GRAMD4

Summary

GRAMD4 (GRAM domain containing 4, HGNC:29113) is a protein-coding gene on chromosome 22q13.31, encoding GRAM domain-containing protein 4 (Q6IC98). Plays a role as a mediator of E2F1-induced apoptosis in the absence of p53/TP53.

GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).

Source: NCBI Gene 23151 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 109 total
• MANE Select transcript: NM_015124

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29113
Approved symbol	GRAMD4
Name	GRAM domain containing 4
Location	22q13.31
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0767, DIP
Ensembl gene	ENSG00000075240
Ensembl biotype	protein_coding
OMIM	613691
Entrez	23151

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 7 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000361034, ENST00000406902, ENST00000408031, ENST00000431155, ENST00000447351, ENST00000456069, ENST00000490378, ENST00000969465

RefSeq mRNA: 2 — MANE Select: NM_015124 NM_001366660, NM_015124

CCDS: CCDS33672

Canonical transcript exons

ENST00000406902 — 19 exons

Exon	Start	End
ENSE00000657403	46675468	46675552
ENSE00000657404	46676600	46676668
ENSE00001551773	46677147	46679785
ENSE00001552787	46620386	46620565
ENSE00001554534	46626751	46626961
ENSE00002203006	46668799	46668908
ENSE00002203503	46663838	46663863
ENSE00002221716	46673670	46673814
ENSE00002224888	46666825	46666873
ENSE00002243321	46664026	46664117
ENSE00002244415	46658187	46658307
ENSE00002244455	46668096	46668167
ENSE00002251757	46668689	46668732
ENSE00002294961	46674657	46674750
ENSE00002297198	46672843	46672997
ENSE00002305294	46665615	46665706
ENSE00002313741	46663040	46663172
ENSE00002319568	46637840	46637960
ENSE00002322824	46661381	46661442

Expression profiles

Bgee: expression breadth ubiquitous, 242 present calls, max score 93.50.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 15.2108 / max 639.6168, expressed in 1803 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
192815	14.0242	1801
192819	0.7637	147
192825	0.1813	55
192820	0.1148	57
192826	0.0557	12
209509	0.0490	22
192814	0.0222	7

Top tissues by expression

282 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
mucosa of transverse colon	UBERON:0004991	93.50	gold quality
right lobe of liver	UBERON:0001114	92.44	gold quality
apex of heart	UBERON:0002098	92.19	gold quality
sural nerve	UBERON:0015488	91.66	gold quality
ventricular zone	UBERON:0003053	90.99	gold quality
cortical plate	UBERON:0005343	90.98	gold quality
monocyte	CL:0000576	90.90	gold quality
mononuclear cell	CL:0000842	90.79	gold quality
ganglionic eminence	UBERON:0004023	90.69	gold quality
leukocyte	CL:0000738	90.65	gold quality
heart left ventricle	UBERON:0002084	90.46	gold quality
cardiac ventricle	UBERON:0002082	89.91	gold quality
right atrium auricular region	UBERON:0006631	89.89	gold quality
skin of abdomen	UBERON:0001416	89.70	gold quality
transverse colon	UBERON:0001157	89.67	gold quality
left adrenal gland cortex	UBERON:0035825	89.55	gold quality
rectum	UBERON:0001052	89.54	gold quality
right adrenal gland cortex	UBERON:0035827	89.22	gold quality
skin of leg	UBERON:0001511	89.20	gold quality
small intestine Peyer’s patch	UBERON:0003454	89.13	gold quality
left adrenal gland	UBERON:0001234	88.78	gold quality
right adrenal gland	UBERON:0001233	88.67	gold quality
cardiac atrium	UBERON:0002081	88.58	gold quality
adenohypophysis	UBERON:0002196	88.53	gold quality
adrenal cortex	UBERON:0001235	88.39	gold quality
small intestine	UBERON:0002108	88.38	gold quality
granulocyte	CL:0000094	88.36	gold quality
zone of skin	UBERON:0000014	88.05	gold quality
gall bladder	UBERON:0002110	87.94	gold quality
islet of Langerhans	UBERON:0000006	87.91	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	8.62
E-MTAB-6911	no	7.47

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F1

miRNA regulators (miRDB)

69 targeting GRAMD4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-548AW	99.99	72.57	3559
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-3605-5P	99.96	67.12	932
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-144-3P	99.94	73.98	2698
HSA-MIR-218-5P	99.93	72.22	2103
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-3143	99.93	71.96	3104
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-944	99.82	70.85	3042
HSA-MIR-636	99.80	69.58	1500
HSA-MIR-577	99.78	69.13	2479
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-4530	99.69	66.47	1509
HSA-MIR-3175	99.65	66.30	2031

