GIPC3

Summary

GIPC3 (GIPC PDZ domain containing family member 3, HGNC:18183) is a protein-coding gene on chromosome 19p13.3, encoding PDZ domain-containing protein GIPC3 (Q8TF64). Required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion.

The protein encoded by this gene belongs to the GIPC family. Studies in mice suggest that this gene is required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion in the ear. Mutations in this gene are associated with autosomal recessive deafness.

Source: NCBI Gene 126326 — RefSeq curated summary.

At a glance

• Gene–disease (curated): nonsyndromic genetic hearing loss (Definitive, ClinGen) — +2 more curated relationships
• Clinical variants (ClinVar): 274 total — 14 pathogenic, 13 likely-pathogenic
• Phenotypes (HPO): 5
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• MANE Select transcript: NM_133261

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18183
Approved symbol	GIPC3
Name	GIPC PDZ domain containing family member 3
Location	19p13.3
Locus type	gene with protein product
Status	Approved
Aliases	DFNB95
Ensembl gene	ENSG00000179855
Ensembl biotype	protein_coding
OMIM	608792
Entrez	126326

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 3 protein_coding

ENST00000644452, ENST00000644946, ENST00000854561

RefSeq mRNA: 2 — MANE Select: NM_133261 NM_001411144, NM_133261

CCDS: CCDS32871, CCDS92487

Canonical transcript exons

ENST00000644452 — 6 exons

Exon	Start	End
ENSE00000664393	3586814	3586994
ENSE00000664394	3586495	3586680
ENSE00000876036	3589831	3589912
ENSE00000876037	3589443	3589555
ENSE00001282971	3590039	3593541
ENSE00003822946	3585478	3585822

Expression profiles

Bgee: expression breadth ubiquitous, 157 present calls, max score 80.72.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.0590 / max 5.2510, expressed in 29 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
173227	0.0590	29

Top tissues by expression

242 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
apex of heart	UBERON:0002098	80.72	gold quality
stromal cell of endometrium	CL:0002255	78.77	gold quality
lower esophagus muscularis layer	UBERON:0035833	77.87	gold quality
lower esophagus	UBERON:0013473	77.81	gold quality
smooth muscle tissue	UBERON:0001135	76.72	gold quality
lower esophagus mucosa	UBERON:0035834	73.03	gold quality
right coronary artery	UBERON:0001625	72.45	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	71.56	gold quality
right lung	UBERON:0002167	69.93	gold quality
omental fat pad	UBERON:0010414	69.58	gold quality
peritoneum	UBERON:0002358	69.55	gold quality
subcutaneous adipose tissue	UBERON:0002190	69.44	gold quality
tibial artery	UBERON:0007610	69.35	gold quality
popliteal artery	UBERON:0002250	69.34	gold quality
esophagus	UBERON:0001043	69.32	gold quality
adipose tissue of abdominal region	UBERON:0007808	69.29	gold quality
metanephros cortex	UBERON:0010533	69.19	gold quality
upper lobe of left lung	UBERON:0008952	68.91	gold quality
descending thoracic aorta	UBERON:0002345	68.70	gold quality
aorta	UBERON:0000947	68.56	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	68.54	gold quality
small intestine Peyer’s patch	UBERON:0003454	68.46	gold quality
left coronary artery	UBERON:0001626	68.37	gold quality
coronary artery	UBERON:0001621	68.08	gold quality
heart left ventricle	UBERON:0002084	68.04	gold quality
metanephros	UBERON:0000081	67.96	gold quality
right lobe of thyroid gland	UBERON:0001119	67.94	gold quality
small intestine	UBERON:0002108	67.70	gold quality
cardiac ventricle	UBERON:0002082	67.68	gold quality
thoracic aorta	UBERON:0001515	67.67	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.91

