H2AX

Summary

H2AX (H2A.X variant histone, HGNC:4739) is a protein-coding gene on chromosome 11q23.3, encoding Histone H2AX (P16104). Variant histone H2A which replaces conventional H2A in a subset of nucleosomes. It is a selective cancer dependency (DepMap: 66.7% of cell lines).

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

Source: NCBI Gene 3014 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Cancer dependency (DepMap): dependent in 66.7% of screened cell lines
• MANE Select transcript: NM_002105

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4739
Approved symbol	H2AX
Name	H2A.X variant histone
Location	11q23.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000188486
Ensembl biotype	protein_coding
OMIM	601772
Entrez	3014

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 1 nonsense_mediated_decay, 1 protein_coding

ENST00000375167, ENST00000530167

RefSeq mRNA: 1 — MANE Select: NM_002105 NM_002105

CCDS: CCDS8410

Canonical transcript exons

ENST00000530167 — 1 exons

Exon	Start	End
ENSE00002184393	119093874	119095465

Expression profiles

Bgee: expression breadth ubiquitous, 278 present calls, max score 98.91.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 322.6103 / max 5232.4750, expressed in 1821 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
122688	322.6103	1821

Top tissues by expression

287 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	98.91	gold quality
endometrium epithelium	UBERON:0004811	98.57	gold quality
embryo	UBERON:0000922	98.11	gold quality
ganglionic eminence	UBERON:0004023	97.70	gold quality
mucosa of transverse colon	UBERON:0004991	94.76	gold quality
oocyte	CL:0000023	94.23	gold quality
inferior vagus X ganglion	UBERON:0005363	93.71	gold quality
thymus	UBERON:0002370	93.16	gold quality
trabecular bone tissue	UBERON:0002483	92.70	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	92.25	gold quality
subthalamic nucleus	UBERON:0001906	92.24	gold quality
spinal cord	UBERON:0002240	92.10	gold quality
lower esophagus mucosa	UBERON:0035834	91.89	gold quality
pharyngeal mucosa	UBERON:0000355	91.63	gold quality
ventral tegmental area	UBERON:0002691	91.52	gold quality
granulocyte	CL:0000094	91.38	gold quality
olfactory bulb	UBERON:0002264	91.00	gold quality
ileal mucosa	UBERON:0000331	90.94	gold quality
pons	UBERON:0000988	90.73	gold quality
bone marrow cell	CL:0002092	90.55	gold quality
medulla oblongata	UBERON:0001896	90.50	gold quality
dorsal plus ventral thalamus	UBERON:0001897	90.37	gold quality
superior vestibular nucleus	UBERON:0007227	90.31	gold quality
CA1 field of hippocampus	UBERON:0003881	90.21	gold quality
amygdala	UBERON:0001876	89.93	gold quality
bone marrow	UBERON:0002371	89.90	gold quality
esophagus mucosa	UBERON:0002469	89.84	gold quality
postcentral gyrus	UBERON:0002581	89.82	gold quality
parietal lobe	UBERON:0001872	89.64	gold quality
Brodmann (1909) area 9	UBERON:0013540	89.60	gold quality

Single-cell (SCXA)

Detected in 12 experiment(s), a significant marker in 10.

Experiment	Marker?	Max mean expression
E-MTAB-8894	yes	907.81
E-CURD-79	yes	502.78
E-HCAD-10	yes	26.46
E-HCAD-13	yes	21.38
E-HCAD-5	yes	19.94
E-GEOD-125970	yes	17.01
E-ANND-3	yes	9.35
E-MTAB-6678	yes	8.59
E-MTAB-10553	yes	8.20
E-CURD-88	yes	5.97
E-CURD-84	no	603.88
E-MTAB-7037	no	161.08

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F1, GLI1, GLI2, KDM4C, LEF1, TBP

miRNA regulators (miRDB)