Literature-anchored findings (GeneRIF, showing 4)

• DIP induces p53-independent caspase-dependent and -independent apoptosis. DIP is localized in the mitochondria. DIP accumulates upon E2F1 activation. (PMID:15565177)
• localizes to the mitochondria, upregulated following E2F1 induction (PMID:15565177)
• GRAMD4 induces changes in Bcl-2 and Bax protein levels (PMID:21127500)
• The expression of GRAMD4 is up-regulated in hepatocellular carcinoma cell(HCC cell) lines and HCC tissues, and the increased expression is correlated with the clinicopathological characteristics of HCC. (PMID:23388340)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	gramd4b	ENSDARG00000045506
danio_rerio	gramd4a	ENSDARG00000069171
mus_musculus	Gramd4	ENSMUSG00000035900
rattus_norvegicus	Gramd4	ENSRNOG00000016968

Protein

Protein identifiers

GRAM domain-containing protein 4 — Q6IC98 (reviewed: Q6IC98)

Alternative names: Death-inducing protein

All UniProt accessions (4): Q6IC98, H0Y5A3, X6RHZ2, X6RIP6

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role as a mediator of E2F1-induced apoptosis in the absence of p53/TP53. Plays a role as a mediator of E2F1-induced apoptosis in the absence of p53/TP53. Inhibits TLR9 response to nucelic acids and regulates TLR9-mediated innate immune response.

Subunit / interactions. Interacts with RTN4 (isoform B).

Subcellular location. Mitochondrion membrane. Endoplasmic reticulum membrane.

Tissue specificity. Expressed in lung and in primary lung squamous cell carcinoma (LSCC).

Induction. Up-regulated in the mitochondria by E2F1 after addition of 4-hydroxytamoxifen (at protein level).

Isoforms (2)

UniProt ID	Names	Canonical?
Q6IC98-1	1	yes
Q6IC98-2	2

RefSeq proteins (2): NP_001353589, NP_055939* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004182	GRAM	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR037845	GRAMDC4_PH-GRAM	Domain
IPR037847	GRAMDC4	Family

Pfam: PF02893

UniProt features (14 total): transmembrane region 3, region of interest 3, modified residue 2, chain 1, splice variant 1, sequence variant 1, domain 1, coiled-coil region 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6IC98-F1	67.28	0.08

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 24, 28

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 201 (showing top): GOBP_TOLL_LIKE_RECEPTOR_9_SIGNALING_PATHWAY, MODULE_16, GOBP_NEGATIVE_REGULATION_OF_INTRACELLULAR_SIGNAL_TRANSDUCTION, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_REGULATION_OF_IMMUNE_RESPONSE, GOBP_DEFENSE_RESPONSE_TO_OTHER_ORGANISM, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, CAIRO_HEPATOBLASTOMA_DN, GOCC_MITOCHONDRIAL_ENVELOPE, CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_5, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_BIOTIC_STIMULUS, GOBP_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_INTRACELLULAR_RECEPTOR_SIGNALING_PATHWAY, GOBP_REGULATION_OF_RESPONSE_TO_BIOTIC_STIMULUS, GOBP_CYTOPLASMIC_PATTERN_RECOGNITION_RECEPTOR_SIGNALING_PATHWAY

GO Biological Process (3): apoptotic process (GO:0006915), negative regulation of toll-like receptor 9 signaling pathway (GO:0034164), positive regulation of apoptotic process (GO:0043065)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (5): mitochondrion (GO:0005739), endoplasmic reticulum membrane (GO:0005789), mitochondrial membrane (GO:0031966), endoplasmic reticulum (GO:0005783), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	2
intracellular membrane-bounded organelle	2
organelle membrane	2
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
toll-like receptor 9 signaling pathway	1
regulation of toll-like receptor 9 signaling pathway	1
negative regulation of cytoplasmic pattern recognition receptor signaling pathway	1
apoptotic process	1
regulation of apoptotic process	1
positive regulation of programmed cell death	1
binding	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
mitochondrion	1
mitochondrial envelope	1
endomembrane system	1
cellular anatomical structure	1

Protein interactions and networks

STRING

924 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GRAMD4	E2F1	Q01094	553
GRAMD4	PARP1	P09874	542
GRAMD4	BCL2	P10415	486
GRAMD4	SWT1	Q5T5J6	471
GRAMD4	CASP3	P42574	452
GRAMD4	QRICH1	Q2TAL8	452
GRAMD4	TBC1D22A	Q8WUA7	417
GRAMD4	GAPDHS	O14556	404
GRAMD4	ZNF408	Q9H9D4	404
GRAMD4	RNF130	Q86XS8	403
GRAMD4	NKRF	O15226	382
GRAMD4	RABL2B	Q9UNT1	379
GRAMD4	CCNJ	Q5T5M9	374
GRAMD4	ACOT13	Q9NPJ3	364
GRAMD4	SMCO2	A6NFE2	348

