GLCCI1
geneOn this page
Also known as GIG18FAM117CTSSN1
Summary
GLCCI1 (glucocorticoid induced 1, HGNC:18713) is a protein-coding gene on chromosome 7p21.3, encoding Glucocorticoid-induced transcript 1 protein (Q86VQ1).
This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients.
Source: NCBI Gene 113263 — RefSeq curated summary.
At a glance
- Gene–disease (curated): glucocorticoid therapy, response to (Limited, GenCC)
- GWAS associations: 28
- Clinical variants (ClinVar): 120 total
- MANE Select transcript:
NM_138426
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:18713 |
| Approved symbol | GLCCI1 |
| Name | glucocorticoid induced 1 |
| Location | 7p21.3 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | GIG18, FAM117C, TSSN1 |
| Ensembl gene | ENSG00000106415 |
| Ensembl biotype | protein_coding |
| OMIM | 614283 |
| Entrez | 113263 |
Gene structure
Transcript identifiers
Ensembl transcripts: 18 — 9 protein_coding, 5 retained_intron, 3 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay
ENST00000223145, ENST00000414914, ENST00000430798, ENST00000438949, ENST00000460897, ENST00000470583, ENST00000474269, ENST00000482540, ENST00000489405, ENST00000491947, ENST00000492797, ENST00000496617, ENST00000865612, ENST00000865613, ENST00000924963, ENST00000924964, ENST00000924965, ENST00000951620
RefSeq mRNA: 1 — MANE Select: NM_138426
NM_138426
CCDS: CCDS34601
Canonical transcript exons
ENST00000223145 — 8 exons
| Exon | Start | End |
|---|---|---|
| ENSE00000671300 | 8084897 | 8085017 |
| ENSE00001854467 | 8086193 | 8089080 |
| ENSE00001901274 | 7968796 | 7969807 |
| ENSE00003461666 | 8055433 | 8055549 |
| ENSE00003502463 | 8003908 | 8004059 |
| ENSE00003502481 | 8022483 | 8022569 |
| ENSE00003516746 | 8070921 | 8071131 |
| ENSE00003694087 | 8060096 | 8060248 |
Expression profiles
Bgee: expression breadth ubiquitous, 255 present calls, max score 99.40.
FANTOM5 (CAGE): breadth ubiquitous, TPM avg 9.7435 / max 148.4644, expressed in 1480 samples.
FANTOM5 promoters (5 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 77209 | 5.9387 | 1327 |
| 77210 | 3.3751 | 946 |
| 77214 | 0.1873 | 98 |
| 77208 | 0.1573 | 73 |
| 77217 | 0.0852 | 23 |
Top tissues by expression
257 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| thymus | UBERON:0002370 | 99.40 | gold quality |
| secondary oocyte | CL:0000655 | 98.50 | gold quality |
| oocyte | CL:0000023 | 98.37 | gold quality |
| ventricular zone | UBERON:0003053 | 96.41 | gold quality |
| cerebellar vermis | UBERON:0004720 | 96.16 | gold quality |
| pylorus | UBERON:0001166 | 95.96 | gold quality |
| bone marrow cell | CL:0002092 | 95.53 | gold quality |
| sperm | CL:0000019 | 95.11 | gold quality |
| lower lobe of lung | UBERON:0008949 | 94.99 | gold quality |
| tibia | UBERON:0000979 | 94.52 | gold quality |
| thyroid gland | UBERON:0002046 | 93.59 | gold quality |
| epithelium of nasopharynx | UBERON:0001951 | 93.52 | gold quality |
| amniotic fluid | UBERON:0000173 | 93.51 | gold quality |
| trabecular bone tissue | UBERON:0002483 | 93.51 | gold quality |
| nasopharynx | UBERON:0001728 | 93.50 | gold quality |
| left lobe of thyroid gland | UBERON:0001120 | 93.38 | gold quality |
| right lobe of thyroid gland | UBERON:0001119 | 92.86 | gold quality |
| trachea | UBERON:0003126 | 92.84 | gold quality |
| ganglionic eminence | UBERON:0004023 | 92.69 | gold quality |
| embryo | UBERON:0000922 | 92.68 | gold quality |
| Brodmann (1909) area 23 | UBERON:0013554 | 92.50 | gold quality |
| parotid gland | UBERON:0001831 | 92.43 | gold quality |
| bone marrow | UBERON:0002371 | 92.15 | gold quality |
| ileal mucosa | UBERON:0000331 | 91.99 | gold quality |