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

160 targeting GIPC3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-518D-5P	100.00	67.51	979
HSA-MIR-518E-5P	100.00	67.66	954
HSA-MIR-518F-5P	100.00	67.51	979
HSA-MIR-519A-5P	100.00	67.66	954
HSA-MIR-519B-5P	100.00	67.66	954
HSA-MIR-519C-5P	100.00	67.66	954
HSA-MIR-520C-5P	100.00	67.51	979
HSA-MIR-522-5P	100.00	67.66	954
HSA-MIR-523-5P	100.00	67.66	954
HSA-MIR-526A-5P	100.00	67.51	979
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-520G-5P	99.99	66.76	658
HSA-MIR-23B-5P	99.98	66.07	587
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-23A-5P	99.94	65.39	468
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-6753-3P	99.93	66.57	637
HSA-MIR-7107-3P	99.93	66.73	627
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-3151-5P	99.86	63.83	1069
HSA-MIR-3180-5P	99.82	69.12	2422
HSA-MIR-1299	99.77	71.24	2389
HSA-MIR-4320	99.75	65.80	793
HSA-MIR-378G	99.71	64.90	1106
HSA-MIR-29B-2-5P	99.67	68.98	1726

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 10)

• Molecular cloning and characterization of human GIPC3, a novel gene homologous to human GIPC1 and GIPC2 (PMID:11836571)
• DFNB72 is telomeric to DFNB68, the only other known deafness locus with statistically significant support for linkage to chromosome 19p. (PMID:17690910)
• A maximum 2-point LOD score of 3.08 was obtained for the marker D19S586. The region overlaps with the recessive locus DFNB15. (PMID:18066515)
• Gipc3 plays a pivotal role in acoustic signal acquisition and propagation in cochlear hair cells, while mutations are associated with audiogenic seizures and sensorineural hearing loss. (PMID:21326233)
• Haplotype analysis excluded GIPC3 from the obligate linkage interval in this family and defined a novel locus spanning 4.08 Mb and 104 genes. (PMID:21660509)
• This study identified a novel causative mutation in GIPC3 for congenital nonsyndromic hearing loss in a consanguineous family from Saudi Arabia. (PMID:23510777)
• This study expands the mutational spectrum of GIPC3 in autosomal recessive nonsyndromic hearing impairment. (PMID:25296581)
• This study is the first report of the contribution of theGIPC3 gene to hearing loss in the Iranian population (PMID:29605370)
• Low incidence of GIPC3 variants among the prelingual hearing impaired from southern India. (PMID:33168789)
• Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population. (PMID:34071867)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	gipc3	ENSDARG00000053074
mus_musculus	Gipc3	ENSMUSG00000034872
rattus_norvegicus	Gipc3	ENSRNOG00000087702
drosophila_melanogaster	kermit	FBGN0010504
caenorhabditis_elegans		WBGENE00009681
caenorhabditis_elegans		WBGENE00016440

Paralogs (2): GIPC1 (ENSG00000123159), GIPC2 (ENSG00000137960)

Protein

Protein identifiers

PDZ domain-containing protein GIPC3 — Q8TF64 (reviewed: Q8TF64)

All UniProt accessions (2): A0A2R8Y651, Q8TF64

UniProt curated annotations — full annotation on UniProt →

Function. Required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion.

Tissue specificity. Widely expressed in adult and fetal tissues. Highest levels are found in jejunum, lymph node, parietal lobe, fetal spleen and fetal thymus. Expressed in cervical, melanoma, chronic myelogenous and gastric cancer cell lines.

Disease relevance. Deafness, autosomal recessive, 15 (DFNB15) [MIM:601869] A form of non-syndromic sensorineural hearing loss with prelingual onset. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the GIPC family.

