GRIP2

Summary

GRIP2 (glutamate receptor interacting protein 2, HGNC:23841) is a protein-coding gene on chromosome 3p25.1, encoding Glutamate receptor-interacting protein 2 (Q9C0E4). May play a role as a localized scaffold for the assembly of a multiprotein signaling complex and as mediator of the trafficking of its binding partners at specific subcellular location in neurons.

Predicted to enable glutamate receptor binding activity. Predicted to be involved in several processes, including neurotransmitter receptor transport, endosome to postsynaptic membrane; positive regulation of AMPA glutamate receptor clustering; and positive regulation of excitatory postsynaptic potential. Predicted to act upstream of or within Notch signaling pathway; artery smooth muscle contraction; and positive regulation of blood pressure. Predicted to be located in dendritic shaft. Predicted to be active in glutamatergic synapse and postsynaptic density, intracellular component.

Source: NCBI Gene 80852 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 111 total
• MANE Select transcript: NM_001080423

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:23841
Approved symbol	GRIP2
Name	glutamate receptor interacting protein 2
Location	3p25.1
Locus type	gene with protein product
Status	Approved
Aliases	KIAA1719
Ensembl gene	ENSG00000144596
Ensembl biotype	protein_coding
Entrez	80852

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 5 protein_coding, 2 retained_intron, 1 nonsense_mediated_decay

ENST00000413414, ENST00000422481, ENST00000430219, ENST00000619221, ENST00000621039, ENST00000637182, ENST00000637939, ENST00000864465

RefSeq mRNA: 1 — MANE Select: NM_001080423 NM_001080423

CCDS: CCDS46766

Canonical transcript exons

ENST00000621039 — 24 exons

Exon	Start	End
ENSE00003479702	14511413	14511479
ENSE00003511677	14509820	14509964
ENSE00003532731	14507561	14507700
ENSE00003596911	14511165	14511310
ENSE00003609078	14506801	14506980
ENSE00003668402	14505615	14505789
ENSE00003711721	14525437	14525572
ENSE00003717031	14517772	14517897
ENSE00003718913	14540269	14540342
ENSE00003719877	14494843	14494989
ENSE00003719878	14517064	14517213
ENSE00003723657	14523612	14523698
ENSE00003723819	14496417	14496560
ENSE00003726576	14520390	14520537
ENSE00003735481	14525851	14525931
ENSE00003735668	14520110	14520279
ENSE00003736502	14514292	14514478
ENSE00003740840	14512777	14512857
ENSE00003741751	14503566	14503671
ENSE00003741874	14521642	14521787
ENSE00003743766	14523000	14523075
ENSE00003746985	14524393	14524538
ENSE00003753086	14513665	14513810
ENSE00003848018	14489107	14493826

Expression profiles

Bgee: expression breadth ubiquitous, 202 present calls, max score 95.22.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.2801 / max 27.8757, expressed in 122 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
41227	0.1102	49
41229	0.0789	46
41226	0.0491	21
41228	0.0420	29

Top tissues by expression

286 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
apex of heart	UBERON:0002098	95.22	gold quality
lateral nuclear group of thalamus	UBERON:0002736	91.19	gold quality
hindlimb stylopod muscle	UBERON:0004252	91.01	gold quality
body of tongue	UBERON:0011876	89.40	gold quality
heart left ventricle	UBERON:0002084	88.60	gold quality
cardiac ventricle	UBERON:0002082	88.51	gold quality
gastrocnemius	UBERON:0001388	87.78	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	87.74	gold quality
muscle of leg	UBERON:0001383	87.66	gold quality
muscle organ	UBERON:0001630	87.07	gold quality
skeletal muscle tissue	UBERON:0001134	86.37	gold quality
type B pancreatic cell	CL:0000169	86.32	gold quality
diaphragm	UBERON:0001103	86.07	silver quality
vena cava	UBERON:0004087	85.95	silver quality
olfactory bulb	UBERON:0002264	85.94	silver quality
triceps brachii	UBERON:0001509	85.69	silver quality
vastus lateralis	UBERON:0001379	85.67	gold quality
quadriceps femoris	UBERON:0001377	85.35	silver quality
ventral tegmental area	UBERON:0002691	84.96	gold quality
tongue	UBERON:0001723	84.65	gold quality
dorsal plus ventral thalamus	UBERON:0001897	84.44	gold quality
muscle tissue	UBERON:0002385	83.77	gold quality
heart	UBERON:0000948	83.22	gold quality
cardia of stomach	UBERON:0001162	82.95	gold quality
heart right ventricle	UBERON:0002080	82.74	silver quality
right atrium auricular region	UBERON:0006631	82.61	gold quality
gluteal muscle	UBERON:0002000	82.49	gold quality
subthalamic nucleus	UBERON:0001906	82.27	silver quality
Brodmann (1909) area 10	UBERON:0013541	81.91	gold quality
cardiac atrium	UBERON:0002081	81.81	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-HCAD-25	yes	38.05
E-GEOD-81608	yes	16.21
E-ENAD-17	no	178.90
E-ANND-3	no	4.17