39 targeting H2AX, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-145-5P	99.92	71.13	1836
HSA-MIR-5195-3P	99.92	70.92	1877
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-130B-5P	99.83	68.50	1888
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-24-3P	99.59	69.97	1934
HSA-MIR-4786-3P	99.36	68.35	1390
HSA-MIR-7515	99.31	68.22	1795
HSA-MIR-133A-5P	99.28	69.13	941
HSA-MIR-3196	98.96	63.91	326
HSA-MIR-455-3P	98.94	67.68	878
HSA-MIR-501-5P	98.77	68.88	1328
HSA-MIR-3180	98.46	64.68	348
HSA-MIR-3180-3P	98.46	64.68	348
HSA-MIR-6816-5P	98.46	64.35	364
HSA-MIR-138-5P	98.43	70.49	1292
HSA-MIR-6787-3P	97.75	66.17	1233
HSA-MIR-938	97.41	68.28	656
HSA-MIR-663B	97.40	62.91	664
HSA-MIR-2467-5P	97.36	67.71	991
HSA-MIR-6131	97.22	66.72	960
HSA-MIR-6736-3P	96.98	65.22	1342
HSA-MIR-10400-5P	96.91	66.00	56
HSA-MIR-4467	96.51	64.44	69
HSA-MIR-6858-3P	96.37	64.41	771

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 66.7% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 40)