RefSeq proteins (2): NP_001398073, NP_573568* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001478	PDZ	Domain
IPR017379	GIPC1/2/3	Family
IPR036034	PDZ_sf	Homologous_superfamily
IPR055349	GH2_GIPC	Domain
IPR056814	GIPC1-3_GH1	Domain

Pfam: PF00595, PF25082, PF25083

UniProt features (12 total): sequence variant 7, compositionally biased region 2, chain 1, domain 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8TF64-F1	85.45	0.68

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 92 (showing top): CCCNNGGGAR_OLF1_01, chr19p13, MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3, MEISSNER_NPC_HCP_WITH_H3K4ME2, ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY, MIR4492, MIR1299, MIR3180_5P, MIR4505, MIR5787, MIR4731_5P, MIR4498, MIR1285_3P, MIR5189_5P, MIR762

GO Biological Process (0):

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	1

Protein interactions and networks

STRING

466 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GIPC3	ZNRF4	Q8WWF5	765
GIPC3	MYO1F	O00160	685
GIPC3	GRXCR1	A8MXD5	682
GIPC3	LOXHD1	Q8IVV2	609
GIPC3	RGS19	P49795	596
GIPC3	TMPRSS3	P57727	596
GIPC3	MYO3A	Q8NEV4	593
GIPC3	TMC1	Q8TDI8	592
GIPC3	TPRN	Q4KMQ1	584
GIPC3	MYO15A	Q9UKN7	584
GIPC3	OTOA	Q7RTW8	583
GIPC3	E9PNW1	E9PNW1	582
GIPC3	PJVK	Q0ZLH3	549
GIPC3	TMIE	Q8NEW7	544
GIPC3	PTPRS	Q13332	543

IntAct

33 interactions, top by confidence:

A	B	Type	Score
GIPC3	ST6GAL2	psi-mi:“MI:0915”(physical association)	0.560
GIPC3	PLEKHA2	psi-mi:“MI:0915”(physical association)	0.560
GIPC1	APPL2	psi-mi:“MI:0914”(association)	0.480
DOCK4	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
ABCC4	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
ARHGEF16	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
ASIC3	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
ATP2B4	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
CYSLTR2	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
DGKK	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
DGKZ	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
FRMPD4	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
FZD7	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
GIPC3	TAMALIN	psi-mi:“MI:0407”(direct interaction)	0.440
E6	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
ORF putative E6	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
KCNA5	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
KIR3DL3	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
GIPC3	MAP2K2	psi-mi:“MI:0407”(direct interaction)	0.440
PBK	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
RALBP1	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
RASSF6	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
SLC15A5	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
SLCO1C1	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
TJP2	GIPC3	psi-mi:“MI:0407”(direct interaction)	0.440
ST6GAL2	GIPC3	psi-mi:“MI:0915”(physical association)	0.000
PLEKHA2	GIPC3	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (8): GIPC3 (Affinity Capture-RNA), GIPC3 (Affinity Capture-RNA), GIPC3 (Affinity Capture-RNA), GIPC3 (Two-hybrid), GIPC3 (Two-hybrid), GIPC3 (Affinity Capture-MS), GIPC3 (Negative Genetic), RRP7A (Cross-Linking-MS (XL-MS))

ESM2 similar proteins: A0JN27, A2ADY9, D3K5L7, D3Z7P3, E2R222, G3MWR8, O70133, O94925, O94973, P13264, P18484, P97834, Q06AT3, Q08211, Q0VCK5, Q13042, Q13098, Q15645, Q28141, Q28F89, Q2KI56, Q2TBV5, Q3MHJ2, Q3UA06, Q497D6, Q5NVP9, Q5R874, Q5RBN9, Q5TDH0, Q5XHZ9, Q5XIT1, Q5ZJB7, Q6AYU1, Q6NRB5, Q6NRT5, Q6PER3, Q6TH22, Q7RTP6, Q7ZYA7, Q86TJ2

Diamond homologs: O14908, Q1JQD4, Q498D9, Q8R5M0, Q8TF64, Q8TF65, Q9Z0G0, Q9Z254, Q9Z2H7

