GOLGB1

Summary

GOLGB1 (golgin B1, HGNC:4429) is a protein-coding gene on chromosome 3q13.33, encoding Golgin subfamily B member 1 (Q14789). May participate in forming intercisternal cross-bridges of the Golgi complex.

Enables RNA binding activity. Involved in protein localization to pericentriolar material. Located in Golgi apparatus and endoplasmic reticulum-Golgi intermediate compartment.

Source: NCBI Gene 2804 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 445 total — 1 pathogenic
• Phenotypes (HPO): 1
• MANE Select transcript: NM_001366282

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4429
Approved symbol	GOLGB1
Name	golgin B1
Location	3q13.33
Locus type	gene with protein product
Status	Approved
Aliases	GCP, GCP372, giantin, GOLIM1
Ensembl gene	ENSG00000173230
Ensembl biotype	protein_coding
OMIM	602500
Entrez	2804

Gene structure

Transcript identifiers

Ensembl transcripts: 59 — 23 nonsense_mediated_decay, 18 retained_intron, 17 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000340645, ENST00000393667, ENST00000472475, ENST00000472829, ENST00000482512, ENST00000489400, ENST00000491690, ENST00000494517, ENST00000614479, ENST00000694956, ENST00000694957, ENST00000694958, ENST00000694959, ENST00000694960, ENST00000694973, ENST00000694974, ENST00000694975, ENST00000694976, ENST00000694977, ENST00000694979, ENST00000694980, ENST00000694981, ENST00000694982, ENST00000694983, ENST00000694984, ENST00000694985, ENST00000695004, ENST00000695005, ENST00000695006, ENST00000695007, ENST00000695008, ENST00000695009, ENST00000695010, ENST00000695011, ENST00000695014, ENST00000695015, ENST00000695016, ENST00000695017, ENST00000695018, ENST00000695019, ENST00000695020, ENST00000695021, ENST00000695022, ENST00000695035, ENST00000695036, ENST00000695037, ENST00000695038, ENST00000695039, ENST00000695040, ENST00000695041, ENST00000695106, ENST00000695107, ENST00000695108, ENST00000695109, ENST00000695110, ENST00000695118, ENST00000695119, ENST00000695120, ENST00000931107

RefSeq mRNA: 8 — MANE Select: NM_001366282 NM_001256486, NM_001256487, NM_001256488, NM_001366282, NM_001366283, NM_001366284, NM_001389631, NM_004487

CCDS: CCDS3004, CCDS58847, CCDS93347, CCDS93348

Canonical transcript exons

ENST00000614479 — 22 exons

Exon	Start	End
ENSE00001837778	121729865	121730017
ENSE00001872373	121699812	121699885
ENSE00001915980	121693741	121698929
ENSE00001931638	121690670	121692581
ENSE00001944363	121749632	121749741
ENSE00002692430	121730876	121730973
ENSE00003489808	121719646	121719768
ENSE00003491843	121667476	121667610
ENSE00003493483	121729188	121729340
ENSE00003495721	121716737	121717139
ENSE00003512985	121677285	121677450
ENSE00003573144	121676893	121677030
ENSE00003576137	121681687	121681865
ENSE00003617067	121718388	121718501
ENSE00003628153	121702481	121702595
ENSE00003652768	121722262	121722378
ENSE00003654494	121668061	121668158
ENSE00003675002	121714861	121714976
ENSE00003679635	121669212	121669355
ENSE00003680004	121726913	121727041
ENSE00003691027	121664926	121665031
ENSE00003926403	121663201	121664614

Expression profiles

Bgee: expression breadth ubiquitous, 290 present calls, max score 97.52.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 18.9661 / max 344.4867, expressed in 1759 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
44108	15.5540	1736
44109	1.2467	749
44110	0.6370	282
44105	0.5120	256
44107	0.3978	164
44106	0.3254	134
44103	0.2933	130

