GMIP

Summary

GMIP (GEM interacting protein, HGNC:24852) is a protein-coding gene on chromosome 19p13.11, encoding GEM-interacting protein (Q9P107). Stimulates, in vitro and in vivo, the GTPase activity of RhoA.

This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 51291 — RefSeq curated summary.

At a glance

• GWAS associations: 26
• Clinical variants (ClinVar): 148 total
• MANE Select transcript: NM_016573

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24852
Approved symbol	GMIP
Name	GEM interacting protein
Location	19p13.11
Locus type	gene with protein product
Status	Approved
Aliases	ARHGAP46
Ensembl gene	ENSG00000089639
Ensembl biotype	protein_coding
OMIM	609694
Entrez	51291

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 8 protein_coding, 2 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000203556, ENST00000586269, ENST00000587205, ENST00000587238, ENST00000587713, ENST00000588171, ENST00000591047, ENST00000593186, ENST00000905971, ENST00000905972, ENST00000916819, ENST00000940889

RefSeq mRNA: 3 — MANE Select: NM_016573 NM_001288998, NM_001288999, NM_016573

CCDS: CCDS12408, CCDS74318

Canonical transcript exons

ENST00000203556 — 21 exons

Exon	Start	End
ENSE00000570774	19633803	19634190
ENSE00000691710	19630471	19630537
ENSE00000691725	19634507	19634703
ENSE00000691728	19635415	19635569
ENSE00000691730	19635644	19635721
ENSE00000691737	19637365	19637561
ENSE00000691741	19637920	19638057
ENSE00000951836	19638159	19638329
ENSE00001113554	19629476	19630336
ENSE00001224467	19643511	19643657
ENSE00003459213	19640085	19640192
ENSE00003472256	19635025	19635213
ENSE00003497923	19636707	19636796
ENSE00003519935	19641810	19641867
ENSE00003522423	19640446	19640571
ENSE00003523507	19636917	19637029
ENSE00003570429	19638402	19638482
ENSE00003579702	19640296	19640360
ENSE00003583669	19642535	19642619
ENSE00003607933	19641976	19642051
ENSE00003639746	19634792	19634929

Expression profiles

Bgee: expression breadth ubiquitous, 219 present calls, max score 97.46.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 16.9896 / max 1234.6092, expressed in 1774 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
180164	16.6171	1774
180163	0.3482	169
180161	0.0243	18

Top tissues by expression

273 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	97.46	gold quality
blood	UBERON:0000178	95.56	gold quality
monocyte	CL:0000576	95.14	gold quality
leukocyte	CL:0000738	95.02	gold quality
mononuclear cell	CL:0000842	94.91	gold quality
spleen	UBERON:0002106	93.27	gold quality
vermiform appendix	UBERON:0001154	91.89	gold quality
lymph node	UBERON:0000029	90.26	gold quality
bone marrow cell	CL:0002092	90.22	gold quality
caecum	UBERON:0001153	89.09	gold quality
cortical plate	UBERON:0005343	87.45	gold quality
mucosa of transverse colon	UBERON:0004991	86.92	gold quality
ganglionic eminence	UBERON:0004023	86.45	gold quality
right lung	UBERON:0002167	85.80	gold quality
small intestine Peyer’s patch	UBERON:0003454	85.68	gold quality
bone marrow	UBERON:0002371	85.17	gold quality
upper lobe of left lung	UBERON:0008952	84.45	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	84.15	gold quality
gall bladder	UBERON:0002110	83.89	gold quality
sural nerve	UBERON:0015488	83.86	gold quality
small intestine	UBERON:0002108	83.85	gold quality
upper lobe of lung	UBERON:0008948	83.51	gold quality
rectum	UBERON:0001052	82.54	gold quality
superficial temporal artery	UBERON:0001614	82.44	gold quality
tonsil	UBERON:0002372	82.30	gold quality
stromal cell of endometrium	CL:0002255	81.86	gold quality
lower esophagus mucosa	UBERON:0035834	81.45	gold quality
transverse colon	UBERON:0001157	81.41	gold quality
body of stomach	UBERON:0001161	81.29	gold quality
periodontal ligament	UBERON:0008266	81.17	silver quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.17
E-MTAB-6142	no	94.85