| nipple | UBERON:0002030 | 91.99 | gold quality |
| cortical plate | UBERON:0005343 | 91.98 | gold quality |
| upper leg skin | UBERON:0004262 | 91.85 | gold quality |
| synovial joint | UBERON:0002217 | 91.75 | gold quality |
| occipital lobe | UBERON:0002021 | 91.36 | gold quality |
| bronchus | UBERON:0002185 | 91.35 | gold quality |
Single-cell (SCXA)
Detected in 4 experiment(s), a significant marker in 3.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-CURD-119 | yes | 33.54 |
| E-ANND-3 | yes | 24.23 |
| E-GEOD-93593 | yes | 7.67 |
| E-MTAB-6075 | no | 417.91 |
Regulation
Is transcription factor: no
Upstream regulators (CollecTRI, top): AR, NR3C1
miRNA regulators (miRDB)
251 targeting GLCCI1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-8485 | 100.00 | 77.57 | 4731 |
| HSA-MIR-30A-5P | 100.00 | 76.31 | 3233 |
| HSA-MIR-30B-5P | 100.00 | 76.29 | 3248 |
| HSA-MIR-30C-5P | 100.00 | 76.29 | 3248 |
| HSA-MIR-30D-5P | 100.00 | 76.32 | 3233 |
| HSA-MIR-30E-5P | 100.00 | 76.32 | 3242 |
| HSA-LET-7A-3P | 100.00 | 74.03 | 3932 |
| HSA-LET-7B-3P | 100.00 | 74.08 | 3913 |
| HSA-LET-7F-1-3P | 100.00 | 74.02 | 3928 |
| HSA-MIR-98-3P | 100.00 | 74.08 | 3907 |
| HSA-MIR-4262 | 100.00 | 73.26 | 3931 |
| HSA-MIR-200B-3P | 100.00 | 73.31 | 2693 |
| HSA-MIR-200C-3P | 100.00 | 73.35 | 2685 |
| HSA-MIR-429 | 100.00 | 73.44 | 2698 |
| HSA-MIR-5011-5P | 100.00 | 83.46 | 5820 |
| HSA-MIR-4682 | 100.00 | 68.89 | 1258 |
| HSA-MIR-5692A | 100.00 | 74.40 | 6850 |
| HSA-MIR-1277-5P | 100.00 | 73.95 | 5056 |
| HSA-MIR-3163 | 100.00 | 77.23 | 8605 |
| HSA-MIR-3924 | 100.00 | 72.09 | 2394 |
| HSA-MIR-33A-5P | 99.99 | 68.62 | 1055 |
| HSA-MIR-33B-5P | 99.99 | 68.58 | 1062 |
| HSA-MIR-181A-5P | 99.99 | 72.96 | 2995 |
| HSA-MIR-181B-5P | 99.99 | 72.97 | 2996 |
| HSA-MIR-181C-5P | 99.99 | 72.95 | 2996 |
| HSA-MIR-181D-5P | 99.99 | 73.04 | 2997 |
| HSA-MIR-4282 | 99.99 | 75.36 | 6408 |
| HSA-MIR-3185 | 99.99 | 68.12 | 1959 |
| HSA-MIR-3662 | 99.99 | 73.82 | 5684 |
| HSA-MIR-4803 | 99.98 | 71.99 | 3117 |
Literature-anchored findings (GeneRIF, showing 25)
- A functional GLCCI1 variant is associated with substantial decrements in the response to inhaled glucocorticoids in patients with asthma. (PMID:21991891)
- Variation at GLCCI1 and FCER2 could lead personalized asthma treatment. (PMID:22304573)
- GLCCI1 nucleotide polymorphisms associated with steroid-responsiveness in asthmatic patients are unlikely to have a clinically actionable impact in pediatric nephrotic syndrome. (PMID:22660954)
- Studied the influence of GLCCI1 SNP rs37972 on dexamethasone efficacy in bacterial meningitis patients.Results show rs37972 in GLCCI1 is associated with death in patients with CA bacterial meningitis treated with adjunctive dexamethasone therapy. (PMID:22796022)
- Novel association was found between intraocular pressure and a common variant at 7p21 near to GLCCI1 and ICA1. (PMID:23836780)
- GLCCI1 rs37973 does not influence treatment response to inhaled corticosteroids in white subjects with asthma. (PMID:24131825)
- GLCCI1 variant accelerates pulmonary function decline in patients with asthma receiving inhaled corticosteroids. (PMID:24673601)
- GLCCI1 rs37972 T allele was not significantly associated with an increased risk of oral corticosteroid use. (PMID:24897287)
- the minor alleles “T” and “G” of rs37972 and rs37973 SNPs, respectively, were not significantly associated with increased asthma risk in asthma patients from Saudi Arabia (PMID:25134782)
- Carriers of the GLCCI1-C allele had lower levels of baseline rheumatoid arthritis disease activity, suggesting a role for the GLCCI1 gene in regulation of glucocorticoid sensitivity to endogenously produced cortisol. (PMID:25724472)