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

188 targeting GRIP2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-6793-5P	99.97	65.95	758
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-1236-3P	99.94	68.04	1695
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-6809-3P	99.91	71.45	3814

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	grip2b	ENSDARG00000027618
danio_rerio	grip2a	ENSDARG00000087187
mus_musculus	Grip2	ENSMUSG00000030098
rattus_norvegicus	Grip2	ENSRNOG00000009726

Paralogs (6): MAGI3 (ENSG00000081026), MAGI1 (ENSG00000151276), SAV1 (ENSG00000151748), GRIP1 (ENSG00000155974), MAGI2 (ENSG00000187391), MAGIX (ENSG00000269313)

Protein

Protein identifiers

Glutamate receptor-interacting protein 2 — Q9C0E4 (reviewed: Q9C0E4)

All UniProt accessions (5): Q9C0E4, A0A087WX15, A0A087WYB3, A0A1B0GUL8, A0A1B0GWJ3

UniProt curated annotations — full annotation on UniProt →

Function. May play a role as a localized scaffold for the assembly of a multiprotein signaling complex and as mediator of the trafficking of its binding partners at specific subcellular location in neurons.

Subunit / interactions. Interacts with EFNB1, EFNB3, GRIA2, GRIA3, CSPG4 and GRIPAP1. Can form homomultimers and heteromultimers with GRIP1. Interacts with the C-terminal tail of PRLHR.

Subcellular location. Cytoplasm. Membrane.

Domain organisation. PDZ 5 mediates the C-terminal binding of GRIA2 and GRIA3. PDZ 6 mediates interaction with the PDZ recognition motif of EFNB1. PDZ 7 mediates interaction with CSPG4.

Miscellaneous. Due to intron retention.

Similarity. Belongs to the GRIP2 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9C0E4-1	1	yes
Q9C0E4-2	2

RefSeq proteins (1): NP_001073892* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001478	PDZ	Domain
IPR036034	PDZ_sf	Homologous_superfamily
IPR041489	PDZ_6	Domain
IPR043545	GRIP1/2	Family

Pfam: PF00595, PF17820

UniProt features (40 total): strand 13, domain 7, compositionally biased region 5, region of interest 4, helix 4, splice variant 2, turn 2, chain 1, modified residue 1, sequence conflict 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
1V62	SOLUTION NMR
1X5R	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9C0E4-F1	62.74	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 38

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-416993	Trafficking of GluR2-containing AMPA receptors

MSigDB gene sets: 158 (showing top): MORF_RAGE, MORF_FLT1, GOBP_REGULATION_OF_BLOOD_PRESSURE, YAGI_AML_WITH_INV_16_TRANSLOCATION, MORF_MSH3, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, MORF_BRCA1, MORF_ATRX, GOBP_VESICLE_MEDIATED_TRANSPORT, MORF_ESR1, GOBP_PROTEIN_LOCALIZATION_TO_CELL_PERIPHERY, GOBP_REGULATION_OF_ANATOMICAL_STRUCTURE_SIZE, GOBP_MUSCLE_CONTRACTION, MORF_PPP5C

GO Biological Process (5): Notch signaling pathway (GO:0007219), artery smooth muscle contraction (GO:0014824), positive regulation of blood pressure (GO:0045777), neurotransmitter receptor transport, endosome to postsynaptic membrane (GO:0098887), vesicle-mediated transport in synapse (GO:0099003)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (5): cytosol (GO:0005829), plasma membrane (GO:0005886), glutamatergic synapse (GO:0098978), cytoplasm (GO:0005737), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Trafficking of AMPA receptors	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
synapse	2
cell surface receptor signaling pathway	1
tonic smooth muscle contraction	1
vascular associated smooth muscle contraction	1
regulation of blood pressure	1
intercellular transport	1
neurotransmitter receptor transport to postsynaptic membrane	1
neurotransmitter receptor transport, endosome to plasma membrane	1
vesicle-mediated transport	1
binding	1
cytoplasm	1
membrane	1
cell periphery	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