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

22 targeting GMIP, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-370-5P	99.78	66.81	706
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-1197	99.70	67.75	1027
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-4472	99.56	66.08	1478
HSA-MIR-6808-5P	99.31	66.23	2150
HSA-MIR-6799-5P	99.14	65.72	2093
HSA-MIR-4725-5P	98.67	65.42	628
HSA-MIR-504-5P	98.67	65.40	631
HSA-MIR-4701-5P	96.45	68.41	1121
HSA-MIR-588	96.45	68.36	1127
HSA-MIR-1291	96.28	65.89	1224
HSA-MIR-6775-3P	95.76	65.91	982

Literature-anchored findings (GeneRIF, showing 4)

• signalling pathways controlled by two proteins of the Ras superfamily, RhoA and Gem, are linked via the action of the RhoGAP protein Gmip (PMID:12093360)
• Variations in the GMIP gene can confer susceptibility to major depressive disorder. (PMID:16086184)
• during exocytosis, actin depolymerization commences near the secretory organelle, not the plasma membrane, and secretory granules use a JFC1- and GMIP-dependent molecular mechanism to traverse cortical actin. (PMID:22438581)
• These findings demonstrate a new role of Gem/Gmip/RhoA signaling in cortical actin regulation during early mitotic stages (PMID:25173885)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	gmip	ENSDARG00000077249
mus_musculus	Gmip	ENSMUSG00000036246
rattus_norvegicus	Gmip	ENSRNOG00000027257
caenorhabditis_elegans		WBGENE00014051

Paralogs (2): ARHGAP29 (ENSG00000137962), ARHGAP45 (ENSG00000180448)

Protein

Protein identifiers

GEM-interacting protein — Q9P107 (reviewed: Q9P107)

All UniProt accessions (5): Q9P107, A0A024R7N1, K7EJC2, K7ELE8, K7EQR5

UniProt curated annotations — full annotation on UniProt →

Function. Stimulates, in vitro and in vivo, the GTPase activity of RhoA.

Subunit / interactions. Interacts with GEM through its N-terminal.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9P107-1	1	yes
Q9P107-2	2

RefSeq proteins (3): NP_001275927, NP_001275928, NP_057657* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000198	RhoGAP_dom	Domain
IPR002219	PKC_DAG/PE	Domain
IPR008936	Rho_GTPase_activation_prot	Homologous_superfamily
IPR027267	AH/BAR_dom_sf	Homologous_superfamily
IPR031160	F_BAR_dom	Domain
IPR046349	C1-like_sf	Homologous_superfamily
IPR051025	RhoGAP	Family
IPR054713	GMIP/FCHO2-like_FCH	Domain

Pfam: PF00620, PF22699

UniProt features (44 total): modified residue 13, compositionally biased region 8, helix 7, region of interest 5, sequence conflict 3, domain 2, chain 1, site 1, zinc finger region 1, splice variant 1, sequence variant 1, turn 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
3QWE	X-RAY DIFFRACTION	2.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9P107-F1	70.02	0.48

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 587 (arginine finger; crucial for gtp hydrolysis by stabilizing the transition state)

Post-translational modifications (13): 19, 71, 231, 234, 243, 437, 441, 660, 885, 907, 914, 919, 923

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-8980692	RHOA GTPase cycle
R-HSA-9013148	CDC42 GTPase cycle
R-HSA-9013149	RAC1 GTPase cycle

MSigDB gene sets: 142 (showing top): GCANCTGNY_MYOD_Q6, GOBP_REGULATION_OF_SMALL_GTPASE_MEDIATED_SIGNAL_TRANSDUCTION, IVANOVA_HEMATOPOIESIS_LATE_PROGENITOR, MORI_IMMATURE_B_LYMPHOCYTE_UP, GGGTGGRR_PAX4_03, GOBP_NEGATIVE_REGULATION_OF_SMALL_GTPASE_MEDIATED_SIGNAL_TRANSDUCTION, GOBP_NEGATIVE_REGULATION_OF_INTRACELLULAR_SIGNAL_TRANSDUCTION, GNF2_MCL1, GNF2_ICAM3, GNF2_S100A4, GNF2_MYD88, GNF2_HCK, DANG_BOUND_BY_MYC, GOBP_SMALL_GTPASE_MEDIATED_SIGNAL_TRANSDUCTION, AP2GAMMA_01