- Carriers of the rs41423247 GLCCI1 polymorphism had a higher probability of responding to glucocorticoids, whereas all other polymorphisms did not affect the likelihood of response to treatment of graft-versus-host disease patients. (PMID:25843653)
- GLCCI1 variations may affect inhaled corticosteroid response by modulating GLCCI1 expression. (PMID:27133712)
- A worsening of pulmonary function caused by GLCCI1 variants could be prevented due to recently used medications based on new action mechanisms. (PMID:28488322)
- CC/CT genotype was significantly associated with post-transplant hypertension (PMID:29224020)
- this study found the GG genotype of GLCCI1 to be associated with better inhaled corticosteroids treatment response in asthma patients (PMID:29345236)
- The genetic variant rs37973 in GLCCI1 is associated with poorer clinical therapeutic response to inhaled glucocorticoids in a Chinese asthma population. (PMID:29384926)
- The GLCCI1 rs37973 variant is a risk factor for glucocorticoid resistance in Chinese patients with SAR who receive short-term intranasal corticosteroids treatment. one genotype of GLCCI1, rs37973, was significantly associated with the INCS response. The effective rate of the GG group was lower than those of the AA and AG groups (AA vs. GG: 73.7% vs. 51.6%, P=0.007; AG vs. GG: 78.8% vs. 51.6%, P=0.000). (PMID:29981236)
- GLCCI1 variant was associated with a significant decrease of the total lung capacity at 3 years after lung transplantation (PMID:30229311)
- The rs37973 polymorphism of GLCCI1 is related to postoperative recovery from chronic rhinosinusitis (CRS) for individual sensitivity to glucocorticoids. Furthermore, AA genotype was associated with better treatment response in CRS. (PMID:30256538)
- GLCCI1 is a downstream molecule of the GC-GR cascade that acts as an antiapoptotic mediator in thymic T cells. Phosphorylated GLCCI1colocalized with microtubules in transfected cells. GR-dependent upregulation of GLCCI1 was proapoptotic in a cultured thymocyte cell line. Transgenic mice overexpressing human GLCCI1 had enlarged thymi with many thymocytes. GLCCI1 bound to both LC8 and PAK1. It reduced BIM expression. (PMID:30860871)
- GLCCI1 and STIP1 variants are associated with asthma susceptibility and inhaled corticosteroid response in a Tunisian population. (PMID:31516081)
- Effects of STIP1 and GLCCI1 polymorphisms on the risk of childhood asthma and inhaled corticosteroid response in Chinese asthmatic children. (PMID:33208131)
- Hsa_circ_001659 serves as a novel diagnostic and prognostic biomarker for colorectal cancer. (PMID:33725570)
- GLCCI1 gene body methylation in peripheral blood is associated with asthma and asthma severity. (PMID:34529984)
- Glucocorticoid-Induced Transcript 1(GLCCI1) SNP rs37937 Is Associated With the Risk of Developing Allergic Rhinitis and the Response to Intranasal Corticosteroids in a Chinese Han Population. (PMID:37553950)
Cross-species orthologs
3 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | glcci1a | ENSDARG00000008503 |
| mus_musculus | Glcci1 | ENSMUSG00000029638 |
| rattus_norvegicus | Glcci1 | ENSRNOG00000076831 |
Paralogs (2): FAM117A (ENSG00000121104), FAM117B (ENSG00000138439)
Protein
Protein identifiers
Glucocorticoid-induced transcript 1 protein — Q86VQ1 (reviewed: Q86VQ1)
All UniProt accessions (4): Q86VQ1, H7C0B2, H7C0Q2, H7C2L5
UniProt curated annotations — full annotation on UniProt →
Tissue specificity. Predominantly expressed in lung, spleen, thymus and testis and, at lower levels, in brain, bone marrow, peripheral leukocytes, skin and trachea.