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

274 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	14
Likely pathogenic	13
Uncertain significance	115
Likely benign	86
Benign	19

Top pathogenic / likely-pathogenic (27)

Variant ID	HGVS	Classification
1452886	NM_133261.3(GIPC3):c.121_122del (p.Thr41fs)	Pathogenic
179296	NC_000019.10:g.3586548_3586564del	Pathogenic
228349	NM_133261.3(GIPC3):c.411+1G>A	Pathogenic
30753	NM_133261.3(GIPC3):c.785T>G (p.Leu262Arg)	Pathogenic
30754	NM_133261.3(GIPC3):c.903G>A (p.Trp301Ter)	Pathogenic
30755	NM_133261.3(GIPC3):c.685dup (p.Ala229fs)	Pathogenic
30756	NM_133261.3(GIPC3):c.767G>A (p.Gly256Asp)	Pathogenic
30757	NM_133261.3(GIPC3):c.136G>A (p.Gly46Arg)	Pathogenic
30758	NM_133261.3(GIPC3):c.565C>T (p.Arg189Cys)	Pathogenic
4683138	NM_133261.3(GIPC3):c.356_357del (p.Glu119fs)	Pathogenic
4694492	NM_133261.3(GIPC3):c.19del (p.Arg7fs)	Pathogenic
4744368	NM_133261.3(GIPC3):c.513C>A (p.Tyr171Ter)	Pathogenic
627446	NM_133261.3(GIPC3):c.724G>T (p.Glu242Ter)	Pathogenic
871900	NM_133261.3(GIPC3):c.662C>T (p.Thr221Ile)	Pathogenic
1185057	NM_133261.3(GIPC3):c.3_594del (p.Met1fs)	Likely pathogenic
3044838	NM_133261.3(GIPC3):c.350del (p.Lys117fs)	Likely pathogenic
3065869	NM_133261.3(GIPC3):c.592+2T>C	Likely pathogenic
3341064	NM_133261.3(GIPC3):c.226-2A>G	Likely pathogenic
3367081	NM_133261.3(GIPC3):c.87del (p.Ala30fs)	Likely pathogenic
3601136	NM_133261.3(GIPC3):c.281dup (p.Gln95fs)	Likely pathogenic
3601137	NM_133261.3(GIPC3):c.331A>T (p.Lys111Ter)	Likely pathogenic
3601138	NM_133261.3(GIPC3):c.466_476del (p.Ser156fs)	Likely pathogenic
3601139	NM_133261.3(GIPC3):c.766G>A (p.Gly256Ser)	Likely pathogenic
3601140	NM_133261.3(GIPC3):c.788C>A (p.Ala263Glu)	Likely pathogenic
3777249	NM_133261.3(GIPC3):c.415del (p.Ile139fs)	Likely pathogenic
4086564	NM_133261.3(GIPC3):c.146dup (p.Lys51fs)	Likely pathogenic
620637	NM_133261.3(GIPC3):c.400G>A (p.Ala134Thr)	Likely pathogenic

SpliceAI

716 predictions. Top by Δscore:

Variant	Effect	Δscore
19:3585820:GAG:G	donor_gain	1.0000
19:3585822:GGT:G	donor_loss	1.0000
19:3585823:G:GG	donor_gain	1.0000
19:3585824:T:A	donor_loss	1.0000
19:3586488:C:CA	acceptor_gain	1.0000
19:3586489:G:A	acceptor_gain	1.0000
19:3586987:GGCCT:G	donor_gain	1.0000
19:3589439:CCA:C	acceptor_loss	1.0000
19:3589440:CA:C	acceptor_loss	1.0000
19:3589441:A:AC	acceptor_loss	1.0000
19:3589441:A:AG	acceptor_gain	1.0000
19:3589442:G:GG	acceptor_gain	1.0000
19:3589442:GAT:G	acceptor_gain	1.0000
19:3589442:GATAT:G	acceptor_gain	1.0000
19:3589553:GCG:G	donor_gain	1.0000
19:3589818:C:CA	acceptor_gain	1.0000
19:3589820:T:TA	acceptor_gain	1.0000
19:3589822:T:TA	acceptor_gain	1.0000
19:3589829:A:AG	acceptor_gain	1.0000
19:3589830:G:GC	acceptor_gain	1.0000
19:3589830:GC:G	acceptor_gain	1.0000
19:3589830:GCC:G	acceptor_gain	1.0000
19:3589830:GCCCA:G	acceptor_gain	1.0000
19:3589908:GCTGG:G	donor_gain	1.0000
19:3589909:C:G	donor_gain	1.0000
19:3589910:TGGGT:T	donor_loss	1.0000
19:3589911:GG:G	donor_gain	1.0000
19:3589911:GGGTA:G	donor_loss	1.0000
19:3589912:GG:G	donor_gain	1.0000
19:3589913:G:GG	donor_gain	1.0000

AlphaMissense

2031 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:3585712:T:C	F39L	1.000
19:3585714:C:A	F39L	1.000
19:3585714:C:G	F39L	1.000
19:3585760:T:C	F55L	1.000
19:3585761:T:C	F55S	1.000
19:3585762:C:A	F55L	1.000
19:3585762:C:G	F55L	1.000
19:3585779:T:C	L61P	1.000
19:3586501:T:C	F78L	1.000
19:3586503:C:A	F78L	1.000
19:3586503:C:G	F78L	1.000
19:3586504:T:C	C79R	1.000
19:3586506:C:G	C79W	1.000
19:3586574:T:A	I102N	1.000
19:3586576:T:C	F103L	1.000
19:3586578:T:A	F103L	1.000
19:3586578:T:G	F103L	1.000
19:3586580:C:A	A104D	1.000
19:3586637:G:A	G123E	1.000
19:3586640:T:C	L124P	1.000
19:3586646:T:A	I126N	1.000
19:3586646:T:G	I126S	1.000
19:3586651:G:C	D128H	1.000
19:3586652:A:T	D128V	1.000
19:3586656:C:A	N129K	1.000
19:3586656:C:G	N129K	1.000
19:3586672:T:C	F135L	1.000
19:3586674:C:A	F135L	1.000
19:3586674:C:G	F135L	1.000
19:3586676:T:A	I136N	1.000

dbSNP variants (sampled 300 via entrez): RS1000020360 (19:3593153 C>G,T), RS1000022481 (19:3583676 T>C), RS1000081103 (19:3588000 TTTTTAA>T), RS1000353076 (19:3592257 T>C), RS1000389576 (19:3587235 C>T), RS1000536431 (19:3587782 C>A), RS1000649687 (19:3584317 C>T), RS1000722205 (19:3588658 A>C), RS1000936915 (19:3583969 C>A), RS1000968622 (19:3592771 GTTCTGGAACCCAGCCTGT>G,GTTCTGGAACCCAGCCTGTTTCTGGAACCCAGCCTGT), RS1001539166 (19:3585071 C>A,T), RS1002051988 (19:3585232 A>G), RS1002290272 (19:3590861 G>A), RS1002656556 (19:3586063 C>T), RS1002952218 (19:3585842 G>A,T)

Disease associations

OMIM: gene MIM:608792 | disease phenotypes: MIM:601869, MIM:220290, MIM:607197

GenCC curated gene-disease

Disease	Classification	Inheritance
nonsyndromic genetic hearing loss	Definitive	Autosomal recessive
autosomal recessive nonsyndromic hearing loss 15	Strong	Autosomal recessive
hearing loss, autosomal recessive	Supportive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
nonsyndromic genetic hearing loss	Definitive	AR

