GNAT3

Summary

GNAT3 (G protein subunit alpha transducin 3, HGNC:22800) is a protein-coding gene on chromosome 7q21.11, encoding Guanine nucleotide-binding protein G(t) subunit alpha-3 (A8MTJ3). Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction.

Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome.

Source: NCBI Gene 346562 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 51 total
• MANE Select transcript: NM_001102386

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:22800
Approved symbol	GNAT3
Name	G protein subunit alpha transducin 3
Location	7q21.11
Locus type	gene with protein product
Status	Approved
Aliases	gustducin, GDCA
Ensembl gene	ENSG00000214415
Ensembl biotype	protein_coding
OMIM	139395
Entrez	346562

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000398291

RefSeq mRNA: 1 — MANE Select: NM_001102386 NM_001102386

CCDS: CCDS47625

Canonical transcript exons

ENST00000398291 — 8 exons

Exon	Start	End
ENSE00001532501	80458635	80458861
ENSE00001532507	80462159	80462312
ENSE00001532515	80474251	80474379
ENSE00001532519	80478841	80478998
ENSE00001532523	80488535	80488676
ENSE00001532527	80494605	80494647
ENSE00001532532	80511809	80512064
ENSE00001597423	80462502	80462631

Expression profiles

Bgee: expression breadth broad, 27 present calls, max score 78.78.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.1938 / max 173.6909, expressed in 21 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
84516	0.1606	20
84515	0.0245	7
84517	0.0087	3

Top tissues by expression

260 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.78	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	57.10	gold quality
tibialis anterior	UBERON:0001385	56.97	silver quality
ileal mucosa	UBERON:0000331	56.40	silver quality
pancreatic ductal cell	CL:0002079	54.45	silver quality
duodenum	UBERON:0002114	52.75	gold quality
deltoid	UBERON:0001476	52.52	silver quality
epithelial cell of pancreas	CL:0000083	50.24	gold quality
quadriceps femoris	UBERON:0001377	49.37	gold quality
Brodmann (1909) area 46	UBERON:0006483	49.30	gold quality
cervix squamous epithelium	UBERON:0006922	49.20	gold quality
hair follicle	UBERON:0002073	49.18	gold quality
olfactory bulb	UBERON:0002264	48.92	gold quality
myocardium	UBERON:0002349	48.87	gold quality
type B pancreatic cell	CL:0000169	48.83	gold quality
cardiac muscle of right atrium	UBERON:0003379	48.55	gold quality
CA1 field of hippocampus	UBERON:0003881	48.50	gold quality
vastus lateralis	UBERON:0001379	48.25	gold quality
left ventricle myocardium	UBERON:0006566	48.24	gold quality
orbitofrontal cortex	UBERON:0004167	48.20	gold quality
upper arm skin	UBERON:0004263	48.06	gold quality
cervix epithelium	UBERON:0004801	48.04	gold quality
oviduct epithelium	UBERON:0004804	48.00	gold quality
tongue squamous epithelium	UBERON:0006919	47.92	gold quality
mucosa of urinary bladder	UBERON:0001259	47.80	gold quality
metanephric glomerulus	UBERON:0004736	47.45	gold quality
thymus	UBERON:0002370	47.42	gold quality
kidney epithelium	UBERON:0004819	47.39	gold quality
nephron tubule	UBERON:0001231	47.30	gold quality
diaphragm	UBERON:0001103	47.05	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-CURD-11	yes	176.92
E-ANND-3	no	2.10

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): GLI3

Literature-anchored findings (GeneRIF, showing 8)

• the alpha-subunit of the taste-specific G protein gustducin is expressed prominently in cells of the human colon (PMID:16728727)
• Axonemal-associated localization within the midpiece and principal piece of human spermatozoa raises the possibility that this G protein alpha-subunit may process intracellular signals controlling sperm motility. (PMID:17021831)
• The sweet taste receptors (alpha-gustducin and T1R3) are involved in glucose-stimulated secretion of GLP-1 and PYY. (PMID:21324568)
• (GNAT3, 11 SNPs) gene, located within the 1-LOD support interval region for their association with MS and its related traits. Several SNPs were associated with MS and its related traits. Remarkably. (PMID:22456541)
• Oral Microbiota Profile Associates with Sugar Intake and Taste Preference Genes. (PMID:32138214)
• Intestinal alteration of alpha-gustducin and sweet taste signaling pathway in metabolic diseases is partly rescued after weight loss and diabetes remission. (PMID:34338041)
• Candidate Gene of NOS3, MMP3, AGT, and AGT1R and Pathway Analyses for Platelet Reactivity and Clinical Outcomes of Repeat Revascularization After First PCI in Chinese Patients. (PMID:34860335)
• Worldwide diversity, association potential, and natural selection in the superimposed taste genes, CD36 and GNAT3. (PMID:34972209)