Polymorphism. Polymorphisms dbSNP:rs37972 and dbSNP:rs37973, located in GLCCI1 promoter region, are associated with a decreased response to glucorticoid treatment [MIM:614400] in asthma patients, as well as in chronic obstructive pulmonary disease patients. The mean increase in forced expiratory volume in 1 second in glucorticoid treated subjects who are homozygous for the mutant (G) rs37973 allele is only about one-third of that seen in similarly treated subjects who are homozygous for the wild-type allele (A). These polymorphisms affect GLCCI1 transcription level.
RefSeq proteins (1): NP_612435* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR026642 | Glcci1/FAM117 | Family |
Pfam: PF15388
UniProt features (42 total): modified residue 22, compositionally biased region 14, region of interest 4, chain 1, coiled-coil region 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q86VQ1-F1 | 53.88 | 0.01 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Post-translational modifications (22): 20, 79, 105, 107, 108, 110, 171, 172, 175, 177, 223, 258, 266, 303, 343, 345, 350, 394, 398, 406 …
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 259 (showing top):
GSE18804_SPLEEN_MACROPHAGE_VS_TUMORAL_MACROPHAGE_UP, MODULE_97, FISCHER_G1_S_CELL_CYCLE, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, MODULE_182, CTATGCA_MIR153, BILD_HRAS_ONCOGENIC_SIGNATURE, CATTTCA_MIR203, RIGGI_EWING_SARCOMA_PROGENITOR_DN, CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_5, TGTTTAC_MIR30A5P_MIR30C_MIR30D_MIR30B_MIR30E5P, BASAKI_YBX1_TARGETS_DN, TURASHVILI_BREAST_CARCINOMA_DUCTAL_VS_LOBULAR_UP, CUI_TCF21_TARGETS_2_DN
GO Biological Process (0):
GO Molecular Function (1): protein binding (GO:0005515)
GO Cellular Component (1): cytoplasm (GO:0005737)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| binding | 1 |
| intracellular anatomical structure | 1 |
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
458 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| GLCCI1 | FCER2 | P06734 | 540 |
| GLCCI1 | CRHR1 | P34998 | 523 |
| GLCCI1 | UMAD1 | C9J7I0 | 479 |
| GLCCI1 | ICA1 | P78506 | 479 |
| GLCCI1 | FAM53C | Q9NYF3 | 467 |
| GLCCI1 | FBXL7 | Q9UJT9 | 451 |
| GLCCI1 | OR6X1 | Q8NH79 | 447 |
| GLCCI1 | SPATS2L | Q9NUQ6 | 432 |
| GLCCI1 | NR3C1 | P04150 | 431 |
| GLCCI1 | MVB12B | Q9H7P6 | 404 |
| GLCCI1 | WDR45B | Q5MNZ6 | 397 |
| GLCCI1 | PDZD9 | Q8IXQ8 | 388 |
| GLCCI1 | ALK | Q9UM73 | 385 |
| GLCCI1 | NUP188 | Q5SRE5 | 377 |
| GLCCI1 | TMCO1 | Q9UM00 | 375 |
IntAct
41 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| DYNLL1 | BLTP3B | psi-mi:“MI:0914”(association) | 0.730 |
| DYNLL2 | BLTP3B | psi-mi:“MI:0914”(association) | 0.640 |
| YWHAH | PLEKHG3 | psi-mi:“MI:0914”(association) | 0.610 |
| YWHAG | SHTN1 | psi-mi:“MI:0914”(association) | 0.560 |
| TRIM41 | GLCCI1 | psi-mi:“MI:0915”(physical association) | 0.560 |
| YWHAQ | IGLC7 | psi-mi:“MI:0914”(association) | 0.530 |
| YWHAZ | BLTP3B | psi-mi:“MI:0914”(association) | 0.530 |
| ZAR1L | BCL2L11 | psi-mi:“MI:0914”(association) | 0.530 |