• The site of very early phosphorylation of H2A.X (obtained from human skin fibroblast cells)in response to low-dose radiation was identified by mass spectrometry. (PMID:12033261)
• During the end-joining reaction H2AX is phosphorylated at Ser-139 as detected by immunoblot with specific antibodies and phosphorylation is inhibited by wortmannin, in vitro the DNA end-joining reaction appears to be independent of H2AX phosphorylation. (PMID:12220643)
• H2AX has low diffusional mobility in the nucleus (PMID:12372432)
• H2AX is involved in a pathway with NFBD1, 53BP1, and Chk2 in recruitment of repair and signaling proteins to sites of DNA damage (PMID:12551934)
• phosphorylation of and activation of Mre11, Rad50, and Nbs1 in response to replication-dependent DNA double-strand breaks induced by mammalian DNA topoisomerase I cleavage complexes (PMID:12660252)
• Sex chromosomes of histone H2AX-deficient spermatocytes don’t form a sex body or initiate MSCI, and show defects in meiotic pairing. H2AX is required for the chromatin remodeling and associated silencing in male meiosis. (PMID:12689589)
• Migration of repair and signalling proteins to double-stranded breaks is not abrogated in H2AX(-/-) cells, or in those that have been reconstituted with H2AX mutants that eliminate phosphorylation. (PMID:12792649)
• Fibroblasts from patients with Huntington disease and spinocerebellar ataxia-2 showed significant phosphorylation. (PMID:12915485)
• a role in repairing DNA double-stranded breaks in human cells (PMID:12926989)
• DNA-PK can be activated by nucleosomes through the ability of Ku to bind to the ends of nucleosomal DNA, and that the activated DNA-PK is capable of phosphorylating H2AX within the nucleosomes (PMID:14627815)
• MDC1 couples DNA ds-break recognition by NBS1 with its H2AFX-dependent chromatin retention. (PMID:15201865)
• chromatin restructuring mediated by H2AX phosphorylation concentrates DNA repair/signaling factors and tethers DNA ends together [review] (PMID:15279782)
• DNA-PK, ATM and possibly other kinases implicated in H2AX phosphorylation. (PMID:15389585)
• we show a requirement for Rad17 and Hus1 to induce G(2) arrest as well as Vpr-induced phosphorylation of histone 2A variant X (H2AX) and formation of nuclear foci containing H2AX and breast cancer susceptibility protein 1 (PMID:15485898)
• ATM, Artemis, and proteins locating to gamma-H2AX foci have roles in double-strand break rejoining (PMID:15574327)
• Histone gamma-H2AX promotes binding of nuclear DNA helicase II to transcriptionally stalled sites on chromosomal DNA. (PMID:15613478)
• data are consistent with the notion that H2AX phosphorylation observed throughout S phase reflects formation of double-strand breaks due to the collision of replication forks with the UV-induced primary DNA lesions (PMID:15655354)
• In this communication, we present the first evidence that heat shock induces the phosphorylated form of histone H2AX, which is thought to be generated at the chromatin proximal to DSB sites (PMID:15707990)
• Werner syndrome protein co-localizes and associates with gamma H2AX (PMID:15733840)
• untreated melanoma cells express significantly greater numbers of gammaH2AX foci than do untreated melanocytes (PMID:15816840)
• Phosphorylated H2AX is a sensitive assay for the presence of double strand breaks. (PMID:15905198)
• DNA-PK activity is required for the increased expression of H2AX in iradiated cells under hypertonic conditions. (PMID:16046194)
• Even in the absence of DNA damage, phosphorylation of H2AX in normal cell cycle progression may contribute to maintenance of genomic integrity. (PMID:16153602)
• these data implicate BRCA1 and the H2AX kinase in replication of facultative heterochromatin on the inactive X chromosome (PMID:16240122)
• H2AX is not a target gene for 11q23 deletions in MCL (PMID:16382446)
• Frequency of activated ATM and phosphorylated H2AX molecules, per apoptotic cell, is comparable. (PMID:16426422)
• phosphorylated histone H2AX foci persist if DNA breaks are rejoined (PMID:16494514)
• increased histone H2AX phosphorylation also occurred outside of double-strand break sites after exposure to ionizing radiation (PMID:16494516)
• 2-deoxy-D-glucose reduces the level of constitutive activation of ATM and phosphorylation of histone H2AX (PMID:16628006)
• XPF is required to form gamma-H2AX and likely double strand breaks in response to interstrand crosslinks in human cells (PMID:16678501)
• H2AX phosphorylation in G(1) cells depends on nucleotide excision repair factors that may expose the S-139 site to kinase activity, is not due to DNA double-strand breaks, and plays a larger role in UV-induced signal transduction than previously realized. (PMID:16788066)
• H2AX phosphorylation on Ser-139 in cells untreated by genotoxic agents is cell-cycle phase specific and attenuated by scavenging reactive oxygen species (PMID:16820894)
• The higher level of constitutive H2AX phosphorylation in cells harbouring wt tumour protein p53 may thus indicate that tumour protein p53 plays a role in facilitating histone H2AX phosphorylation. (PMID:16872365)
• A model is proposed for non-targeted (bystander) signaling leading to gamma H2AX foci induction in irradiated primary astrocytes and glioma cells. (PMID:16909103)
• These results demonstrate that neither RPA hyper-phosphorylation nor H2AX are required for the formation in RPA intra-nuclear foci in response to DNA damage/replicational stress. (PMID:16927366)
• We determined independently that those siblings with mean numbers of foci per cell in the range of ATM heterozygotes carried the mutant allele, while both siblings with a normal number of foci per cell after irradiation had normal alleles. (PMID:16953663)
• H2AX phosphorylation and two other collaborating proteins, Rad50 and 53BP1, were generated in spermatozoa after H(2)O(2) exposure; oxidative stress can induce H2AX phosphorylation in human spermatozoa through double strand break induction (PMID:17064697)
• induction of oxidative stress in human peripheral blood leukocytes by phorbol myristate acetate (PMA) was associated with intense phosphorylation of histone H2AX (PMID:17106266)
• data support a model in which the size and distribution of H2AX clusters define the boundaries of gamma-H2AX spreading and also may provide a platform for the immediate and robust response observed after DNA damage (PMID:17110439)
• Genotoxic responses to ultraviolet radiation, like increase in the phosphorylation of histone H2AX, induction of p53 protein and binding of this protein to its DNA consensus sequence, were all decreased on the restrictive substrate. (PMID:17203247)