Cross-species orthologs

26 orthologs

Organism	Symbol	Gene ID
danio_rerio	gna15.1	ENSDARG00000016364
danio_rerio	gna15.2	ENSDARG00000056654
danio_rerio	gna15.4	ENSDARG00000071416
danio_rerio	si:ch211-207c7.2	ENSDARG00000092481
danio_rerio	gna15.3	ENSDARG00000092948
danio_rerio		ENSDARG00000116003
mus_musculus	Gnat3	ENSMUSG00000028777
rattus_norvegicus	Gnat3	ENSRNOG00000005268
drosophila_melanogaster	cta	FBGN0000384
drosophila_melanogaster	Galphai	FBGN0001104
drosophila_melanogaster	Galphaf	FBGN0010223
drosophila_melanogaster	CG17760	FBGN0033756
drosophila_melanogaster	CG30054	FBGN0050054
caenorhabditis_elegans		WBGENE00001664
caenorhabditis_elegans		WBGENE00001665
caenorhabditis_elegans		WBGENE00001666
caenorhabditis_elegans		WBGENE00001667
caenorhabditis_elegans		WBGENE00001668
caenorhabditis_elegans		WBGENE00001670
caenorhabditis_elegans		WBGENE00001671
caenorhabditis_elegans		WBGENE00001673
caenorhabditis_elegans		WBGENE00001674
caenorhabditis_elegans		WBGENE00001675
caenorhabditis_elegans	gpa-14	WBGENE00001676
caenorhabditis_elegans	gpa-16	WBGENE00001678
caenorhabditis_elegans	gsa-1	WBGENE00001745

Paralogs (15): GNA15 (ENSG00000060558), GNAI3 (ENSG00000065135), GNAO1 (ENSG00000087258), GNAS (ENSG00000087460), GNA11 (ENSG00000088256), GNAT1 (ENSG00000114349), GNAI2 (ENSG00000114353), GNA13 (ENSG00000120063), GNAI1 (ENSG00000127955), GNAZ (ENSG00000128266), GNAT2 (ENSG00000134183), GNAL (ENSG00000141404), GNA12 (ENSG00000146535), GNA14 (ENSG00000156049), GNAQ (ENSG00000156052)

Protein

Protein identifiers

Guanine nucleotide-binding protein G(t) subunit alpha-3 — A8MTJ3 (reviewed: A8MTJ3)

Alternative names: Gustducin alpha-3 chain

All UniProt accessions (1): A8MTJ3

UniProt curated annotations — full annotation on UniProt →

Function. Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction. Transduction by this alpha subunit involves coupling of specific cell-surface receptors with a cGMP-phosphodiesterase; Activation of phosphodiesterase lowers intracellular levels of cAMP and cGMP which may open a cyclic nucleotide-suppressible cation channel leading to influx of calcium, ultimately leading to release of neurotransmitter. Indeed, denatonium and strychnine induce transient reduction in cAMP and cGMP in taste tissue, whereas this decrease is inhibited by GNAT3 antibody. Gustducin heterotrimer transduces response to bitter and sweet compounds via regulation of phosphodiesterase for alpha subunit, as well as via activation of phospholipase C for beta and gamma subunits, with ultimate increase inositol trisphosphate and increase of intracellular Calcium. GNAT3 can functionally couple to taste receptors to transmit intracellular signal: receptor heterodimer TAS1R2/TAS1R3 senses sweetness and TAS1R1/TAS1R3 transduces umami taste, whereas the T2R family GPCRs such as TAS2R14 act as bitter sensors. Also functions as lumenal sugar sensors in the gut to control the expression of the Na+-glucose transporter SGLT1 in response to dietaty sugar, as well as the secretion of Glucagon-like peptide-1, GLP-1 and glucose-dependent insulinotropic polypeptide, GIP. Thus, may modulate the gut capacity to absorb sugars, with implications in malabsorption syndromes and diet-related disorders including diabetes and obesity.

Subunit / interactions. G proteins are composed of 3 units; alpha, beta and gamma, respectively GNAT3, GNB1 and GNG13 for Gustducin heterotrimer for bitter taste transduction. The alpha chain contains the guanine nucleotide binding site. Component of the TAS2R14-GNAT3 complex, consisting of TAS2R14, GNAT3, GNB1 and GNG2; within the complex interacts with TAS2R14; this complex plays a role in the perception of bitterness. Gustducin heterotrimer may also be composed of GNAT3, GNB3 and GNG13.