| DYRK1B | BMAL1 | psi-mi:“MI:0914”(association) | 0.530 |
| DCAF7 | CLASP2 | psi-mi:“MI:0914”(association) | 0.510 |
| ERICH6 | GLCCI1 | psi-mi:“MI:0915”(physical association) | 0.400 |
| Dynll1 | psi-mi:“MI:0915”(physical association) | 0.400 | |
| SLC23A2 | GLCCI1 | psi-mi:“MI:0915”(physical association) | 0.400 |
| Xpo1 | IFT56 | psi-mi:“MI:0914”(association) | 0.350 |
| TRIM41 | ANKHD1 | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAB | PLEKHG3 | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAG | C1orf226 | psi-mi:“MI:0914”(association) | 0.350 |
| DYRK1A | SEC16A | psi-mi:“MI:0914”(association) | 0.350 |
| DYRK1B | POM121C | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAH | SHTN1 | psi-mi:“MI:0914”(association) | 0.350 |
| DYRK1A | TEX13D | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAB | BRAF | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAE | DEPDC5 | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAG | BRAF | psi-mi:“MI:0914”(association) | 0.350 |
| YWHAB | FOXO6 | psi-mi:“MI:0914”(association) | 0.350 |
BioGRID (65): GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-RNA), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS), GLCCI1 (Affinity Capture-MS)
ESM2 similar proteins: A0A088MLT8, A6NNE9, A6P320, B3KU38, B5DF41, D4AE48, G3V9M2, O15079, O43521, O54918, O75081, O88498, P0C1G7, P0DPB3, P0DPB4, P49796, P53349, P78524, Q14DQ1, Q1LY51, Q3U3E2, Q50H33, Q5FVG6, Q5XKK7, Q60698, Q62925, Q68FF7, Q6P1L5, Q6ZNC4, Q7TNF9, Q80TE3, Q80U23, Q80U62, Q80UZ0, Q86VQ1, Q8BGW2, Q8BWU3, Q8CBH7, Q8IWP9, Q8K3I9
Diamond homologs: Q3U3E2, Q6P1L5, Q7TNF9, Q86VQ1, Q8K3I9, Q9C073
SIGNOR signaling
0 interactions.
Enriched among interaction partners
Reactome pathways and GO biological processes over-represented among this gene’s 37 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.
Reactome pathways:
| Pathway | Partners | Fold | FDR |
|---|---|---|---|
| Activation of BAD and translocation to mitochondria | 6 | 169.2× | 4e-11 |
| Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex | 6 | 149.3× | 5e-11 |
| SARS-CoV-1 targets host intracellular signalling and regulatory pathways | 6 | 149.3× | 5e-11 |
| Activation of BH3-only proteins | 7 | 128.7× | 1e-11 |
| Intrinsic Pathway for Apoptosis | 7 | 75.9× | 1e-10 |
| RHO GTPases activate PKNs | 6 | 70.5× | 5e-09 |
| FOXO-mediated transcription | 5 | 62.2× | 3e-07 |
| Apoptosis | 7 | 43.5× | 4e-09 |
GO biological processes:
| GO term | Partners | Fold | FDR |
|---|---|---|---|
| protein targeting | 5 | 59.1× | 3e-06 |
| substantia nigra development | 5 | 59.1× | 3e-06 |
| intracellular protein localization | 6 | 20.3× | 4e-05 |
Disease & clinical
Clinical variants and AI predictions
ClinVar
120 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 100 |
| Likely benign | 4 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
1974 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 7:8003897:A:AG | acceptor_gain | 1.0000 |
| 7:8003898:C:G | acceptor_gain | 1.0000 |
| 7:8003904:GTAGC:G | acceptor_loss | 1.0000 |
| 7:8003905:TAG:T | acceptor_loss | 1.0000 |