Cross-species orthologs

20 orthologs

Organism	Symbol	Gene ID
danio_rerio	h2ax1	ENSDARG00000068995
mus_musculus	H2ax	ENSMUSG00000049932
rattus_norvegicus	H2ax	ENSRNOG00000074924
caenorhabditis_elegans		WBGENE00001877
caenorhabditis_elegans		WBGENE00001881
caenorhabditis_elegans		WBGENE00001886
caenorhabditis_elegans		WBGENE00001890
caenorhabditis_elegans		WBGENE00001893
caenorhabditis_elegans		WBGENE00001895
caenorhabditis_elegans		WBGENE00001904
caenorhabditis_elegans		WBGENE00001907
caenorhabditis_elegans		WBGENE00001909
caenorhabditis_elegans		WBGENE00001917
caenorhabditis_elegans		WBGENE00001921
caenorhabditis_elegans		WBGENE00001925
caenorhabditis_elegans		WBGENE00001927
caenorhabditis_elegans		WBGENE00001931
caenorhabditis_elegans		WBGENE00001935
caenorhabditis_elegans		WBGENE00001939
caenorhabditis_elegans	his-68	WBGENE00001942

Paralogs (27): MACROH2A2 (ENSG00000099284), H2AZ2 (ENSG00000105968), MACROH2A1 (ENSG00000113648), H2AZ1 (ENSG00000164032), H2AC1 (ENSG00000164508), H2AC6 (ENSG00000180573), H2AC25 (ENSG00000181218), H2AC20 (ENSG00000184260), H2AC21 (ENSG00000184270), H2AC13 (ENSG00000196747), H2AC11 (ENSG00000196787), H2AC7 (ENSG00000196866), H2AL3 (ENSG00000229674), H2AJ (ENSG00000246705), H2AL1Q (ENSG00000249467), H2AB1 (ENSG00000274183), H2AC12 (ENSG00000274997), H2AC15 (ENSG00000275221), H2AC14 (ENSG00000276368), H2AC16 (ENSG00000276903), H2AC8 (ENSG00000277075), H2AB3 (ENSG00000277745), H2AB2 (ENSG00000277858), H2AC4 (ENSG00000278463), H2AC17 (ENSG00000278677), H2AC18 (ENSG00000288825), H2AC19 (ENSG00000288859)

Protein

Protein identifiers

Histone H2AX — P16104 (reviewed: P16104)

Alternative names: Histone H2A.X

All UniProt accessions (1): P16104

UniProt curated annotations — full annotation on UniProt →

Function. Variant histone H2A which replaces conventional H2A in a subset of nucleosomes. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Required for checkpoint-mediated arrest of cell cycle progression in response to low doses of ionizing radiation and for efficient repair of DNA double strand breaks (DSBs) specifically when modified by C-terminal phosphorylation.

Subunit / interactions. The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. Interacts with numerous proteins required for DNA damage signaling and repair when phosphorylated on Ser-140. These include MDC1, TP53BP1, BRCA1 and the MRN complex, composed of MRE11, RAD50, and NBN. Interaction with the MRN complex is mediated at least in part by NBN. Also interacts with DHX9/NDHII when phosphorylated on Ser-140 and MCPH1 when phosphorylated at Ser-140 or Tyr-143. Interacts with ARRB2; the interaction is detected in the nucleus upon OR1D2 stimulation. Interacts with WRAP53/TCAB1. Interacts with HDGFL2. Interacts with DNA damage up-regulated protein DDUP. Forms a complex with DDUP and RAD18 following DDUP phosphorylation. (Microbial infection) Interacts with Epstein-Barr virus protein EBNA6.

Subcellular location. Nucleus. Chromosome.