Subcellular location. Cytoplasm.

Tissue specificity. Expressed in taste buds (sensory organs of clustered epithelial cells) of the circumvallate and foliate papillae of the tongue at protein level. Expressed in enteroendocrine L cells of the gut. Detected also in spermatozoa.

Post-translational modifications. Potential N-myristoylation may anchor alpha-subunit to the inner surface of plasma membrane.

Similarity. Belongs to the G-alpha family. G(i/o/t/z) subfamily.

RefSeq proteins (1): NP_001095856* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001019	Gprotein_alpha_su	Family
IPR001408	Gprotein_alpha_I	Family
IPR011025	GproteinA_insert	Homologous_superfamily
IPR027417	P-loop_NTPase	Homologous_superfamily

Pfam: PF00503

UniProt features (38 total): strand 10, helix 9, binding site 7, region of interest 6, initiator methionine 1, chain 1, lipid moiety-binding region 1, domain 1, turn 1, compositionally biased region 1

Structure

Experimental structures (PDB)

6 structures.

PDB	Method	Resolution (Å)
8VY9	ELECTRON MICROSCOPY	2.88
8YKY	ELECTRON MICROSCOPY	2.99
9M8K	ELECTRON MICROSCOPY	3
9OXB	ELECTRON MICROSCOPY	3
8RQL	ELECTRON MICROSCOPY	3.03
8XQP	ELECTRON MICROSCOPY	3.29

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A8MTJ3-F1	94.11	0.86

Antibody-complex structures (SAbDab): 4 — 8RQL, 8VY9, 8XQP, 8YKY

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (7): 40–47; 47; 175–181; 181; 200–204; 269–272; 326

Post-translational modifications (1): 2

Function

Pathways and Gene Ontology

Reactome pathways

10 pathways

ID	Pathway
R-HSA-170670	Adenylate cyclase inhibitory pathway
R-HSA-381771	Synthesis, secretion, and inactivation of Glucagon-like Peptide-1 (GLP-1)
R-HSA-392170	ADP signalling through P2Y purinoceptor 12
R-HSA-418555	G alpha (s) signalling events
R-HSA-418594	G alpha (i) signalling events
R-HSA-418597	G alpha (z) signalling events
R-HSA-9009391	Extra-nuclear estrogen signaling
R-HSA-9634597	GPER1 signaling
R-HSA-9660821	ADORA2B mediated anti-inflammatory cytokines production
R-HSA-9717207	Sensory perception of sweet, bitter, and umami (glutamate) taste

MSigDB gene sets: 98 (showing top): GOCC_SECRETORY_GRANULE, REACTOME_PLATELET_ACTIVATION_SIGNALING_AND_AGGREGATION, REACTOME_G_ALPHA_Z_SIGNALLING_EVENTS, GOBP_SENSORY_PERCEPTION_OF_CHEMICAL_STIMULUS, GOBP_PHOTOTRANSDUCTION, GOBP_ADENYLATE_CYCLASE_MODULATING_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOBP_SENSORY_PERCEPTION_OF_TASTE, GOBP_PHOTOTRANSDUCTION_VISIBLE_LIGHT, GOBP_SENSORY_PERCEPTION_OF_LIGHT_STIMULUS, GOBP_RESPONSE_TO_RADIATION, GOBP_RESPONSE_TO_NICOTINE, GOBP_DETECTION_OF_LIGHT_STIMULUS, GOBP_RESPONSE_TO_ABIOTIC_STIMULUS, GOCC_APICAL_PLASMA_MEMBRANE, GOBP_DETECTION_OF_ABIOTIC_STIMULUS

GO Biological Process (10): adenylate cyclase-modulating G protein-coupled receptor signaling pathway (GO:0007188), phototransduction, visible light (GO:0007603), response to nicotine (GO:0035094), detection of light stimulus involved in visual perception (GO:0050908), sensory perception of bitter taste (GO:0050913), sensory perception of sweet taste (GO:0050916), sensory perception of umami taste (GO:0050917), signal transduction (GO:0007165), G protein-coupled receptor signaling pathway (GO:0007186), sensory perception of taste (GO:0050909)

GO Molecular Function (7): G protein-coupled receptor binding (GO:0001664), GTPase activity (GO:0003924), GTP binding (GO:0005525), G-protein beta/gamma-subunit complex binding (GO:0031683), metal ion binding (GO:0046872), nucleotide binding (GO:0000166), guanyl nucleotide binding (GO:0019001)