| 7:8003906:A:AG | acceptor_gain | 1.0000 |
| 7:8003906:AG:A | acceptor_loss | 1.0000 |
| 7:8003906:AGC:A | acceptor_gain | 1.0000 |
| 7:8003907:G:GC | acceptor_gain | 1.0000 |
| 7:8003907:GC:G | acceptor_gain | 1.0000 |
| 7:8003907:GCG:G | acceptor_gain | 1.0000 |
| 7:8022471:T:G | acceptor_gain | 1.0000 |
| 7:8022480:A:G | acceptor_gain | 1.0000 |
| 7:8022567:GAG:G | donor_gain | 1.0000 |
| 7:8055422:T:TA | acceptor_gain | 1.0000 |
| 7:8055545:CTCAG:C | donor_loss | 1.0000 |
| 7:8055546:TCAGG:T | donor_loss | 1.0000 |
| 7:8055547:CAG:C | donor_loss | 1.0000 |
| 7:8055548:AG:A | donor_loss | 1.0000 |
| 7:8055549:GG:G | donor_loss | 1.0000 |
| 7:8055550:GTAGG:G | donor_loss | 1.0000 |
| 7:8055551:T:G | donor_loss | 1.0000 |
| 7:8060090:TCATA:T | acceptor_loss | 1.0000 |
| 7:8060091:CATA:C | acceptor_loss | 1.0000 |
| 7:8060092:ATAGG:A | acceptor_loss | 1.0000 |
| 7:8060093:TA:T | acceptor_loss | 1.0000 |
| 7:8060094:A:AC | acceptor_loss | 1.0000 |
| 7:8060094:A:AG | acceptor_gain | 1.0000 |
| 7:8060095:G:GA | acceptor_loss | 1.0000 |
| 7:8060095:G:GG | acceptor_gain | 1.0000 |
| 7:8060246:AAGGT:A | donor_loss | 1.0000 |
AlphaMissense
3521 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 7:8004003:T:A | W185R | 1.000 |
| 7:8004003:T:C | W185R | 1.000 |
| 7:8004005:G:C | W185C | 1.000 |
| 7:8004005:G:T | W185C | 1.000 |
| 7:8055446:T:C | L237P | 1.000 |
| 7:8084938:C:T | P407S | 1.000 |
| 7:8084939:C:A | P407H | 1.000 |
| 7:8084944:C:T | P409S | 1.000 |
| 7:8084945:C:A | P409Q | 1.000 |
| 7:8084953:A:C | S412R | 1.000 |
| 7:8084955:C:A | S412R | 1.000 |
| 7:8084955:C:G | S412R | 1.000 |
| 7:8084962:T:C | F415L | 1.000 |
| 7:8084963:T:C | F415S | 1.000 |
| 7:8084963:T:G | F415C | 1.000 |
| 7:8084964:C:A | F415L | 1.000 |
| 7:8084964:C:G | F415L | 1.000 |
| 7:8084969:G:C | R417P | 1.000 |
| 7:8084974:C:T | P419S | 1.000 |
| 7:8084975:C:A | P419H | 1.000 |
| 7:8084977:C:T | P420S | 1.000 |
| 7:8084978:C:A | P420Q | 1.000 |
| 7:8084983:G:A | G422R | 1.000 |
| 7:8084983:G:C | G422R | 1.000 |
| 7:8084984:G:A | G422E | 1.000 |
| 7:8084986:T:C | C423R | 1.000 |
| 7:8084987:G:A | C423Y | 1.000 |
| 7:8084988:T:G | C423W | 1.000 |
| 7:8086230:C:T | P446S | 1.000 |
| 7:8086231:C:A | P446H | 1.000 |
dbSNP variants (sampled 300 via entrez): RS1000031220 (7:8004278 A>G,T), RS1000042849 (7:8006072 A>T), RS1000051214 (7:8085300 GTTTAGATGGTAACAAAGAGAC>G), RS1000078680 (7:8039866 G>A), RS1000098408 (7:8001093 G>T), RS1000112778 (7:7996140 C>T), RS1000155722 (7:7998891 C>T), RS1000183515 (7:8070763 G>A), RS1000190763 (7:8034380 A>G), RS1000215525 (7:8068534 C>A), RS1000241191 (7:8021482 G>C), RS1000323828 (7:8044961 C>A,G), RS1000329058 (7:7981669 A>G), RS1000368461 (7:8029027 G>A,C), RS1000409926 (7:8086992 A>G)
Disease associations
OMIM: gene MIM:614283 | disease phenotypes: MIM:614400
GenCC curated gene-disease
| Disease | Classification | Inheritance |
|---|---|---|
| glucocorticoid therapy, response to | Limited | Autosomal dominant |
Mondo (1): glucocorticoid therapy, response to (MONDO:0013732)
