GRXCR2
geneOn this page
Also known as DFNB101
Summary
GRXCR2 (glutaredoxin and cysteine rich domain containing 2, HGNC:33862) is a protein-coding gene on chromosome 5q32, encoding Glutaredoxin domain-containing cysteine-rich protein 2 (A6NFK2). Required for hearing.
This gene encodes a protein containing a glutaredoxin domain, which functions in protein S-glutathionylation. A mutation in this gene was found in a family with autoosomal recessive nonsyndromic sensorineural deafness-101.
Source: NCBI Gene 643226 — RefSeq curated summary.
At a glance
- Gene–disease (curated): autosomal recessive nonsyndromic hearing loss 101 (Strong, GenCC) — +2 more curated relationships
- GWAS associations: 1
- Clinical variants (ClinVar): 109 total — 6 pathogenic, 2 likely-pathogenic
- Phenotypes (HPO): 5
- MANE Select transcript:
NM_001080516
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:33862 |
| Approved symbol | GRXCR2 |
| Name | glutaredoxin and cysteine rich domain containing 2 |
| Location | 5q32 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | DFNB101 |
| Ensembl gene | ENSG00000204928 |
| Ensembl biotype | protein_coding |
| OMIM | 615762 |
| Entrez | 643226 |
Gene structure
Transcript identifiers
Ensembl transcripts: 2 — 2 protein_coding
ENST00000377976, ENST00000639411
RefSeq mRNA: 1 — MANE Select: NM_001080516
NM_001080516
CCDS: CCDS34263
Canonical transcript exons
ENST00000377976 — 3 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001416400 | 145866501 | 145866728 |
| ENSE00001475731 | 145872633 | 145873014 |
| ENSE00003805370 | 145858521 | 145859915 |
Expression profiles
Bgee: expression breadth broad, 24 present calls, max score 86.22.
Top tissues by expression
117 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 86.22 | gold quality |
| apex of heart | UBERON:0002098 | 69.21 | gold quality |
| right atrium auricular region | UBERON:0006631 | 60.83 | gold quality |
| heart left ventricle | UBERON:0002084 | 53.76 | gold quality |
| heart | UBERON:0000948 | 52.21 | gold quality |
| left testis | UBERON:0004533 | 45.74 | gold quality |
| testis | UBERON:0000473 | 45.48 | gold quality |
| right testis | UBERON:0004534 | 44.70 | gold quality |
| skin of abdomen | UBERON:0001416 | 44.15 | gold quality |
| zone of skin | UBERON:0000014 | 43.96 | gold quality |
| skin of leg | UBERON:0001511 | 43.57 | gold quality |
| right lobe of thyroid gland | UBERON:0001119 | 40.33 | gold quality |
| tonsil | UBERON:0002372 | 39.57 | gold quality |
| calcaneal tendon | UBERON:0003701 | 39.40 | silver quality |
| colonic epithelium | UBERON:0000397 | 37.20 | gold quality |
| ventricular zone | UBERON:0003053 | 36.48 | gold quality |
| cortical plate | UBERON:0005343 | 36.47 | gold quality |
| sural nerve | UBERON:0015488 | 36.38 | gold quality |
| hindlimb stylopod muscle | UBERON:0004252 | 36.36 | gold quality |
| olfactory segment of nasal mucosa | UBERON:0005386 | 36.31 | silver quality |
| mucosa of transverse colon | UBERON:0004991 | 36.17 | gold quality |
| bone marrow cell | CL:0002092 | 36.16 | gold quality |
| thyroid gland | UBERON:0002046 | 36.13 | gold quality |