IntAct

47 interactions, top by confidence:

A	B	Type	Score
GADD45G	GRAMD4	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	SH2D4A	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	EXOC8	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	PLEKHF2	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	FAM9B	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	SMARCD1	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	NTAQ1	psi-mi:“MI:0915”(physical association)	0.560
C2CD6	GRAMD4	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	CCDC146	psi-mi:“MI:0915”(physical association)	0.560
GRAMD4	MTMR9	psi-mi:“MI:0915”(physical association)	0.560
TACC2	GRAMD4	psi-mi:“MI:0915”(physical association)	0.560
TBC1D15	MYO9A	psi-mi:“MI:0914”(association)	0.530
PBXIP1	GOLIM4	psi-mi:“MI:0914”(association)	0.530
TBC1D15	UBXN8	psi-mi:“MI:0914”(association)	0.530
Nme7	MCM3AP	psi-mi:“MI:0914”(association)	0.350
Kif4	UMPS	psi-mi:“MI:0914”(association)	0.350
TBC1D15	UBXN8	psi-mi:“MI:0914”(association)	0.350
RALBP1	HMGB1P1	psi-mi:“MI:0914”(association)	0.350
RALBP1	ABLIM1	psi-mi:“MI:0914”(association)	0.350
GNAO1	SNX2	psi-mi:“MI:0914”(association)	0.350
TBC1D15	TMEM223	psi-mi:“MI:0914”(association)	0.350
SLC30A5	NBAS	psi-mi:“MI:0914”(association)	0.350
GADD45G	GRAMD4	psi-mi:“MI:0915”(physical association)	0.000
MTMR9	GRAMD4	psi-mi:“MI:0915”(physical association)	0.000
TACC2	GRAMD4	psi-mi:“MI:0915”(physical association)	0.000
SH2D4A	GRAMD4	psi-mi:“MI:0915”(physical association)	0.000
EXOC8	GRAMD4	psi-mi:“MI:0915”(physical association)	0.000
PLEKHF2	GRAMD4	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (79): GRAMD4 (Affinity Capture-MS), GRAMD4 (Affinity Capture-MS), GRAMD4 (Affinity Capture-MS), GRAMD4 (Proximity Label-MS), GRAMD4 (Two-hybrid), SH2D4A (Two-hybrid), MTMR9 (Two-hybrid), EXOC8 (Two-hybrid), GADD45G (Two-hybrid), CCDC146 (Two-hybrid), TACC2 (Two-hybrid), ALS2CR11 (Two-hybrid), WDYHV1 (Two-hybrid), PLEKHF2 (Two-hybrid), FAM9B (Two-hybrid)

ESM2 similar proteins: A0A0R4IES7, A0JN62, A2AAE1, A2RV80, A4IFQ0, A6QQW8, F1Q8X5, O35382, P48553, P70398, Q08BT5, Q13769, Q2LD37, Q5F361, Q5R903, Q5RAQ5, Q5REX9, Q62824, Q68FX7, Q6DFZ1, Q6IC98, Q6NRC7, Q6P6Y1, Q6SP92, Q6ZWH5, Q7SXV1, Q7TSG1, Q7Z7G8, Q80TY5, Q8BHY8, Q8BKT7, Q8BQZ4, Q8CB44, Q8CIB5, Q8K3W0, Q8N960, Q8WN69, Q8WN70, Q91W96, Q92538

Diamond homologs: A2RV80, Q6IC98, Q8CB44, Q8IUY3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

109 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	80
Likely benign	4
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

4385 predictions. Top by Δscore:

Variant	Effect	Δscore
22:46620544:G:GT	donor_gain	1.0000
22:46637836:CTAG:C	acceptor_loss	1.0000
22:46637838:A:AG	acceptor_gain	1.0000
22:46637838:AG:A	acceptor_gain	1.0000
22:46637838:AGGCT:A	acceptor_gain	1.0000
22:46637839:G:A	acceptor_loss	1.0000
22:46637839:G:GG	acceptor_gain	1.0000
22:46637839:GG:G	acceptor_gain	1.0000
22:46637839:GGCTG:G	acceptor_gain	1.0000
22:46637957:TTAC:T	donor_gain	1.0000
22:46637958:TAC:T	donor_gain	1.0000
22:46637959:AC:A	donor_gain	1.0000
22:46637961:G:GG	donor_gain	1.0000
22:46658182:CATA:C	acceptor_loss	1.0000
22:46658183:ATAG:A	acceptor_loss	1.0000
22:46658185:A:AC	acceptor_loss	1.0000
22:46658185:A:AG	acceptor_gain	1.0000
22:46658186:G:GG	acceptor_gain	1.0000
22:46658186:GA:G	acceptor_gain	1.0000
22:46658186:GAGGA:G	acceptor_gain	1.0000
22:46658291:G:GT	donor_gain	1.0000
22:46663039:GAGC:G	acceptor_gain	1.0000
22:46663169:GCAG:G	donor_gain	1.0000
22:46663170:CAGGT:C	donor_loss	1.0000
22:46663171:AG:A	donor_loss	1.0000
22:46663172:GGTAG:G	donor_loss	1.0000
22:46663173:G:GG	donor_gain	1.0000
22:46663173:G:T	donor_loss	1.0000
22:46663903:GT:G	donor_gain	1.0000
22:46664023:CAGA:C	acceptor_loss	1.0000

AlphaMissense

3786 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
22:46637928:T:C	L84P	1.000
22:46637936:G:C	A87P	1.000
22:46637937:C:A	A87D	1.000
22:46637943:T:C	L89S	1.000
22:46663160:T:A	L196Q	1.000
22:46663840:T:C	L201S	1.000
22:46668132:T:C	F299L	1.000
22:46668133:T:C	F299S	1.000
22:46668134:C:A	F299L	1.000
22:46668134:C:G	F299L	1.000
22:46668139:T:C	L301P	1.000
22:46668142:T:A	V302E	1.000
22:46668145:T:C	L303P	1.000
22:46668154:C:A	A306D	1.000
22:46668167:G:C	Q310H	1.000
22:46668167:G:T	Q310H	1.000
22:46674677:T:C	C469R	1.000
22:46674678:G:A	C469Y	1.000
22:46674679:C:G	C469W	1.000
22:46674684:T:C	L471P	1.000
22:46674687:T:A	I472N	1.000
22:46674687:T:C	I472T	1.000
22:46674687:T:G	I472S	1.000
22:46674693:G:C	R474T	1.000
22:46674693:G:T	R474M	1.000
22:46674694:G:C	R474S	1.000
22:46674694:G:T	R474S	1.000
22:46674728:G:A	G486R	1.000
22:46674728:G:C	G486R	1.000
22:46674728:G:T	G486W	1.000

dbSNP variants (sampled 300 via entrez): RS1000026786 (22:46659531 G>A), RS1000036944 (22:46603837 G>A), RS1000042193 (22:46588829 C>T), RS1000096984 (22:46644435 G>A,T), RS1000106966 (22:46591470 C>T), RS1000109039 (22:46675711 C>T), RS1000133009 (22:46630789 G>A), RS1000147626 (22:46644694 C>T), RS1000148339 (22:46609580 C>T), RS1000192273 (22:46605767 G>C), RS1000205446 (22:46612397 GTTGGAGGAAGGCCTTCTCTCC>G), RS1000256600 (22:46599502 T>C), RS1000285848 (22:46596615 A>G), RS1000312886 (22:46611300 C>A,G,T), RS1000313393 (22:46647080 G>A,T)

Disease associations

OMIM: gene MIM:613691 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST002828_20	Urate levels in obese individuals	9.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

30 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cisplatin	increases expression, increases reaction, affects binding, decreases expression	3
Valproic Acid	affects expression, increases expression, increases methylation	3
bisphenol A	increases expression	2
Benzo(a)pyrene	decreases expression, increases methylation	2
Tobacco Smoke Pollution	decreases expression	2
FR900359	affects phosphorylation	1
trichostatin A	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
sodium arsenite	increases expression	1
butyraldehyde	decreases expression	1
aflatoxin B2	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, decreases expression	1
beta-methylcholine	affects expression	1
abrine	decreases expression	1
bisphenol S	decreases methylation	1
jinfukang	increases reaction, increases expression	1
Fulvestrant	decreases methylation	1
Arsenic	affects methylation	1
Atrazine	decreases expression	1
Vehicle Emissions	increases abundance, increases expression	1
Calcitriol	increases expression	1
Doxorubicin	decreases expression	1
Fluorouracil	increases expression, increases reaction	1
Lipopolysaccharides	affects cotreatment, decreases expression	1
Malathion	decreases expression	1
Silicon Dioxide	decreases expression	1
Tunicamycin	decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	1
Sodium Selenite	decreases expression	1
Particulate Matter	increases abundance, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.