabolism	5	16.3×	5e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

28 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	21
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

857 predictions. Top by Δscore:

Variant	Effect	Δscore
20:62938252:CGGTA:C	donor_loss	1.0000
20:62938253:GGTAA:G	donor_loss	1.0000
20:62938254:G:GG	donor_gain	1.0000
20:62938254:GT:G	donor_loss	1.0000
20:62938255:T:G	donor_loss	1.0000
20:62941486:TGTA:T	acceptor_loss	1.0000
20:62941487:GTA:G	acceptor_loss	1.0000
20:62941488:TA:T	acceptor_loss	1.0000
20:62941489:A:AG	acceptor_gain	1.0000
20:62941489:A:T	acceptor_loss	1.0000
20:62941490:G:GA	acceptor_loss	1.0000
20:62941490:G:GG	acceptor_gain	1.0000
20:62941490:GA:G	acceptor_gain	1.0000
20:62941490:GAA:G	acceptor_gain	1.0000
20:62941490:GAAA:G	acceptor_gain	1.0000
20:62941490:GAAAT:G	acceptor_gain	1.0000
20:62941615:TCAC:T	donor_gain	1.0000
20:62941619:AG:A	donor_loss	1.0000
20:62941620:GG:G	donor_loss	1.0000
20:62941622:T:G	donor_loss	1.0000
20:62942986:GA:G	acceptor_gain	1.0000
20:62943183:GG:G	donor_loss	1.0000
20:62943185:T:A	donor_loss	1.0000
20:62943493:A:AG	acceptor_gain	1.0000
20:62943493:A:G	acceptor_loss	1.0000
20:62943494:G:GA	acceptor_gain	1.0000
20:62943494:GC:G	acceptor_gain	1.0000
20:62943494:GCA:G	acceptor_gain	1.0000
20:62943494:GCAAC:G	acceptor_gain	1.0000
20:62943688:AGAAG:A	donor_loss	1.0000

AlphaMissense

1513 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:62941612:T:C	L37P	1.000
20:62942989:G:C	G41R	1.000
20:62943014:T:C	F49S	1.000
20:62943514:T:C	L112P	1.000
20:62943520:G:C	R114P	1.000
20:62943625:T:C	L149P	1.000
20:62943633:T:C	F152L	1.000
20:62943635:T:A	F152L	1.000
20:62943635:T:G	F152L	1.000
20:62941597:T:C	L32P	0.999
20:62941600:T:A	I33N	0.999
20:62941612:T:A	L37Q	0.999
20:62942990:G:A	G41D	0.999
20:62942990:G:T	G41V	0.999
20:62942992:T:C	F42L	0.999
20:62942994:T:A	F42L	0.999
20:62942994:T:G	F42L	0.999
20:62943004:G:C	A46P	0.999
20:62943013:T:C	F49L	0.999
20:62943015:T:A	F49L	0.999
20:62943015:T:G	F49L	0.999
20:62943025:T:C	S53P	0.999
20:62943080:G:C	R71P	0.999
20:62943149:T:C	L94S	0.999
20:62943172:T:C	F102L	0.999
20:62943174:C:A	F102L	0.999
20:62943174:C:G	F102L	0.999
20:62943179:T:C	L104S	0.999
20:62943179:T:G	L104W	0.999
20:62943496:A:C	Q106P	0.999

dbSNP variants (sampled 300 via entrez): RS1000085881 (20:62937224 G>A,C), RS1000150377 (20:62938526 G>A), RS1000222345 (20:62945378 A>C,G,T), RS1000257014 (20:62942751 A>G), RS1000300119 (20:62942087 G>A), RS1000406723 (20:62948081 C>T), RS1000436885 (20:62941804 T>G), RS1000594939 (20:62948757 C>T), RS1000619885 (20:62947631 G>A), RS1000631277 (20:62942973 G>A,T), RS1000721950 (20:62946589 C>T), RS1000921633 (20:62938112 CCCGCCCCCGCCT>C,CCCGCCCCCGCCTCCGCCCCCGCCT), RS1000960473 (20:62938263 C>CG), RS1000995493 (20:62941251 G>C), RS1001315805 (20:62936828 C>T)

Disease associations

OMIM: gene MIM:611625 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST90000025_694	Appendicular lean mass	3.000000e-09
GCST90002393_466	Monocyte count	1.000000e-10

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004980	appendicular lean mass
EFO:0005091	monocyte count

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

18 total (human), top 18 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases abundance, decreases expression, affects cotreatment	3
TAK-243	increases sumoylation	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	decreases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, increases expression	1
Arsenic	increases abundance, affects cotreatment, decreases expression	1
Atrazine	decreases expression	1
Benzo(a)pyrene	affects methylation, increases methylation	1
Caffeine	decreases phosphorylation	1
Catechin	affects cotreatment, increases expression	1
Ivermectin	decreases expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Valproic Acid	affects expression	1
Aflatoxin B1	increases methylation	1
Cadmium Chloride	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.