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
calcaneal tendon	UBERON:0003701	97.52	gold quality
sural nerve	UBERON:0015488	96.29	gold quality
tendon	UBERON:0000043	95.83	gold quality
pancreatic ductal cell	CL:0002079	95.81	gold quality
parotid gland	UBERON:0001831	95.71	gold quality
adrenal tissue	UBERON:0018303	95.12	gold quality
tibia	UBERON:0000979	94.73	gold quality
colonic epithelium	UBERON:0000397	94.63	gold quality
sperm	CL:0000019	94.19	gold quality
body of pancreas	UBERON:0001150	93.83	gold quality
tendon of biceps brachii	UBERON:0008188	93.76	gold quality
skin of hip	UBERON:0001554	93.55	gold quality
corpus epididymis	UBERON:0004359	93.42	gold quality
stromal cell of endometrium	CL:0002255	93.37	gold quality
bronchial epithelial cell	CL:0002328	93.30	gold quality
upper leg skin	UBERON:0004262	93.15	gold quality
right adrenal gland cortex	UBERON:0035827	93.15	gold quality
epithelium of bronchus	UBERON:0002031	93.12	gold quality
pituitary gland	UBERON:0000007	93.04	gold quality
cartilage tissue	UBERON:0002418	93.04	gold quality
right adrenal gland	UBERON:0001233	93.02	gold quality
adenohypophysis	UBERON:0002196	92.96	gold quality
male germ cell	CL:0000015	92.92	gold quality
left adrenal gland	UBERON:0001234	92.91	gold quality
bronchus	UBERON:0002185	92.90	gold quality
metanephros cortex	UBERON:0010533	92.87	gold quality
left adrenal gland cortex	UBERON:0035825	92.75	gold quality
saliva-secreting gland	UBERON:0001044	92.73	gold quality
minor salivary gland	UBERON:0001830	92.67	gold quality
adrenal gland	UBERON:0002369	92.60	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-6819	yes	18266.36
E-CURD-135	no	2239.05
E-MTAB-9689	no	170.42
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

64 targeting GOLGB1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-1343-3P	99.89	66.78	1815
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-4698	99.84	71.41	4303
HSA-MIR-6715A-3P	99.83	68.05	1473
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-6752-3P	99.72	66.71	1587
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-7150	99.62	66.80	1322
HSA-MIR-3942-3P	99.57	69.03	2854
HSA-MIR-106A-3P	99.53	67.58	995
HSA-MIR-7159-5P	99.53	72.12	2472
HSA-MIR-216A-5P	99.50	68.02	1288
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-6740-3P	99.48	68.49	1392
HSA-MIR-582-5P	99.47	70.79	2635
HSA-MIR-942-5P	99.41	68.40	1977
HSA-MIR-185-5P	99.35	68.60	2497
HSA-MIR-4644	99.35	69.12	2514
HSA-MIR-5582-5P	99.27	71.42	1879
HSA-MIR-3064-5P	99.26	66.13	1497
HSA-MIR-3085-3P	99.26	66.16	1490

Literature-anchored findings (GeneRIF, showing 10)