GO Cellular Component (8): acrosomal vesicle (GO:0001669), cytoplasm (GO:0005737), heterotrimeric G-protein complex (GO:0005834), plasma membrane (GO:0005886), axoneme (GO:0005930), apical plasma membrane (GO:0016324), protein-containing complex (GO:0032991), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-9 pathways:

Category	Pathways
GPCR downstream signalling	3
G-protein mediated events	1
Activation of GABAB receptors	1
Incretin synthesis, secretion, and inactivation	1
Signal amplification	1
ESR-mediated signaling	1
G alpha (s) signalling events	1
Anti-inflammatory response favouring Leishmania parasite infection	1
Sensory perception of taste	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
sensory perception of taste	3
cellular anatomical structure	3
adenylate cyclase activity	1
G protein-coupled receptor signaling pathway	1
phototransduction	1
detection of visible light	1
response to chemical	1
visual perception	1
detection of light stimulus involved in sensory perception	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
G protein-coupled receptor activity	1
signal transduction	1
sensory perception of chemical stimulus	1
signaling receptor binding	1
ribonucleoside triphosphate phosphatase activity	1
guanyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
protein-containing complex binding	1
cation binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
purine nucleotide binding	1
secretory granule	1
intracellular anatomical structure	1
extrinsic component of cytoplasmic side of plasma membrane	1
plasma membrane protein complex	1
GTPase complex	1
membrane	1
cell periphery	1
cytoskeleton	1
microtubule	1
ciliary plasm	1
apical part of cell	1
plasma membrane region	1
cellular_component	1

Protein interactions and networks

STRING

1833 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GNAT3	PLCB2	Q00722	988
GNAT3	TAS1R3	Q7RTX0	987
GNAT3	TAS1R2	Q8TE23	987
GNAT3	TAS1R1	Q7RTX1	960
GNAT3	TAS2R38	P59533	953
GNAT3	TRPM5	Q9NZQ8	946
GNAT3	TAS2R4	Q9NYW5	918
GNAT3	TAS2R46	P59540	907
GNAT3	TAS2R10	Q9NYW0	904
GNAT3	SLC5A1	P13866	896
GNAT3	TAS2R43	P59537	882
GNAT3	TAS2R7	Q9NYW3	880
GNAT3	TAS2R5	Q9NYW4	871
GNAT3	TAS2R1	Q9NYW7	852
GNAT3	TAS2R9	Q9NYW1	842
GNAT3	TAS2R13	Q9NYV9	842

IntAct

11 interactions, top by confidence:

A	B	Type	Score
RAB5C	GNAT3	psi-mi:“MI:0914”(association)	0.530
GNAI1	GNAT3	psi-mi:“MI:0914”(association)	0.530
Haus1	GNAT3	psi-mi:“MI:0915”(physical association)	0.400
	GNAT3	psi-mi:“MI:0915”(physical association)	0.400
SNTA1	GNAT3	psi-mi:“MI:0914”(association)	0.350
P		psi-mi:“MI:0914”(association)	0.350
OTUD3	GNAT3	psi-mi:“MI:0914”(association)	0.350
	ESYT2	psi-mi:“MI:0914”(association)	0.350

BioGRID (20): GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Reconstituted Complex), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS), GNAT3 (Affinity Capture-MS)

ESM2 similar proteins: A8MTJ3, B2RSH2, G1XJZ0, O13055, O14438, O15976, P04695, P04696, P04897, P04899, P08752, P08753, P08754, P0C7Q4, P10824, P10825, P11488, P16894, P19087, P20353, P20612, P27044, P28052, P29348, P38400, P38401, P38402, P38403, P38407, P38408, P41776, P50146, P50147, P50149, P51876, P63096, P63097, P87034, P87383, Q18434

Diamond homologs: A2Y3B5, A8MTJ3, B0XRA0, B2RSH2, O04278, O04279, O13055, O13315, O14438, O15976, O42784, O74227, O74259, O95837, P04695, P04696, P04897, P04899, P08239, P08752, P08753, P08754, P09471, P0C7Q4, P0CN96, P0CN97, P10824, P10825, P11488, P16378, P16894, P18064, P18872, P19087, P20353, P20612, P26981, P27044, P27045, P28051

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

51 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	47
Likely benign	1
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

2014 predictions. Top by Δscore:

Variant	Effect	Δscore
7:80458861:CCT:C	acceptor_gain	1.0000
7:80458863:T:C	acceptor_gain	1.0000
7:80462324:C:CT	acceptor_gain	1.0000
7:80462325:A:T	acceptor_gain	1.0000
7:80478839:A:AC	donor_gain	1.0000
7:80478840:C:CC	donor_gain	1.0000
7:80478840:CTAAG:C	donor_gain	1.0000
7:80488533:A:AC	donor_gain	1.0000
7:80488534:C:CT	donor_gain	1.0000
7:80488534:CTG:C	donor_gain	1.0000
7:80488534:CTGCA:C	donor_gain	1.0000
7:80494603:A:AC	donor_gain	1.0000
7:80494604:C:CC	donor_gain	1.0000
7:80458860:CCCT:C	acceptor_gain	0.9900
7:80458863:T:TC	acceptor_gain	0.9900
7:80462308:CTATT:C	acceptor_gain	0.9900
7:80462313:C:CC	acceptor_gain	0.9900
7:80462501:CCA:C	donor_gain	0.9900
7:80475570:T:TA	donor_gain	0.9900
7:80478844:G:C	donor_gain	0.9900
7:80478996:CTC:C	acceptor_gain	0.9900
7:80478997:TCCTA:T	acceptor_loss	0.9900
7:80478998:CCTAG:C	acceptor_loss	0.9900
7:80478999:C:CG	acceptor_loss	0.9900
7:80479000:T:G	acceptor_loss	0.9900
7:80487684:A:AG	acceptor_gain	0.9900
7:80487685:G:GG	acceptor_gain	0.9900
7:80487685:GCAA:G	acceptor_gain	0.9900
7:80487778:GTGG:G	donor_gain	0.9900
7:80488526:CATA:C	donor_loss	0.9900

AlphaMissense

2367 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:80462223:T:A	K270N	1.000
7:80462223:T:G	K270N	1.000
7:80462224:T:A	K270I	1.000
7:80462589:C:A	W211C	1.000
7:80462589:C:G	W211C	1.000
7:80462591:A:G	W211R	1.000
7:80462591:A:T	W211R	1.000
7:80462598:T:A	R208S	1.000
7:80462598:T:G	R208S	1.000
7:80462614:C:T	G203E	1.000
7:80462615:C:G	G203R	1.000
7:80462615:C:T	G203R	1.000
7:80494628:T:A	K46N	1.000
7:80494628:T:G	K46N	1.000
7:80494629:T:A	K46I	1.000
7:80494630:T:G	K46Q	1.000
7:80494632:C:T	G45E	1.000
7:80494633:C:A	G45W	1.000
7:80494647:C:T	G40E	1.000
7:80511809:C:G	G40R	1.000
7:80511809:C:T	G40R	1.000
7:80458693:A:G	L348P	0.999
7:80458724:C:G	A338P	0.999
7:80462226:G:C	N269K	0.999
7:80462226:G:T	N269K	0.999
7:80462236:A:G	L266P	0.999
7:80462287:A:G	L249P	0.999
7:80462295:G:C	S246R	0.999
7:80462295:G:T	S246R	0.999
7:80462297:T:G	S246R	0.999

dbSNP variants (sampled 300 via entrez): RS1000054545 (7:80491301 C>A,T), RS1000097961 (7:80475946 G>C), RS1000133611 (7:80479705 T>C), RS1000208146 (7:80482465 TATTTTCTTTTTCTTTTTTCTTTC>T), RS1000215055 (7:80467428 C>T), RS1000259633 (7:80506810 T>C), RS1000278675 (7:80463399 G>A), RS1000314355 (7:80513194 T>G), RS1000357825 (7:80485522 T>A,G), RS1000413162 (7:80473218 C>A,T), RS1000455852 (7:80484422 C>A,G), RS1000484438 (7:80479900 C>A,T), RS1000493963 (7:80469335 G>A), RS1000497756 (7:80496255 T>C), RS1000548861 (7:80469109 T>C)

Disease associations

OMIM: gene MIM:139395 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST003075_130	Cognitive decline rate in late mild cognitive impairment	1.000000e-06
GCST003075_95	Cognitive decline rate in late mild cognitive impairment	3.000000e-08
GCST003542_206	Night sleep phenotypes	3.000000e-06
GCST005991_90	Platelet count	2.000000e-17
GCST005992_31	Mean corpuscular hemoglobin concentration	4.000000e-11
GCST005999_16	Aspartate aminotransferase levels	3.000000e-14
GCST011351_11	Aspartate aminotransferase levels	1.000000e-12

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0007710	cognitive decline measurement
EFO:0004309	platelet count
EFO:0004528	mean corpuscular hemoglobin concentration
EFO:0004736	aspartate aminotransferase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

5 total (human), top 5 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects splicing, decreases expression	1
denatonium	increases reaction, increases secretion	1
(+)-JQ1 compound	decreases expression	1
Rotenone	decreases expression	1
1-Methyl-4-phenylpyridinium	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.