Post-translational modifications. Phosphorylated by VRK1. Phosphorylated on Ser-140 (to form gamma-H2AX or H2AX139ph) in response to DNA double strand breaks (DSBs) generated by exogenous genotoxic agents and by stalled replication forks, and may also occur during meiotic recombination events and immunoglobulin class switching in lymphocytes. Phosphorylation can extend up to several thousand nucleosomes from the actual site of the DSB and may mark the surrounding chromatin for recruitment of proteins required for DNA damage signaling and repair. Widespread phosphorylation may also serve to amplify the damage signal or aid repair of persistent lesions. Phosphorylation of Ser-140 (H2AX139ph) in response to ionizing radiation is mediated by both ATM and PRKDC while defects in DNA replication induce Ser-140 phosphorylation (H2AX139ph) subsequent to activation of ATR and PRKDC. Dephosphorylation of Ser-140 by PP2A is required for DNA DSB repair. In meiosis, Ser-140 phosphorylation (H2AX139ph) may occur at synaptonemal complexes during leptotene as an ATM-dependent response to the formation of programmed DSBs by SPO11. Ser-140 phosphorylation (H2AX139ph) may subsequently occurs at unsynapsed regions of both autosomes and the XY bivalent during zygotene, downstream of ATR and BRCA1 activation. Ser-140 phosphorylation (H2AX139ph) may also be required for transcriptional repression of unsynapsed chromatin and meiotic sex chromosome inactivation (MSCI), whereby the X and Y chromosomes condense in pachytene to form the heterochromatic XY-body. During immunoglobulin class switch recombination in lymphocytes, Ser-140 phosphorylation (H2AX139ph) may occur at sites of DNA-recombination subsequent to activation of the activation-induced cytidine deaminase AICDA. Phosphorylation at Tyr-143 (H2AXY142ph) by BAZ1B/WSTF determines the relative recruitment of either DNA repair or pro-apoptotic factors. Phosphorylation at Tyr-143 (H2AXY142ph) favors the recruitment of APBB1/FE65 and pro-apoptosis factors such as MAPK8/JNK1, triggering apoptosis. In contrast, dephosphorylation of Tyr-143 by EYA proteins (EYA1, EYA2, EYA3 or EYA4) favors the recruitment of MDC1-containing DNA repair complexes to the tail of phosphorylated Ser-140 (H2AX139ph). Monoubiquitination of Lys-120 (H2AXK119ub) by RING1 and RNF2/RING2 complex gives a specific tag for epigenetic transcriptional repression. Following DNA double-strand breaks (DSBs), it is ubiquitinated through ‘Lys-63’ linkage of ubiquitin moieties by the E2 ligase UBE2N and the E3 ligases RNF8 and RNF168, leading to the recruitment of repair proteins to sites of DNA damage. Ubiquitination at Lys-14 and Lys-16 (H2AK13Ub and H2AK15Ub, respectively) in response to DNA damage is initiated by RNF168 that mediates monoubiquitination at these 2 sites, and ‘Lys-63’-linked ubiquitin are then conjugated to monoubiquitin; RNF8 is able to extend ‘Lys-63’-linked ubiquitin chains in vitro. H2AK119Ub and ionizing radiation-induced ‘Lys-63’-linked ubiquitination (H2AK13Ub and H2AK15Ub) are distinct events. Acetylation at Lys-6 (H2AXK5ac) by KAT5 component of the NuA4 histone acetyltransferase complex promotes NBN/NBS1 assembly at the sites of DNA damage. Acetylation at Lys-37 increases in S and G2 phases. This modification has been proposed to play a role in DNA double-strand break repair.

Domain organisation. The [ST]-Q motif constitutes a recognition sequence for kinases from the PI3/PI4-kinase family.

Similarity. Belongs to the histone H2A family.

RefSeq proteins (1): NP_002096* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002119	Histone_H2A	Family
IPR007125	H2A/H2B/H3	Domain
IPR009072	Histone-fold	Homologous_superfamily
IPR032454	Histone_H2A_C	Domain
IPR032458	Histone_H2A_CS	Conserved_site

Pfam: PF00125, PF16211

UniProt features (36 total): modified residue 9, helix 6, cross-link 5, mutagenesis site 4, strand 4, region of interest 2, initiator methionine 1, chain 1, sequence conflict 1, turn 1, short sequence motif 1, compositionally biased region 1

Structure

Experimental structures (PDB)

28 structures.