• Data report the characterization of a mammalian coiled-coil protein, CASP, a Golgi protein that shares with giantin a conserved histidine in its transmembrane domain. (PMID:12429822)
• Giantin binds to Rab6A and Rab1 proteins. (PMID:17475246)
• unbiased whole-genome search for genetic modifiers of stroke risk in sickle cell anemia was performed; mutation in GOLGB1 (Y1212C) and mutation in ENPP1 (K173Q) were confirmed as having significant associations with a decreased risk for stroke (PMID:23422753)
• the spatial organization of the Golgi ribbon is mediated by giantin, which also plays a role in cargo transport and sugar modifications (PMID:23555793)
• Partial depletion of giantin or of WDR34 leads to an increase in cilia length consistent with the concept that giantin acts through dynein-2. (PMID:24046448)
• Results show that ST3Gal1 uses GM130-GRASP65 and giantin, whereas C2GnT-L uses only giantin for Golgi targeting and defective giantin dimerization in PC-3 and DU145 prostate cancer cells causes fragmentation of the Golgi and prevents its targeting. (PMID:25086069)
• Single nucleotide polymorphisms (SNPs) rs1035798 in RAGE gene, rs2073617 and rs2073618 in TNFRSF11B, and rs3732410 in Golgb1 will be investigated on whether there is an association with hemorrhagic stroke (HS) in Chinese population. (PMID:26664786)
• In situ proximity ligation assays of Golgi localization of alpha-mannosidase IA at giantin versus GM130-GRASP65 site, and absence or presence of N-glycans terminated with alpha3-mannose on trans-Golgi glycosyltransferases may be useful for distinguishing indolent from aggressive prostate cancer cells. (PMID:28782625)
• common polymorphisms of GOLGB1 are not associated with nonsyndromic cleft palate susceptibility in the Brazilian population (PMID:29430628)
• Ethanol-induced Golgi disassembly was associated with de-dimerization of the largest Golgi matrix protein giantin, along with impaired transport of selected hepatic proteins. (PMID:30453527)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	golgb1	ENSDARG00000061951
mus_musculus	Golgb1	ENSMUSG00000034243
rattus_norvegicus	Golgb1	ENSRNOG00000030314
caenorhabditis_elegans		WBGENE00006375

Protein

Protein identifiers

Golgin subfamily B member 1 — Q14789 (reviewed: Q14789)

Alternative names: 372 kDa Golgi complex-associated protein, Giantin, Macrogolgin

All UniProt accessions (27): Q14789, A0A8J9C4H3, A0A8Q3SHH2, A0A8Q3SHH5, A0A8Q3SHI6, A0A8Q3SHI9, A0A8Q3SHM0, A0A8Q3SHM5, A0A8Q3SHP0, A0A8Q3SHQ4, A0A8Q3SHQ5, A0A8Q3SHQ9, A0A8Q3SHR7, A0A8Q3WK91, A0A8Q3WK92, A0A8Q3WKA7, A0A8Q3WKB4, A0A8Q3WKE2, A0A8Q3WKV5, A0A8Q3WLC9, A0A8Q3WLG1, A0A8Q3WLR7, C9J8Q0, E7EU81, F8WF12, H0Y867, H7C5I7

UniProt curated annotations — full annotation on UniProt →

Function. May participate in forming intercisternal cross-bridges of the Golgi complex.

Subunit / interactions. Homodimer; disulfide-linked. Interacts with PLK3.

Subcellular location. Golgi apparatus membrane.

Miscellaneous. Antigen in chronic rheumatoid arthritis and in the autoimmune disease Sjoegren syndrome.

Isoforms (4)

UniProt ID	Names	Canonical?
Q14789-1	1	yes
Q14789-2	2
Q14789-3	3
Q14789-4	4

RefSeq proteins (8): NP_001243415, NP_001243416, NP_001243417, NP_001353211, NP_001353212, NP_001353213, NP_001376560, NP_004478 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003106	Leu_zip_homeo	Domain
IPR026202	GOLGB1	Family

UniProt features (47 total): modified residue 12, region of interest 7, compositionally biased region 7, sequence variant 7, coiled-coil region 5, splice variant 4, topological domain 2, chain 1, transmembrane region 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

No AlphaFold model available for Q14789 — AlphaFold DB does not currently provide models for proteins above ~3000 aa.

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (12): 6, 17, 138, 528, 653, 2216, 2735, 2872, 2884, 3037, 1, 1

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-432722	Golgi Associated Vesicle Biogenesis
R-HSA-6807878	COPI-mediated anterograde transport
R-HSA-9703465	Signaling by FLT3 fusion proteins

MSigDB gene sets: 122 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_MCMV_INFECTION_UP, GOBP_PROTEIN_LOCALIZATION_TO_CYTOSKELETON, REACTOME_MEMBRANE_TRAFFICKING, SHEPARD_BMYB_MORPHOLINO_DN, BLALOCK_ALZHEIMERS_DISEASE_UP, GOBP_ENDOMEMBRANE_SYSTEM_ORGANIZATION, HAHTOLA_SEZARY_SYNDROM_UP, GOBP_PROTEIN_LOCALIZATION_TO_ORGANELLE, NOUZOVA_TRETINOIN_AND_H4_ACETYLATION, SHEPARD_BMYB_TARGETS, ATF_01, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_DN, GOBP_GOLGI_ORGANIZATION, GOCC_GOLGI_STACK, GOCC_CIS_GOLGI_NETWORK