Mondo (5): autosomal recessive nonsyndromic hearing loss 15 (MONDO:0011160), hearing loss disorder (MONDO:0005365), nonsyndromic genetic hearing loss (MONDO:0019497), sensorineural hearing loss disorder (MONDO:0020678), hearing loss, autosomal recessive (MONDO:0019588)

Orphanet (4): Rare autosomal recessive non-syndromic sensorineural deafness type DFNB (Orphanet:90636), Rare genetic deafness (Orphanet:96210), Rare non-syndromic genetic deafness (Orphanet:87884), Rare autosomal dominant non-syndromic sensorineural deafness type DFNA (Orphanet:90635)

HPO phenotypes

5 total (5 of 5 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000399	Prelingual sensorineural hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000505	Visual impairment
HP:0001751	Abnormal vestibular function

GWAS associations

0 associations (top):

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D034381	Hearing Loss	C09.218.458.341; C10.597.751.418.341; C23.888.592.763.393.341
C564609	Deafness, Autosomal Recessive (supp.)
C566611	Deafness, Autosomal Recessive 15 (supp.)
C580334	Nonsyndromic Deafness (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

17 total (human), top 17 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sotorasib	affects cotreatment, decreases expression	1
triphenyl phosphate	affects expression	1
ethyl-p-hydroxybenzoate	decreases expression	1
sulforaphane	decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	increases expression	1
trametinib	affects cotreatment, decreases expression	1
(+)-JQ1 compound	decreases expression	1
NVP-BKM120	affects cotreatment, decreases expression	1
Benzo(a)pyrene	increases methylation	1
Diethylhexyl Phthalate	decreases expression	1
Doxorubicin	decreases expression	1
Gallic Acid	decreases expression	1
Lipopolysaccharides	affects cotreatment, decreases expression	1
1-Methyl-4-phenylpyridinium	increases expression	1
Antirheumatic Agents	increases expression	1

Clinical trials (associated diseases)