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
28 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST002089_1 | Intraocular pressure | 1.000000e-08 |
| GCST002386_3 | Cognitive function | 4.000000e-06 |
| GCST003542_38 | Night sleep phenotypes | 6.000000e-06 |
| GCST004608_36 | Granulocyte percentage of myeloid white cells | 9.000000e-10 |
| GCST004613_154 | Sum neutrophil eosinophil counts | 4.000000e-09 |
| GCST004614_98 | Granulocyte count | 3.000000e-09 |
| GCST004624_108 | Sum eosinophil basophil counts | 2.000000e-09 |
| GCST004967_5 | Moderate or severe diarrhoea in darapladib-treated cardiovascular disease (time to event) | 3.000000e-08 |
| GCST005316_46 | Intelligence (MTAG) | 1.000000e-09 |
| GCST006976_120 | Macular thickness | 4.000000e-11 |
| GCST008152_173 | Weight | 8.000000e-06 |
| GCST008163_582 | Height | 3.000000e-06 |
| GCST008595_182 | Cognitive ability, years of educational attainment or schizophrenia (pleiotropy) | 2.000000e-08 |
| GCST008839_244 | Height | 4.000000e-13 |
| GCST009523_47 | Household income | 3.000000e-09 |
| GCST009524_150 | Household income (MTAG) | 2.000000e-12 |
| GCST009524_242 | Household income (MTAG) | 1.000000e-14 |
| GCST012226_696 | Waist circumference adjusted for body mass index | 4.000000e-08 |
| GCST012227_105 | Hip circumference adjusted for BMI | 2.000000e-10 |
| GCST90000025_147 | Appendicular lean mass | 7.000000e-20 |
| GCST90002379_145 | Basophil count | 2.000000e-20 |
| GCST90002380_42 | Basophil percentage of white cells | 1.000000e-13 |
| GCST90002381_173 | Eosinophil count | 9.000000e-10 |
| GCST90002394_186 | Monocyte percentage of white cells | 1.000000e-19 |
| GCST90002398_420 | Neutrophil count | 5.000000e-17 |
| GCST90002399_166 | Neutrophil percentage of white cells | 3.000000e-13 |
| GCST90002407_541 | White blood cell count | 6.000000e-13 |
| GCST90020028_133 | Hip circumference adjusted for BMI | 2.000000e-09 |
EFO canonical traits (18, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0004695 | intraocular pressure measurement |
| EFO:0003925 | cognition |
| EFO:0007997 | granulocyte percentage of myeloid white cells |
| EFO:0004833 | neutrophil count |
| EFO:0004842 | eosinophil count |
| EFO:0007987 | granulocyte count |
| EFO:0005090 | basophil count |
| EFO:0008395 | response to darapladib |
| EFO:0004337 | intelligence |
| EFO:0004338 | body weight |
| EFO:0004784 | self reported educational attainment |
| EFO:0009695 | household income |
| EFO:0007789 | BMI-adjusted waist circumference |
| EFO:0008039 | BMI-adjusted hip circumference |
| EFO:0004980 | appendicular lean mass |
| EFO:0007992 | basophil percentage of leukocytes |
| EFO:0007989 | monocyte percentage of leukocytes |
| EFO:0007990 | neutrophil percentage of leukocytes |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
PharmGKB clinical annotations
1 annotations.
| Variant | Type | Level | Drugs | Phenotypes |
|---|---|---|---|---|
| rs37973 | Efficacy | 3 | budesonide;flunisolide;fluticasone propionate;glucocorticoids;nedocromil;triamcinolone | Asthma |
PharmGKB variants
41 variants.