GO Biological Process (4): regulation of DNA-templated transcription (GO:0006355), Golgi organization (GO:0007030), protein localization to pericentriolar material (GO:1905793), chondrocyte proliferation (GO:0035988)

GO Molecular Function (3): RNA binding (GO:0003723), sequence-specific DNA binding (GO:0043565), protein binding (GO:0005515)

GO Cellular Component (7): Golgi membrane (GO:0000139), endoplasmic reticulum-Golgi intermediate compartment (GO:0005793), Golgi apparatus (GO:0005794), Golgi stack (GO:0005795), cis-Golgi network (GO:0005801), cytosol (GO:0005829), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
trans-Golgi Network Vesicle Budding	1
ER to Golgi Anterograde Transport	1
FLT3 signaling in disease	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	3
intracellular membrane-bounded organelle	3
Golgi apparatus	2
cellular anatomical structure	2
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
organelle organization	1
endomembrane system organization	1
protein localization to centrosome	1
cell population proliferation	1
nucleic acid binding	1
DNA binding	1
binding	1
bounding membrane of organelle	1
endomembrane system	1
Golgi apparatus subcompartment	1

Protein interactions and networks

STRING

3091 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GOLGB1	ACBD3	Q9H3P7	987
GOLGB1	GOLGA5	Q8TBA6	920
GOLGB1	GORASP1	Q9BQQ3	920
GOLGB1	GOLGA2	Q08379	912
GOLGB1	RAB1A	P11476	799
GOLGB1	GOLGA1	Q92805	781
GOLGB1	GOLGA3	Q08378	776
GOLGB1	TGOLN2	O43493	772
GOLGB1	USO1	O60763	771
GOLGB1	POLQ	O75417	770
GOLGB1	GOLGA4	Q13439	755
GOLGB1	GOLPH3	Q9H4A6	694
GOLGB1	LMAN1	P49257	692
GOLGB1	COG3	Q96JB2	679
GOLGB1	COPB1	P53618	672

IntAct

141 interactions, top by confidence:

A	B	Type	Score
DYNLL1	BLTP3B	psi-mi:“MI:0914”(association)	0.730
TMED10	TMED1	psi-mi:“MI:0914”(association)	0.730
TMED9	TMED10	psi-mi:“MI:0914”(association)	0.730
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
TMED2	ATP9A	psi-mi:“MI:0914”(association)	0.640
DYNLL2	BLTP3B	psi-mi:“MI:0914”(association)	0.640
TRDN	TMEM223	psi-mi:“MI:0914”(association)	0.640
SCGN	SNAP23	psi-mi:“MI:0914”(association)	0.550
KSR2	POLR3A	psi-mi:“MI:0914”(association)	0.530
IPPK	TMEM223	psi-mi:“MI:0914”(association)	0.530
rep	TBKBP1	psi-mi:“MI:0914”(association)	0.530
LPAR1	TMEM120B	psi-mi:“MI:0914”(association)	0.530
GOLGB1	PFN2	psi-mi:“MI:0915”(physical association)	0.510
NRAS	ESYT2	psi-mi:“MI:2364”(proximity)	0.480
BIRC6	GOLGB1	psi-mi:“MI:0915”(physical association)	0.400
CFAP157	GOLGB1	psi-mi:“MI:0915”(physical association)	0.400
GOLGB1	HNRNPU	psi-mi:“MI:0915”(physical association)	0.400
COX4I2	GOLGB1	psi-mi:“MI:0915”(physical association)	0.400
ULK3	GOLGB1	psi-mi:“MI:0915”(physical association)	0.400
TASOR2	GOLGB1	psi-mi:“MI:0915”(physical association)	0.400
GOLGA4	GOLGB1	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (288): GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Proximity Label-MS), GOLGB1 (Proximity Label-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS), GOLGB1 (Affinity Capture-MS)