| ganglionic eminence | UBERON:0004023 | 35.49 | gold quality |
| left lobe of thyroid gland | UBERON:0001120 | 35.45 | silver quality |
| saliva-secreting gland | UBERON:0001044 | 34.82 | gold quality |
| bone marrow | UBERON:0002371 | 34.30 | gold quality |
| skeletal muscle tissue | UBERON:0001134 | 33.38 | gold quality |
| right uterine tube | UBERON:0001302 | 33.04 | gold quality |
| gall bladder | UBERON:0002110 | 32.35 | gold quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 3.12 |
Regulation
Is transcription factor: no
Literature-anchored findings (GeneRIF, showing 3)
- ur results indicate that GRXCR2 should be considered in differential genetic diagnosis for individuals with early onset, moderate-to-severe and progressive hearing loss. (PMID:24619944)
- GRXCR2 plays an intrinsic role in bundle orientation, organization, and sensory function in the inner ear during development and at maturity (PMID:30157177)
- Whole exome sequencing reveals a biallelic frameshift mutation in GRXCR2 in hearing impairment in Cameroon. (PMID:33528103)
Cross-species orthologs
5 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| mus_musculus | Grxcr2 | ENSMUSG00000073574 |
| rattus_norvegicus | Grxcr2 | ENSRNOG00000039325 |
| drosophila_melanogaster | CG12206 | FBGN0029662 |
| drosophila_melanogaster | CG31559 | FBGN0051559 |
| caenorhabditis_elegans | WBGENE00021593 |
Paralogs (2): GLRX2 (ENSG00000023572), GRXCR1 (ENSG00000215203)
Protein
Protein identifiers
Glutaredoxin domain-containing cysteine-rich protein 2 — A6NFK2 (reviewed: A6NFK2)
Alternative names: GRXCR1-like protein, Glutaredoxin domain-containing cysteine-rich protein 1-like protein
All UniProt accessions (2): A6NFK2, A0A1W2PQQ7
UniProt curated annotations — full annotation on UniProt →
Function. Required for hearing. Plays a role in maintaining cochlear stereocilia bundles that are involved in sound detection. Ensures the restriction of TPRN to the basal region of stereocilia in hair cells.
Subunit / interactions. Interacts with TPRN; the interaction restricts TPRN to the stereocilum basal region.
Subcellular location. Cell projection. Stereocilium.
Disease relevance. Deafness, autosomal recessive, 101 (DFNB101) [MIM:615837] A form of non-syndromic deafness characterized by bilateral, moderate to severe hearing loss. Vestibular function is unaffected. The disease is caused by variants affecting the gene represented in this entry.
Similarity. Belongs to the GRXCR2 family.
RefSeq proteins (1): NP_001073985* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR033023 | GRXCR2 | Family |
| IPR036410 | HSP_DnaJ_Cys-rich_dom_sf | Homologous_superfamily |
Pfam: PF23733
UniProt features (6 total): region of interest 2, compositionally biased region 2, chain 1, sequence variant 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-A6NFK2-F1 | 59.23 | 0.02 |
Function
Pathways and Gene Ontology
Reactome pathways
2 pathways
| ID | Pathway |
|---|---|
| R-HSA-9662360 | Sensory processing of sound by inner hair cells of the cochlea |
| R-HSA-9662361 | Sensory processing of sound by outer hair cells of the cochlea |