GO Biological Process (5): small GTPase-mediated signal transduction (GO:0007264), intracellular signal transduction (GO:0035556), regulation of small GTPase mediated signal transduction (GO:0051056), negative regulation of small GTPase mediated signal transduction (GO:0051058), signal transduction (GO:0007165)

GO Molecular Function (4): GTPase activator activity (GO:0005096), zinc ion binding (GO:0008270), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (3): nucleoplasm (GO:0005654), cytosol (GO:0005829), plasma membrane (GO:0005886)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
RHO GTPase cycle	3

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
small GTPase-mediated signal transduction	2
cellular anatomical structure	2
intracellular signaling cassette	1
intracellular anatomical structure	1
signal transduction	1
regulation of intracellular signal transduction	1
regulation of small GTPase mediated signal transduction	1
negative regulation of intracellular signal transduction	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
GTPase activity	1
enzyme activator activity	1
GTPase regulator activity	1
transition metal ion binding	1
binding	1
cation binding	1
nuclear lumen	1
cytoplasm	1
membrane	1
cell periphery	1

Protein interactions and networks

STRING

1138 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GMIP	RHOA	P06749	690
GMIP	SYTL1	Q8IYJ3	682
GMIP	RAB27A	P51159	555
GMIP	YJEFN3	A6XGL0	475
GMIP	AKNA	Q7Z591	456
GMIP	ZNF101	Q8IZC7	434
GMIP	MYRIP	Q8NFW9	430
GMIP	LARS2	Q15031	410
GMIP	ATP13A1	Q9HD20	406
GMIP	TTC21A	Q8NDW8	388
GMIP	STARD13	Q9Y3M8	388
GMIP	YRDC	Q86U90	367
GMIP	BORCS8	Q96FH0	364
GMIP	ZNF14	P17017	355
GMIP	CELSR3	Q9NYQ7	345

IntAct

11 interactions, top by confidence:

A	B	Type	Score
ARHGAP45	GMIP	psi-mi:“MI:0915”(physical association)	0.560
GMIP	ACAD8	psi-mi:“MI:0915”(physical association)	0.400
Xpo1	IFT56	psi-mi:“MI:0914”(association)	0.350
ADGRG2	CFAP69	psi-mi:“MI:0914”(association)	0.350
PRPS2	SMCHD1	psi-mi:“MI:0914”(association)	0.350
CTAG1A	DPYSL4	psi-mi:“MI:0914”(association)	0.350
CTAG1A	PER1	psi-mi:“MI:0914”(association)	0.350
SLC35E1	IPO8	psi-mi:“MI:0914”(association)	0.350
ARHGAP45	GMIP	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (35): GMIP (Co-fractionation), GMIP (Affinity Capture-MS), GMIP (Affinity Capture-MS), GMIP (Affinity Capture-MS), HMHA1 (Two-hybrid), GMIP (Two-hybrid), GEM (Affinity Capture-Western), GMIP (FRET), GMIP (FRET), GMIP (FRET), EBNA1BP2 (Affinity Capture-MS), FLOT1 (Affinity Capture-MS), LRPAP1 (Affinity Capture-MS), NUP35 (Affinity Capture-MS), PSPC1 (Affinity Capture-MS)

ESM2 similar proteins: A1IGU3, A1IGU4, A1IGU5, A6QP29, B1AVH7, B2RUP2, B5DFA1, D2H0G5, D3ZFJ3, O15068, O55043, P00530, P07332, P14238, P16879, P55194, P98171, Q0GNC1, Q14155, Q15052, Q27J81, Q3U5C8, Q3UMR0, Q58EX7, Q5VV41, Q5XXR3, Q5ZLR6, Q60I26, Q63406, Q64096, Q6PFY1, Q6PGG2, Q70J99, Q7TNH6, Q80TT2, Q80VK6, Q86WN1, Q8C2K1, Q8C6B2, Q8CJ00

Diamond homologs: A0A0G2JTR4, A1A4S6, A2AB59, A2RUV4, A4IF90, A4II46, A6QNS3, A6X8Z5, A7KAX9, A7YY57, A8WRJ2, D3ZFJ3, E7EZG2, E7F3F0, F1LXF1, O14559, O94466, P11274, P15882, P30337, P34288, P38339, P46941, P52757, P55194, P81128, P97393, Q03070, Q08DP6, Q10164, Q12979, Q13017, Q15311, Q17QN0, Q20498, Q2M1Z3, Q3TBD2, Q3UIA2, Q52LW3, Q53QZ3