ESM2 similar proteins: D3ZZL9, E9Q1U1, F4I9A2, O75330, O97961, P49454, P61430, P97779, Q00547, Q03410, Q0VBY1, Q13439, Q14789, Q15075, Q15643, Q28628, Q4R7H3, Q53EZ4, Q5M7B7, Q5RI56, Q5T9S5, Q60563, Q61595, Q62209, Q640L5, Q6TFL3, Q70FJ1, Q7FAD5, Q861Q8, Q86UP2, Q8BL66, Q8CDI7, Q8CHG3, Q8HYY4, Q8IWJ2, Q8NB25, Q8NCX0, Q8R5M4, Q90631, Q90Z16

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
“Caspase 3 complex”	“down-regulates activity”	GOLGB1	cleavage
USO1	“up-regulates activity”	GOLGB1	binding
GOLGB1	“up-regulates activity”	GOLGA2	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 150 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
COPI-mediated anterograde transport	8	8.1×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
zinc ion transmembrane transport	5	26.4×	4e-04
intracellular zinc ion homeostasis	5	18.1×	1e-03
endoplasmic reticulum to Golgi vesicle-mediated transport	10	10.2×	6e-05
Golgi organization	8	8.0×	1e-03
intracellular protein transport	11	5.4×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

445 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	387
Likely benign	27
Benign	2

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
2423484	NC_000003.11:g.(?121459590)(121547499_?)del	Pathogenic

SpliceAI

2978 predictions. Top by Δscore:

Variant	Effect	Δscore
3:121667458:ATCT:A	donor_gain	1.0000
3:121667461:T:TA	donor_gain	1.0000
3:121667475:CCGT:C	donor_gain	1.0000
3:121667606:AAAAG:A	acceptor_gain	1.0000
3:121667607:AAAG:A	acceptor_gain	1.0000
3:121667608:AAG:A	acceptor_gain	1.0000
3:121667609:AG:A	acceptor_gain	1.0000
3:121667611:C:CC	acceptor_gain	1.0000
3:121667613:T:C	acceptor_gain	1.0000
3:121667613:T:TC	acceptor_gain	1.0000
3:121667618:A:C	acceptor_gain	1.0000
3:121669210:ACCG:A	donor_gain	1.0000
3:121669211:CCGC:C	donor_gain	1.0000
3:121669225:TGA:T	donor_gain	1.0000
3:121669351:GAGAA:G	acceptor_gain	1.0000
3:121669353:GAA:G	acceptor_gain	1.0000
3:121669356:C:CC	acceptor_gain	1.0000
3:121676891:A:AC	donor_gain	1.0000
3:121676892:C:CC	donor_gain	1.0000
3:121676892:CG:C	donor_gain	1.0000
3:121677282:CA:C	donor_loss	1.0000
3:121677283:A:AC	donor_gain	1.0000
3:121677283:A:AT	donor_loss	1.0000
3:121677284:C:CC	donor_gain	1.0000
3:121677284:CCTGT:C	donor_gain	1.0000
3:121677448:ATCC:A	acceptor_loss	1.0000
3:121677450:CCTAG:C	acceptor_loss	1.0000
3:121677451:CTAGA:C	acceptor_loss	1.0000
3:121681681:TAGTA:T	donor_loss	1.0000
3:121681683:GTACC:G	donor_loss	1.0000