MSigDB gene sets: 47 (showing top):
GOBP_EPITHELIUM_DEVELOPMENT, GOBP_SENSORY_PERCEPTION_OF_MECHANICAL_STIMULUS, GOBP_NEUROGENESIS, GOBP_EPIDERMAL_CELL_DIFFERENTIATION, GOBP_ANIMAL_ORGAN_MORPHOGENESIS, GOBP_EAR_DEVELOPMENT, GOBP_EMBRYONIC_ORGAN_MORPHOGENESIS, GOBP_EAR_MORPHOGENESIS, GOBP_EPIDERMIS_DEVELOPMENT, GOBP_AUDITORY_RECEPTOR_CELL_DEVELOPMENT, GOBP_MECHANORECEPTOR_DIFFERENTIATION, GOBP_HAIR_CELL_DIFFERENTIATION, GOBP_SENSORY_PERCEPTION, GOCC_NEURON_PROJECTION, GOBP_EMBRYO_DEVELOPMENT
GO Biological Process (3): sensory perception of sound (GO:0007605), auditory receptor cell stereocilium organization (GO:0060088), inner ear receptor cell stereocilium organization (GO:0060122)
GO Molecular Function (0):
GO Cellular Component (5): microvillus (GO:0005902), stereocilium shaft (GO:0120043), stereocilium base (GO:0120044), stereocilium (GO:0032420), cell projection (GO:0042995)
Reactome top-level categories
Rollup of top-1 pathways:
| Category | Pathways |
|---|---|
| Sensory processing of sound | 2 |
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular anatomical structure | 3 |
| actin-based cell projection | 2 |
| stereocilium | 2 |
| sensory perception of mechanical stimulus | 1 |
| auditory receptor cell morphogenesis | 1 |
| inner ear receptor cell stereocilium organization | 1 |
| neuron projection development | 1 |
| inner ear receptor cell development | 1 |
| actin filament bundle | 1 |
| stereocilium bundle | 1 |
| neuron projection | 1 |
Protein interactions and networks
STRING
378 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| GRXCR2 | STRC | Q7RTU9 | 687 |
| GRXCR2 | CLIC5 | Q9NZA1 | 671 |
| GRXCR2 | CLIC6 | Q96NY7 | 651 |
| GRXCR2 | TPRN | Q4KMQ1 | 632 |
| GRXCR2 | CLRN2 | A0PK11 | 565 |
| GRXCR2 | ESPN | B1AK53 | 530 |
| GRXCR2 | PPP1R17 | O96001 | 505 |
| GRXCR2 | E9PNW1 | E9PNW1 | 498 |
| GRXCR2 | RIPOR2 | Q9Y4F9 | 495 |
| GRXCR2 | GIPC3 | Q8TF64 | 494 |
| GRXCR2 | NSG2 | Q9Y328 | 493 |
| GRXCR2 | CHRNA10 | Q9GZZ6 | 490 |
| GRXCR2 | USH1G | Q495M9 | 490 |
| GRXCR2 | CABP2 | Q9NPB3 | 478 |
| GRXCR2 | PRELID2 | Q8N945 | 478 |
IntAct
2 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| M | psi-mi:“MI:0914”(association) | 0.350 |
BioGRID (1): GRXCR2 (Affinity Capture-MS)
ESM2 similar proteins: A2XTW9, A6NFK2, A8MW92, D3Z1Q2, D3Z6S9, F1N8V3, F8W4H9, M0R2J8, P0DM64, P0DO92, P58270, P62932, Q01954, Q0P5X5, Q3TYR5, Q40359, Q49A92, Q4R989, Q503Y8, Q5XEM9, Q5XIV2, Q66HF0, Q6ZN30, Q6ZVD7, Q7L4S7, Q7PCK7, Q7TP54, Q80T69, Q8BMQ3, Q8BZJ8, Q8C5V0, Q8IZS5, Q8K4P8, Q8K4S1, Q8LA16, Q8NA82, Q8S8M9, Q8WWI1, Q8WWY6, Q96G30
Diamond homologs: A6NFK2, A8MXD5, Q3TYR5, Q50H32, O23419, Q02784, Q0JM76, Q6NLU2, Q8LBK6, Q9FLE8, Q9HDW8, Q9LH89, Q9VNL4, Q9W4S1
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
109 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 6 |
| Likely pathogenic | 2 |
| Uncertain significance | 57 |
| Likely benign | 27 |
| Benign | 14 |
Top pathogenic / likely-pathogenic (8)
| Variant ID | HGVS | Classification |
|---|---|---|
| 1192284 | NM_001080516.2(GRXCR2):c.323C>T (p.Ala108Val) | Pathogenic |