826 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
GRIP2	PICK1	Q9NRD5	891
GRIP2	GRIA2	P42262	865
GRIP2	GRIPAP1	Q4V328	841
GRIP2	GRIA3	P42263	741
GRIP2	PRLHR	P49683	669
GRIP2	PRLH	P81277	668
GRIP2	ZNF668	Q96K58	659
GRIP2	SYPL1	Q16563	639
GRIP2	RUSC2	Q8N2Y8	622
GRIP2	TUBGCP4	Q9UGJ1	609
GRIP2	RALGDS	Q12967	608
GRIP2	TUBGCP3	Q96CW5	576
GRIP2	ZDHHC5	Q9C0B5	576
GRIP2	ZDHHC8	Q9ULC8	576
GRIP2	AKAP6	Q13023	559

IntAct

2065 interactions, top by confidence:

A	B	Type	Score
PRLHR	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.610
GRIP2	NECTIN1	psi-mi:“MI:0915”(physical association)	0.590
GRIP2	NECTIN1	psi-mi:“MI:0407”(direct interaction)	0.590
NECTIN1	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.590
E6	GRIP2	psi-mi:“MI:0915”(physical association)	0.540
E6	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.540
NRXN3	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
GRIP2	CSPG4	psi-mi:“MI:0407”(direct interaction)	0.440
CNTNAP4	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
PPFIA1	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
NECTIN3	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
GYPC	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
TRAF7	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
PTTG2	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
GRIP2	GYPC	psi-mi:“MI:0407”(direct interaction)	0.440
MYOT	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
JAG1	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
EVI5	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
GRIP2	KCNV1	psi-mi:“MI:0407”(direct interaction)	0.440
CIB2	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
GNG4	GRIP2	psi-mi:“MI:0407”(direct interaction)	0.440
GRIP2	NRXN1	psi-mi:“MI:0407”(direct interaction)	0.440

BioGRID (12): GRIP2 (Synthetic Lethality), GRIP2 (Two-hybrid), GRIP2 (Affinity Capture-Western), GRIP2 (Affinity Capture-Western), PPFIA1 (Affinity Capture-Western), GIT1 (Affinity Capture-Western), GRIP2 (Two-hybrid), GRIP2 (Two-hybrid), GRIP2 (Affinity Capture-MS), GRIP2 (Affinity Capture-MS), GRIP2 (Proximity Label-MS), GRIP2 (Two-hybrid)

ESM2 similar proteins: A0A0G2K2P5, A1A5G4, A8E0R9, G9CGD6, O08874, O54785, O70263, O88382, O97758, P15056, P28028, P34908, P39447, P53666, P53667, P53668, P53669, P53670, P53671, P97879, Q04982, Q07157, Q16513, Q32L23, Q5F488, Q5TCQ9, Q6ZWJ1, Q80T23, Q812E4, Q86UL8, Q8N448, Q8QFP8, Q8TBB1, Q8TDW5, Q8TEW8, Q91XL2, Q925T6, Q95168, Q96NE9, Q9C0E4

Diamond homologs: A1Z9P3, A1ZA47, A2ALU4, A8E0R9, D4A702, E9Q9W7, O00151, O14910, O70209, O70400, O75112, O88952, P36202, P50479, P52944, P70271, P97879, Q01613, Q09JY9, Q0P5E6, Q0P5F3, Q13424, Q13796, Q27IV2, Q28626, Q2M3G4, Q32LM6, Q3SYZ8, Q3T005, Q3T0C8, Q53GG5, Q5E9E1, Q5F425, Q5RAA5, Q5RBI7, Q5SX79, Q61234, Q62920, Q66HS7, Q6AYD6

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 78 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
EPH-Ephrin signaling	6	16.8×	8e-04

GO biological processes:

GO term	Partners	Fold	FDR
ephrin receptor signaling pathway	7	33.9×	1e-06
cell-cell adhesion	9	12.9×	1e-05
regulation of actin cytoskeleton organization	5	11.1×	9e-03
axon guidance	8	10.2×	3e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

111 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	90
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

4345 predictions. Top by Δscore:

Variant	Effect	Δscore
3:14493665:T:TA	donor_gain	1.0000
3:14493837:C:CT	acceptor_gain	1.0000
3:14494837:CATTA:C	donor_loss	1.0000
3:14494838:ATTAC:A	donor_loss	1.0000
3:14494839:TTA:T	donor_loss	1.0000
3:14494840:TAC:T	donor_loss	1.0000
3:14494987:CAC:C	acceptor_gain	1.0000
3:14494990:C:A	acceptor_loss	1.0000
3:14494991:T:C	acceptor_loss	1.0000
3:14506797:TTAC:T	donor_loss	1.0000
3:14506799:A:C	donor_loss	1.0000
3:14506800:C:CG	donor_loss	1.0000
3:14506977:GGAC:G	acceptor_gain	1.0000
3:14506978:GACC:G	acceptor_loss	1.0000
3:14506981:C:CC	acceptor_gain	1.0000
3:14507516:T:TA	donor_gain	1.0000
3:14507537:C:CA	donor_gain	1.0000
3:14507559:A:AC	donor_gain	1.0000
3:14507560:C:CC	donor_gain	1.0000
3:14507560:CG:C	donor_gain	1.0000
3:14507560:CGGT:C	donor_gain	1.0000
3:14507573:T:TA	donor_gain	1.0000
3:14507712:A:C	acceptor_gain	1.0000
3:14511159:CCATA:C	donor_loss	1.0000
3:14511160:CATAC:C	donor_loss	1.0000
3:14511161:ATAC:A	donor_loss	1.0000
3:14511162:TACCA:T	donor_loss	1.0000
3:14511163:A:AC	donor_gain	1.0000
3:14511163:ACCA:A	donor_loss	1.0000
3:14511164:C:CC	donor_gain	1.0000

AlphaMissense

6732 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:14507584:A:G	L732P	1.000
3:14511194:A:G	L635P	1.000
3:14511281:A:T	L606Q	1.000
3:14525470:A:T	V75D	1.000
3:14525512:A:G	L61P	1.000
3:14494910:A:T	V968D	0.999
3:14494949:A:G	F955S	0.999
3:14507590:A:T	V730D	0.999
3:14507611:A:G	L723P	0.999
3:14507662:A:T	I706N	0.999
3:14507666:C:G	A705P	0.999
3:14507689:A:T	I697N	0.999
3:14509826:G:T	A691D	0.999
3:14509853:A:T	I682N	0.999
3:14509889:A:T	I670N	0.999
3:14509895:A:C	I668S	0.999
3:14509895:A:G	I668T	0.999
3:14509895:A:T	I668N	0.999
3:14509922:A:G	L659P	0.999
3:14511181:C:A	K639N	0.999
3:14511181:C:G	K639N	0.999
3:14511194:A:T	L635Q	0.999
3:14511276:C:G	A608P	0.999
3:14511281:A:C	L606R	0.999
3:14511281:A:G	L606P	0.999
3:14511287:T:C	D604G	0.999
3:14511287:T:G	D604A	0.999
3:14511310:C:A	R596S	0.999
3:14511310:C:G	R596S	0.999
3:14511413:C:A	R596M	0.999

dbSNP variants (sampled 300 via entrez): RS1000080840 (3:14561851 C>T), RS1000088426 (3:14574129 C>A,T), RS1000104045 (3:14599719 G>A,T), RS1000138939 (3:14567545 A>C), RS1000156591 (3:14540423 TGGGCACCGAGTCCACCCACTGCAGC>T), RS1000190083 (3:14497778 G>A,T), RS1000196942 (3:14529498 G>A,T), RS1000233110 (3:14535091 G>A), RS1000259618 (3:14566921 A>G), RS1000265535 (3:14551829 G>C), RS1000293707 (3:14572220 A>G), RS1000293729 (3:14535570 G>A), RS1000331178 (3:14541216 C>T), RS1000343608 (3:14595733 C>T), RS1000349889 (3:14556445 G>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST000477_25	Cognitive performance	3.000000e-06
GCST012796_2	Sjögren’s syndrome	5.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0003926	neuropsychological test

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

21 total (human), top 21 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Aflatoxin B1	increases expression, increases methylation	2
bufotalin	decreases expression	1
bisphenol A	decreases methylation	1
sodium arsenite	increases expression	1
butyraldehyde	increases expression	1
benzo(e)pyrene	decreases methylation	1
S-(1,2-dichlorovinyl)cysteine	increases expression, affects cotreatment, decreases expression, affects response to substance	1
CGP 52608	affects binding, increases reaction	1
jinfukang	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Zoledronic Acid	increases expression	1
Benzo(a)pyrene	affects methylation	1
Cisplatin	affects cotreatment, increases expression	1
Copper	affects cotreatment, decreases expression	1
Lead	affects expression	1
Lipopolysaccharides	affects response to substance, increases expression, affects cotreatment, decreases expression	1
Methapyrilene	decreases methylation	1
Niclosamide	increases expression	1
Valproic Acid	increases methylation	1
Acrylamide	decreases expression	1
Permethrin	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.