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
GMIP	“down-regulates activity”	RHOA	“gtpase-activating protein”
GMIP	“down-regulates activity”	RAC1	“gtpase-activating protein”
GMIP	“down-regulates activity”	CDC42	“gtpase-activating protein”

Disease & clinical

Clinical variants and AI predictions

ClinVar

148 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	122
Likely benign	8
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2772 predictions. Top by Δscore:

Variant	Effect	Δscore
19:19630467:TCA:T	donor_loss	1.0000
19:19630468:CA:C	donor_loss	1.0000
19:19630469:A:AT	donor_loss	1.0000
19:19630533:GGAAT:G	acceptor_gain	1.0000
19:19630534:GAAT:G	acceptor_gain	1.0000
19:19630536:AT:A	acceptor_gain	1.0000
19:19630537:TC:T	acceptor_loss	1.0000
19:19630538:C:CA	acceptor_loss	1.0000
19:19630538:C:CC	acceptor_gain	1.0000
19:19634186:CCACC:C	acceptor_gain	1.0000
19:19634187:CACC:C	acceptor_gain	1.0000
19:19634187:CACCC:C	acceptor_gain	1.0000
19:19634189:CC:C	acceptor_gain	1.0000
19:19634190:CC:C	acceptor_gain	1.0000
19:19634191:C:CC	acceptor_gain	1.0000
19:19634790:ACCT:A	donor_gain	1.0000
19:19634791:CCTC:C	donor_gain	1.0000
19:19634793:T:TA	donor_gain	1.0000
19:19634927:GCCC:G	acceptor_loss	1.0000
19:19634928:CCCT:C	acceptor_loss	1.0000
19:19634930:CTGC:C	acceptor_loss	1.0000
19:19634931:T:C	acceptor_loss	1.0000
19:19635086:T:TA	donor_gain	1.0000
19:19635416:T:TA	donor_gain	1.0000
19:19635422:CA:C	donor_gain	1.0000
19:19635429:T:TA	donor_gain	1.0000
19:19635570:C:CC	acceptor_gain	1.0000
19:19636913:TCACC:T	donor_loss	1.0000
19:19636914:CACCT:C	donor_loss	1.0000
19:19636915:A:AC	donor_gain	1.0000

AlphaMissense

6244 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:19635495:G:C	H494D	0.998
19:19634161:A:G	M705T	0.997
19:19634910:C:T	G590E	0.997
19:19634929:C:G	G584R	0.997
19:19635198:G:C	H526D	0.997
19:19635423:A:G	C518R	0.997
19:19635462:A:G	C505R	0.997
19:19635493:G:C	H494Q	0.997
19:19635493:G:T	H494Q	0.997
19:19635503:G:T	A491D	0.997
19:19638445:C:G	R192P	0.997
19:19634807:C:A	K624N	0.996
19:19634807:C:G	K624N	0.996
19:19634923:A:C	Y586D	0.996
19:19635063:A:G	C571R	0.996
19:19635164:C:T	C537Y	0.996
19:19635189:A:G	C529R	0.996
19:19635213:A:G	C521R	0.996
19:19635461:C:G	C505S	0.996
19:19635462:A:T	C505S	0.996
19:19634513:A:G	L693P	0.995
19:19634919:C:G	R587P	0.995
19:19635164:C:G	C537S	0.995
19:19635165:A:T	C537S	0.995
19:19635188:C:G	C529S	0.995
19:19635189:A:T	C529S	0.995
19:19635196:G:C	H526Q	0.995
19:19635196:G:T	H526Q	0.995
19:19635422:C:G	C518S	0.995
19:19635423:A:T	C518S	0.995

dbSNP variants (sampled 300 via entrez): RS1000014813 (19:19630685 C>G,T), RS1000299919 (19:19643617 AGCCGCCGCCGCC>A,AGCC,AGCCGCC,AGCCGCCGCC,AGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCCGCCGCC,AGCCGCCGCCGCCGCCGCCGCCGCCGCC), RS1000351996 (19:19643709 T>C), RS1000869474 (19:19635878 T>C), RS1001159277 (19:19629719 C>T), RS1001262398 (19:19642907 G>A,C), RS1001423984 (19:19629399 T>C), RS1001605626 (19:19642700 G>A), RS1001850018 (19:19637187 T>C), RS1002159601 (19:19641432 G>A,C), RS1002212002 (19:19641738 G>A), RS1002300955 (19:19637519 G>A,T), RS1002689684 (19:19640630 C>G,T), RS1002917251 (19:19644822 G>A,C), RS1003102951 (19:19645101 C>G)