| 133347 | NM_001080516.2(GRXCR2):c.714dup (p.Gly239fs) | Pathogenic |
| 1943443 | NM_001080516.2(GRXCR2):c.463G>T (p.Glu155Ter) | Pathogenic |
| 2124823 | NM_001080516.2(GRXCR2):c.100C>T (p.Gln34Ter) | Pathogenic |
| 3246459 | NC_000005.9:g.(?145239296)(145252531_?)del | Pathogenic |
| 4682638 | GRCh37/hg19 5q32(chr5:144614507-145878493)x1 | Pathogenic |
| 3601167 | NM_001080516.2(GRXCR2):c.247C>T (p.Gln83Ter) | Likely pathogenic |
| 4277768 | NM_001080516.2(GRXCR2):c.397C>T (p.Arg133Ter) | Likely pathogenic |
SpliceAI
471 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 5:145872629:CAA:C | donor_loss | 0.9900 |
| 5:145872630:AACCT:A | donor_loss | 0.9900 |
| 5:145872632:C:CA | donor_loss | 0.9900 |
| 5:145936692:AAGG:A | donor_loss | 0.9900 |
| 5:145936693:AGG:A | donor_loss | 0.9900 |
| 5:145936694:GGTT:G | donor_loss | 0.9900 |
| 5:145936695:G:T | donor_loss | 0.9900 |
| 5:145872829:T:TA | donor_gain | 0.9800 |
| 5:145859917:T:A | acceptor_loss | 0.9700 |
| 5:145861720:T:TA | donor_gain | 0.9700 |
| 5:145872880:CG:C | donor_gain | 0.9700 |
| 5:145870955:TAGC:T | donor_gain | 0.9600 |
| 5:145872629:CAACC:C | donor_gain | 0.9600 |
| 5:145936695:G:GG | donor_gain | 0.9600 |
| 5:145859911:CCTTC:C | acceptor_gain | 0.9500 |
| 5:145859912:CTTC:C | acceptor_gain | 0.9500 |
| 5:145859912:CTTCC:C | acceptor_gain | 0.9500 |
| 5:145859913:TTCCT:T | acceptor_gain | 0.9500 |
| 5:145866659:T:TC | acceptor_gain | 0.9500 |
| 5:145866657:C:CT | acceptor_gain | 0.9400 |
| 5:145866724:AGGGG:A | acceptor_gain | 0.9400 |
| 5:145872917:T:A | donor_gain | 0.9400 |
| 5:145859916:C:CC | acceptor_gain | 0.9300 |
| 5:145866576:G:C | donor_gain | 0.9300 |
| 5:145866729:C:CC | acceptor_gain | 0.9200 |
| 5:145936693:AG:A | donor_gain | 0.9200 |
| 5:145936694:GG:G | donor_gain | 0.9200 |
| 5:145859913:TTC:T | acceptor_gain | 0.9100 |
| 5:145936613:G:GT | donor_gain | 0.9100 |
| 5:145866725:GGGG:G | acceptor_gain | 0.9000 |
AlphaMissense
1649 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 5:145859786:A:G | C232R | 1.000 |
| 5:145859848:C:G | C211S | 1.000 |
| 5:145859849:A:G | C211R | 1.000 |
| 5:145859849:A:T | C211S | 1.000 |
| 5:145872907:A:G | F21S | 1.000 |
| 5:145859775:G:C | C235W | 0.999 |
| 5:145859776:C:G | C235S | 0.999 |
| 5:145859776:C:T | C235Y | 0.999 |
| 5:145859777:A:G | C235R | 0.999 |
| 5:145859777:A:T | C235S | 0.999 |
| 5:145859785:C:G | C232S | 0.999 |
| 5:145859786:A:T | C232S | 0.999 |
| 5:145859811:A:C | F223L | 0.999 |
| 5:145859811:A:T | F223L | 0.999 |
| 5:145859813:A:G | F223L | 0.999 |
| 5:145859847:G:C | C211W | 0.999 |
| 5:145859848:C:T | C211Y | 0.999 |
| 5:145859856:G:C | C208W | 0.999 |
| 5:145859857:C:G | C208S | 0.999 |
| 5:145859858:A:G | C208R | 0.999 |
| 5:145859858:A:T | C208S | 0.999 |
| 5:145866679:A:G | L129P | 0.999 |
| 5:145872906:A:C | F21L | 0.999 |
| 5:145872906:A:T | F21L | 0.999 |
| 5:145872908:A:G | F21L | 0.999 |
| 5:145859753:A:G | C243R | 0.998 |
| 5:145859776:C:A | C235F | 0.998 |
| 5:145859784:G:C | C232W | 0.998 |
| 5:145859785:C:T | C232Y | 0.998 |
| 5:145859812:A:G | F223S | 0.998 |