PDB	Method	Resolution (Å)
3U3Z	X-RAY DIFFRACTION	1.5
6ZWK	X-RAY DIFFRACTION	1.55
1YDP	X-RAY DIFFRACTION	1.9
3SHV	X-RAY DIFFRACTION	2.1
3SQD	X-RAY DIFFRACTION	2.15
6K1K	X-RAY DIFFRACTION	2.2
2AZM	X-RAY DIFFRACTION	2.41
2DYP	X-RAY DIFFRACTION	2.5
3SZM	X-RAY DIFFRACTION	2.63
6K1I	X-RAY DIFFRACTION	2.75
6K1J	X-RAY DIFFRACTION	2.85
9Q8X	ELECTRON MICROSCOPY	2.94
9MLR	ELECTRON MICROSCOPY	3.1
2D31	X-RAY DIFFRACTION	3.2
9MMK	ELECTRON MICROSCOPY	3.2
9MLN	ELECTRON MICROSCOPY	3.3
7YQK	ELECTRON MICROSCOPY	3.38
9Q80	ELECTRON MICROSCOPY	3.39
9MMT	ELECTRON MICROSCOPY	3.4
9MLS	ELECTRON MICROSCOPY	3.6
9MMN	ELECTRON MICROSCOPY	3.6
9MLL	ELECTRON MICROSCOPY	3.7
9MMO	ELECTRON MICROSCOPY	3.9
9MMM	ELECTRON MICROSCOPY	4
9QCR	ELECTRON MICROSCOPY	4.37
9QCS	ELECTRON MICROSCOPY	4.38
9Q9F	ELECTRON MICROSCOPY	4.54
9QMS	ELECTRON MICROSCOPY	5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P16104-F1	87.22	0.74

Antibody-complex structures (SAbDab): 1 — 6ZWK

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (14): 10, 37, 122, 140, 143, 14, 16, 120, 128, 135, 2, 2, 6, 10

Mutagenesis-validated functional residues (4):

Position	Phenotype
6	decreased acetylation and reduced h2axk119ub ubiquitination.
140	impaired phosphorylation without affecting h2axk5ac acetylation.
141	reduced phosphorylation of s-140 in response to dna damage.
143	displays a reduced apoptotic response. s-140 phosphorylation is reduced.

Function

Pathways and Gene Ontology

Reactome pathways

52 pathways

ID	Pathway
R-HSA-110328	Recognition and association of DNA glycosylase with site containing an affected pyrimidine
R-HSA-110329	Cleavage of the damaged pyrimidine
R-HSA-110330	Recognition and association of DNA glycosylase with site containing an affected purine
R-HSA-110331	Cleavage of the damaged purine
R-HSA-1221632	Meiotic synapsis
R-HSA-171306	Packaging Of Telomere Ends
R-HSA-1912408	Pre-NOTCH Transcription and Translation
R-HSA-201722	Formation of the beta-catenin:TCF transactivating complex
R-HSA-212300	PRC2 methylates histones and DNA
R-HSA-2299718	Condensation of Prophase Chromosomes
R-HSA-2559580	Oxidative Stress Induced Senescence
R-HSA-2559582	Senescence-Associated Secretory Phenotype (SASP)
R-HSA-2559586	DNA Damage/Telomere Stress Induced Senescence
R-HSA-3214858	RMTs methylate histone arginines
R-HSA-427359	SIRT1 negatively regulates rRNA expression
R-HSA-427389	ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression
R-HSA-427413	NoRC negatively regulates rRNA expression
R-HSA-5250924	B-WICH complex positively regulates rRNA expression
R-HSA-5334118	DNA methylation
R-HSA-5578749	Transcriptional regulation by small RNAs
R-HSA-5617472	Activation of anterior HOX genes in hindbrain development during early embryogenesis
R-HSA-5625886	Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
R-HSA-5693565	Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks
R-HSA-5693571	Nonhomologous End-Joining (NHEJ)
R-HSA-5693607	Processing of DNA double-strand break ends
R-HSA-606279	Deposition of new CENPA-containing nucleosomes at the centromere
R-HSA-68616	Assembly of the ORC complex at the origin of replication
R-HSA-69473	G2/M DNA damage checkpoint
R-HSA-73728	RNA Polymerase I Promoter Opening
R-HSA-73772	RNA Polymerase I Promoter Escape