Disease associations

OMIM: gene MIM:609694 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

26 associations (top):

Study	Trait	p-value
GCST002149_11	Schizophrenia	3.000000e-09
GCST008074_33	Triglyceride levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	2.000000e-39
GCST008074_98	Triglyceride levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	8.000000e-44
GCST008076_31	Triglyceride levels	4.000000e-14
GCST008076_59	Triglyceride levels	1.000000e-20
GCST008077_11	LDL cholesterol levels	6.000000e-12
GCST008077_62	LDL cholesterol levels	1.000000e-10
GCST008078_133	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	2.000000e-193
GCST008078_96	LDL cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)	5.000000e-226
GCST008079_115	LDL cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	6.000000e-39
GCST008079_47	LDL cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	4.000000e-31
GCST008083_106	Triglyceride levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	5.000000e-40
GCST008083_142	Triglyceride levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df)	7.000000e-47
GCST008086_19	LDL cholesterol levels in current drinkers	8.000000e-20
GCST008086_80	LDL cholesterol levels in current drinkers	2.000000e-21
GCST008087_118	Triglyceride levels in current drinkers	1.000000e-23
GCST008087_75	Triglyceride levels in current drinkers	4.000000e-22
GCST008103_10	Bipolar disorder	1.000000e-09
GCST008115_2	Bipolar I disorder	3.000000e-09
GCST008116_4	Bipolar II disorder	4.000000e-06
GCST009600_14	Anorexia nervosa, attention-deficit/hyperactivity disorder, autism spectrum disorder, bipolar disorder, major depression, obsessive-compulsive disorder, schizophrenia, or Tourette syndrome (pleiotropy)	1.000000e-09
GCST010002_52	Refractive error	4.000000e-29
GCST90002379_198	Basophil count	1.000000e-18
GCST90002380_13	Basophil percentage of white cells	3.000000e-17
GCST90002389_401	Lymphocyte percentage of white cells	3.000000e-10
GCST90002399_231	Neutrophil percentage of white cells	1.000000e-13

EFO canonical traits (9, from GWAS)

EFO ID	Trait name
EFO:0004530	triglyceride measurement
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004329	alcohol drinking
EFO:0009963	bipolar I disorder
EFO:0009964	bipolar II disorder
EFO:0005090	basophil count
EFO:0007992	basophil percentage of leukocytes
EFO:0007993	lymphocyte percentage of leukocytes
EFO:0007990	neutrophil percentage of leukocytes

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

38 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Air Pollutants	affects expression, increases abundance, increases expression	2
Benzo(a)pyrene	increases expression, increases methylation	2
Nickel	increases expression	2
Tobacco Smoke Pollution	increases expression, increases methylation	2
Valproic Acid	affects expression, increases methylation	2
aristolochic acid I	increases expression	1
GSK-J4	decreases expression	1
FR900359	affects phosphorylation	1
triphenyl phosphate	affects expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
sodium arsenite	increases expression	1
cobaltous chloride	decreases expression	1
coumarin	decreases phosphorylation	1
muconaldehyde	decreases expression	1
N,N,N’,N’-tetrakis(2-pyridylmethyl)ethylenediamine	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
deguelin	decreases expression	1
thifluzamide	decreases expression	1
abrine	increases expression	1
pyrachlostrobin	decreases expression	1
bisphenol S	decreases methylation	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Caffeine	decreases phosphorylation	1
Diazinon	increases methylation	1
Doxorubicin	decreases expression	1
Ozone	affects expression, increases abundance	1
Plant Extracts	affects cotreatment, decreases expression	1
Rotenone	decreases expression	1
Tretinoin	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.