dbSNP variants (sampled 300 via entrez): RS1000021931 (5:145929341 T>C), RS1000023388 (5:145883036 G>A,C,T), RS1000072265 (5:145922381 C>T), RS1000089936 (5:145929909 T>A), RS1000143645 (5:145920970 C>A,T), RS1000211750 (5:145905495 A>G), RS1000237753 (5:145888491 A>G), RS1000411616 (5:145883447 A>G), RS1000425129 (5:145922682 A>G,T), RS1000452143 (5:145871400 C>T), RS1000459895 (5:145893331 G>A,C), RS1000531111 (5:145929593 GTTTTACCAATTACTTGGA>G,GTTTTACCAATTACTTGGATTTTACCAATTACTTGGA), RS1000588057 (5:145878275 T>C), RS1000604770 (5:145906744 G>A), RS1000636021 (5:145924908 G>A)
Disease associations
OMIM: gene MIM:615762 | disease phenotypes: MIM:220290, MIM:607197, MIM:615837
GenCC curated gene-disease
| Disease | Classification | Inheritance |
|---|---|---|
| autosomal recessive nonsyndromic hearing loss 101 | Strong | Autosomal recessive |
| nonsyndromic genetic hearing loss | Moderate | Autosomal recessive |
| hearing loss, autosomal recessive | Supportive | Autosomal recessive |
ClinGen Gene-Disease Validity (1)
Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.
| Disease | Classification | Inheritance |
|---|---|---|
| nonsyndromic genetic hearing loss | Moderate | AR |
Mondo (3): hearing loss, autosomal recessive (MONDO:0019588), autosomal recessive nonsyndromic hearing loss 101 (MONDO:0014363), nonsyndromic genetic hearing loss (MONDO:0019497)
Orphanet (2): Rare autosomal dominant non-syndromic sensorineural deafness type DFNA (Orphanet:90635), Rare autosomal recessive non-syndromic sensorineural deafness type DFNB (Orphanet:90636)
HPO phenotypes
5 total (5 of 5 shown, HPO-id order):
| HPO | Term |
|---|---|
| HP:0000007 | Autosomal recessive inheritance |
| HP:0000505 | Visual impairment |
| HP:0001751 | Abnormal vestibular function |
| HP:0008619 | Bilateral sensorineural hearing impairment |
| HP:0011463 | Childhood onset |
GWAS associations
1 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST009173_1 | Response to (pegylated) interferon in HBeAG-positive hepatitis B | 3.000000e-06 |
EFO canonical traits (1, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0007859 | response to interferon |
MeSH disease descriptors (2)
| Descriptor | Name | Tree numbers |
|---|---|---|
| C564609 | Deafness, Autosomal Recessive (supp.) | |
| C580334 | Nonsyndromic Deafness (supp.) |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
1 total (human), top 1 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| Benzo(a)pyrene | increases methylation | 1 |
Clinical trials (associated diseases)
1 trials via MONDO — disease-level, not drug-specific.
| Trial | Phase | Status | Title |
|---|---|---|---|
| NCT01802190 | Not specified | TERMINATED | Prevalence of POU4F3 and SLC17A8 Mutations |
Related Atlas pages
- Associated diseases: nonsyndromic genetic hearing loss, autosomal recessive nonsyndromic hearing loss 101, hearing loss, autosomal recessive
- Disease cohort memberships (association, not causation — diseases whose associated-gene cohort lists this gene; a subset are also under Associated diseases): autosomal recessive nonsyndromic hearing loss 101, hearing loss, autosomal recessive, nonsyndromic genetic hearing loss