AlphaMissense

21847 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:121694710:A:G	L1933P	0.997
3:121691931:C:G	R2473P	0.996
3:121694731:A:G	L1926P	0.996
3:121695433:A:G	L1692P	0.996
3:121697524:A:G	L995P	0.993
3:121697758:A:G	L917P	0.993
3:121719692:A:G	L237P	0.993
3:121729923:A:G	L64P	0.993
3:121694717:C:G	A1931P	0.992
3:121691943:A:G	L2469P	0.991
3:121695652:A:G	L1619P	0.991
3:121695655:A:G	L1618P	0.991
3:121697494:A:G	L1005P	0.991
3:121697512:A:G	L999P	0.991
3:121697516:C:G	A998P	0.991
3:121697716:A:G	L931P	0.991
3:121691248:C:G	A2701P	0.990
3:121691770:C:G	A2527P	0.990
3:121693877:A:G	W2211R	0.990
3:121693877:A:T	W2211R	0.990
3:121693906:C:G	R2201P	0.990
3:121694727:C:A	M1927I	0.990
3:121694727:C:G	M1927I	0.990
3:121694727:C:T	M1927I	0.990
3:121695453:T:A	K1685N	0.990
3:121695453:T:G	K1685N	0.990
3:121691226:A:G	L2708P	0.989
3:121691233:C:G	A2706P	0.989
3:121691758:C:G	A2531P	0.989
3:121693863:A:C	F2215L	0.989

dbSNP variants (sampled 300 via entrez): RS1000028156 (3:121748451 G>C), RS1000075600 (3:121690631 ACT>A), RS1000095570 (3:121710859 C>T), RS1000130276 (3:121741224 T>C), RS1000190070 (3:121683194 G>A,C), RS1000197682 (3:121678794 T>C), RS1000226948 (3:121717129 T>C), RS1000229336 (3:121732659 A>G), RS1000297903 (3:121683009 T>C), RS1000300622 (3:121699692 T>A), RS1000322700 (3:121678601 TCTGTTGCCCAGGTTAGAGTG>T), RS1000331472 (3:121675887 A>G,T), RS1000441830 (3:121665447 C>G), RS1000454350 (3:121704178 T>C), RS1000459866 (3:121741416 A>T)

Disease associations

OMIM: gene MIM:602500 | disease phenotypes: MIM:256100

GenCC curated gene-disease

Mondo (1): nephronophthisis (MONDO:0019005)

Orphanet (1): Nephronophthisis (Orphanet:655)

HPO phenotypes

1 total (1 of 1 shown, HPO-id order):

HPO	Term
HP:0000090	Nephronophthisis

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST90002396_198	Mean reticulocyte volume	4.000000e-12
GCST90013406_260	Liver enzyme levels (alkaline phosphatase)	1.000000e-10

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0010701	mean reticulocyte volume
EFO:0004533	alkaline phosphatase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

54 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	5
bisphenol A	increases expression, decreases expression	2
Cyclosporine	increases expression	2
afuresertib	increases expression	1
FR900359	affects phosphorylation	1
triphenyl phosphate	affects expression	1
sodium arsenate	decreases expression	1
beta-lapachone	decreases expression	1
arsenite	affects binding, decreases reaction	1
cobaltous chloride	increases expression	1
butyraldehyde	decreases expression	1
zinc chromate	increases abundance, increases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
pentanal	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
chromium hexavalent ion	increases abundance, increases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
bisphenol B	increases expression	1
bisphenol S	affects expression	1
bisphenol AF	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Acetaminophen	increases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Benztropine	affects cotreatment, decreases expression	1
Caffeine	affects phosphorylation	1
Clorgyline	increases expression	1
Clozapine	increases expression	1
Cuprizone	affects cotreatment, decreases expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SQ26	HAP1 GOLGB1 (-) 1	Cancer cell line	Male
CVCL_XP27	HAP1 GOLGB1 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

6 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT01022957	Not specified	COMPLETED	Nephronophthisis : Clinical and Genetic Study
NCT01401998	Not specified	RECRUITING	ARPKD Database Study
NCT04874909	Not specified	COMPLETED	Classification, Functional Stratification and Biomarkers in Ciliopathy (CILLICORIRCM)
NCT05286632	Not specified	COMPLETED	KidneYou - Innovative Digital Therapy
NCT06065852	Not specified	RECRUITING	National Registry of Rare Kidney Diseases
NCT06648044	Not specified	RECRUITING	Research of Therapeutic Targets in the Frame of Nephronophthisis and Renal Associated Ciliopathies