| Variant | Genes | Level | Score | #Clin annots | Drugs |
|---|---|---|---|---|---|
| rs37973 | GLCCI1 | 3 | 0.00 | 1 | budesonide;flunisolide;fluticasone propionate;glucocorticoids;nedocromil;triamcinolone |
| rs37972 | GLCCI1 | 0.00 | 0 | ||
| rs37976 | GLCCI1 | 0.00 | 0 | ||
| rs7792118 | GLCCI1 | 0.00 | 0 | ||
| rs715377 | GLCCI1 | 0.00 | 0 | ||
| rs12537880 | GLCCI1 | 0.00 | 0 | ||
| rs7800750 | GLCCI1 | 0.00 | 0 | ||
| rs37990 | GLCCI1 | 0.00 | 0 | ||
| rs38010 | GLCCI1 | 0.00 | 0 | ||
| rs2041362 | GLCCI1 | 0.00 | 0 | ||
| rs17141876 | GLCCI1 | 0.00 | 0 | ||
| rs1476823 | GLCCI1 | 0.00 | 0 | ||
| rs10229643 | GLCCI1 | 0.00 | 0 | ||
| rs13239966 | GLCCI1 | 0.00 | 0 | ||
| rs10243846 | GLCCI1 | 0.00 | 0 | ||
| rs13245462 | GLCCI1 | 0.00 | 0 | ||
| rs10435183 | GLCCI1 | 0.00 | 0 | ||
| rs7801924 | GLCCI1 | 0.00 | 0 | ||
| rs4725061 | GLCCI1 | 0.00 | 0 | ||
| rs10226865 | GLCCI1 | 0.00 | 0 | ||
| rs13222222 | GLCCI1 | 0.00 | 0 | ||
| rs6969971 | GLCCI1 | 0.00 | 0 | ||
| rs9648623 | GLCCI1 | 0.00 | 0 | ||
| rs13242904 | GLCCI1 | 0.00 | 0 | ||
| rs11978165 | GLCCI1 | 0.00 | 0 | ||
| rs6463755 | GLCCI1 | 0.00 | 0 | ||
| rs16872488 | GLCCI1 | 0.00 | 0 | ||
| rs2191318 | GLCCI1 | 0.00 | 0 | ||
| rs11976862 | GLCCI1 | 0.00 | 0 | ||
| rs4236406 | GLCCI1 | 0.00 | 0 | ||
| rs17142716 | GLCCI1 | 0.00 | 0 | ||
| rs17142727 | GLCCI1 | 0.00 | 0 | ||
| rs10253260 | GLCCI1 | 0.00 | 0 | ||
| rs10952084 | GLCCI1 | 0.00 | 0 | ||
| rs6964558 | GLCCI1 | 0.00 | 0 | ||
| rs6956039 | GLCCI1 | 0.00 | 0 | ||
| rs1468594 | GLCCI1 | 0.00 | 0 | ||
| rs10257285 | GLCCI1 | 0.00 | 0 | ||
| rs12668352 | GLCCI1 | 0.00 | 0 | ||
| rs929509 | GLCCI1 | 0.00 | 0 |
CTD chemical–gene interactions
49 total (human), top 30 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| Valproic Acid | affects cotreatment, decreases expression, affects expression | 6 |
| trichostatin A | affects cotreatment, decreases expression | 3 |
| Cadmium Chloride | decreases expression, increases abundance, increases expression | 3 |
| epigallocatechin gallate | increases expression, affects cotreatment, decreases expression | 2 |
| entinostat | decreases expression, affects cotreatment | 2 |
| Panobinostat | affects cotreatment, decreases expression | 2 |
| Phenylmercuric Acetate | affects cotreatment, decreases expression | 2 |
| FR900359 | increases phosphorylation | 1 |
| pirinixic acid | affects binding, decreases expression, increases activity | 1 |
| arsenite | affects binding, decreases reaction | 1 |
| afimoxifene | decreases expression, decreases reaction | 1 |
| sodium arsenite | decreases expression | 1 |
| sulindac sulfide | increases expression | 1 |
| potassium chromate(VI) | affects cotreatment, decreases expression | 1 |
| nickel sulfate | decreases expression | 1 |
| lei gong teng | increases expression | 1 |
| beta-methylcholine | affects expression | 1 |
| CGP 52608 | affects binding, increases reaction | 1 |
| 2-palmitoylglycerol | increases expression | 1 |
| 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | affects cotreatment, decreases expression | 1 |
| dorsomorphin | affects cotreatment, decreases expression | 1 |
| 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine | increases expression, increases response to substance | 1 |
| jinfukang | decreases expression, affects cotreatment | 1 |
| (+)-JQ1 compound | increases expression | 1 |
| Acetaminophen | increases expression | 1 |
| Air Pollutants | decreases expression, increases abundance | 1 |
| Cadmium | decreases expression, increases abundance | 1 |
| Caffeine | decreases phosphorylation | 1 |
| Cisplatin | affects cotreatment, decreases expression | 1 |
| Dichlorodiphenyl Dichloroethylene | decreases expression | 1 |
Clinical trials (associated diseases)
1 trials via MONDO — disease-level, not drug-specific.
| Trial | Phase | Status | Title |
|---|---|---|---|
| NCT00813189 | PHASE3 | COMPLETED | Efficacy Study of Recombinant Growth Hormone on Muscle Function in Children Long-term Treated With Glucocorticoid |
Related Atlas pages
- Associated diseases: glucocorticoid therapy, response to
- Disease cohort memberships (association, not causation — diseases whose associated-gene cohort lists this gene; a subset are also under Associated diseases): glucocorticoid therapy, response to