301 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00205881	PHASE4	COMPLETED	Bilateral Benefit in Adult Users of the HiRes 90K Bionic Ear System
NCT00331539	PHASE4	UNKNOWN	Relationship Between Auto NRT and Behavioural T & C Levels With the Nucleus Freedom Cochlear Implant
NCT00424307	PHASE4	UNKNOWN	Bilateral Cochlear Implant Benefit in Young Children
NCT00765635	PHASE4	COMPLETED	Chlorobutanol, Potassium Carbonate, and Irrigation in Cerumen Removal
NCT03321006	PHASE4	COMPLETED	Treating Hearing Loss to Improve Mood and Cognition in Older Adults
NCT01499901	PHASE3	WITHDRAWN	Comparison of the Bilateral Sequential and Simultaneous Cochlear Implantation in the Deaf Children
NCT02561091	PHASE3	COMPLETED	AM-111 in the Treatment of Acute Inner Ear Hearing Loss
NCT03331627	PHASE3	COMPLETED	Safety and Efficacy of STR001-IT and STR001-ER in Patients With SSHL
NCT05532657	PHASE3	ACTIVE_NOT_RECRUITING	ACHIEVE Brain Health Follow-Up Study
NCT00013455	PHASE2	COMPLETED	Quantifying Auditory Perceptual Learning Following Hearing Aid Fitting
NCT00323427	PHASE2	COMPLETED	Clinical Trial of the Living Well With Hearing Loss Workshop
NCT00552786	PHASE2	COMPLETED	Antioxidation Medication for Noise-induced Hearing Loss
NCT00802425	PHASE2	COMPLETED	Efficacy of AM-111 in Patients With Acute Sensorineural Hearing Loss
NCT01139281	PHASE2	COMPLETED	The Protective Effect of Ginkgo Biloba Extract on Cisplatin-induced Ototoxicity in Humans
NCT01451853	PHASE2	UNKNOWN	SPI-1005 for Prevention and Treatment of Chemotherapy Induced Hearing Loss
NCT01588925	PHASE2	COMPLETED	Hearing Preservation Using Dexamethasone and Hyaluronic Acid for Cochlear Implantation
NCT01773278	PHASE2	RECRUITING	Cholesterol and Antioxidant Treatment in Patients With Smith-Lemli-Opitz Syndrome (SLOS)
NCT02832128	PHASE2	COMPLETED	Evaluating Possible Improvement in Speech and Hearing Tests After 28 Days of Dosing of the Study Drug AUT00063 Compared to Placebo (QuicKfire)
NCT04915183	PHASE2	RECRUITING	Atorvastatin to Reduce Cisplatin-Induced Hearing Loss Among Individuals With Head and Neck Cancer
NCT05258773	PHASE2	COMPLETED	Evaluation of the Presence of SENS-401 in the Perilymph
NCT06340633	PHASE2	RECRUITING	SPI-1005 in Adults Receiving Cochlear Implant
NCT00582946	PHASE1	COMPLETED	Wide-Bandwidth Open Canal Hearing Aid For Better Multitalker Speech Understanding
NCT00584155	PHASE1	WITHDRAWN	Protection From Cisplatin Ototoxicity by Lactated Ringers
NCT01206829	PHASE1	UNKNOWN	Hearing Impairment, Cognitive Therapy and Coping
NCT01256229	PHASE1	COMPLETED	Outcomes In Children With Developmental Delay And Deafness
NCT01343394	PHASE1	WITHDRAWN	Safety of Autologous Human Umbilical Cord Blood Mononuclear Fraction to Treat Acquired Hearing Loss in Children
NCT01452607	PHASE1	COMPLETED	Study to Evaluate the Safety and Pharmacokinetics of SPI-1005
NCT02259595	PHASE1	COMPLETED	Study to Determine the Safety, Tolerability, and Pharmacokinetic Profile of HPN-07 and HPN-07 Plus NAC
NCT04041440	PHASE1	COMPLETED	Speech Recognition Training in Children With Hearing Loss
NCT07218913	PHASE1	RECRUITING	Testing the Addition of Pedmark to Cisplatin Chemotherapy for Reducing Drug-Induced Ear Damage in Men With Stage II-III Metastatic Testicular Germ Cell Tumors
NCT01802190	Not specified	TERMINATED	Prevalence of POU4F3 and SLC17A8 Mutations
NCT00486577	PHASE2/PHASE3	COMPLETED	Chronic Electrical Stimulation of the Auditory Cortex for Intractable Tinnitus
NCT00789061	PHASE2/PHASE3	UNKNOWN	Applying Proton Pump Inhibitor to Prevent and Treat Acute Fluctuating Hearing Loss in Patients With SLC26A4 Mutation
NCT01423409	PHASE2/PHASE3	COMPLETED	Multicenter Trial Assessing an Innovative VAS of Pain Among Deaf People
NCT05786378	PHASE2/PHASE3	UNKNOWN	Assessment of The Efficacy of Intratympanic Platelet Rich Plasma for Treatment of Sensorineural Hearing Loss.
NCT01108601	PHASE1/PHASE2	UNKNOWN	Transtympanic Ringer’s Lactate for the Prevention of Cisplatin Ototoxicity
NCT01621256	PHASE1/PHASE2	COMPLETED	Efficacy, Safety, and Tolerability of Ancrod in Patients With Sudden Hearing Loss
NCT06370351	PHASE1/PHASE2	RECRUITING	A Phase I/II Clinical Trial with SENS-501 in Children Suffering from Severe to Profound Hearing Loss Due to Otoferlin (OTOF) Mutations
NCT06545175	PHASE1/PHASE2	RECRUITING	Intracochlear Application of VSF1.01 for the Reduction of Cochlear Implant Surgery Related Trauma
NCT07304024	PHASE1/PHASE2	RECRUITING	A Treatment for a Form of Age-Related Central Auditory Processing Disorder Consisting of Clemastine Fumarate Plus Engineered Sound