MSigDB gene sets: 540 (showing top): PID_FANCONI_PATHWAY, REACTOME_MEIOTIC_RECOMBINATION, REACTOME_DNA_REPLICATION, REACTOME_SIGNALING_BY_NOTCH, MODULE_52, GOBP_RESPONSE_TO_IONIZING_RADIATION, HORIUCHI_WTAP_TARGETS_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GNF2_CENPF, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, REACTOME_MEIOTIC_SYNAPSIS, PAL_PRMT5_TARGETS_UP, BROWNE_HCMV_INFECTION_8HR_UP, CROONQUIST_NRAS_SIGNALING_DN, REACTOME_G2_M_DNA_DAMAGE_CHECKPOINT

GO Biological Process (15): DNA damage checkpoint signaling (GO:0000077), double-strand break repair via homologous recombination (GO:0000724), double-strand break repair (GO:0006302), nucleosome assembly (GO:0006334), DNA damage response (GO:0006974), spermatogenesis (GO:0007283), response to ionizing radiation (GO:0010212), heterochromatin formation (GO:0031507), positive regulation of DNA repair (GO:0045739), meiotic cell cycle (GO:0051321), protein localization to site of double-strand break (GO:1990166), DNA repair (GO:0006281), DNA recombination (GO:0006310), protein K63-linked ubiquitination (GO:0070534), positive regulation of double-strand break repair via homologous recombination (GO:1905168)

GO Molecular Function (8): DNA binding (GO:0003677), damaged DNA binding (GO:0003684), enzyme binding (GO:0019899), structural constituent of chromatin (GO:0030527), histone binding (GO:0042393), protein heterodimerization activity (GO:0046982), chromatin-protein adaptor activity (GO:0140463), protein binding (GO:0005515)

GO Cellular Component (15): nucleosome (GO:0000786), condensed nuclear chromosome (GO:0000794), male germ cell nucleus (GO:0001673), XY body (GO:0001741), nucleus (GO:0005634), nucleoplasm (GO:0005654), replication fork (GO:0005657), centrosome (GO:0005813), nuclear speck (GO:0016607), site of double-strand break (GO:0035861), extracellular exosome (GO:0070062), site of DNA damage (GO:0090734), chromosome, telomeric region (GO:0000781), chromatin (GO:0000785), chromosome (GO:0005694)

Reactome top-level categories

Rollup of top-13 pathways:

Category	Pathways
Cellular Senescence	3
Depyrimidination	2
Depurination	2
Epigenetic regulation of gene expression	2
Negative epigenetic regulation of rRNA expression	2
Positive epigenetic regulation of rRNA expression	2
Meiosis	1
Telomere Maintenance	1
Pre-NOTCH Expression and Processing	1
TCF dependent signaling in response to WNT	1
Mitotic Prophase	1
Chromatin modifying enzymes	1
Gene Silencing by RNA	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
chromosome	3
DNA repair	2
chromatin organization	2
DNA metabolic process	2
protein binding	2
chromatin	2
DNA integrity checkpoint signaling	1
signal transduction in response to DNA damage	1
recombinational repair	1
double-strand break repair	1
nucleosome organization	1
protein-DNA complex assembly	1
cellular response to stress	1
developmental process involved in reproduction	1
male gamete generation	1
response to radiation	1
cellular component assembly	1
heterochromatin boundary formation	1
negative regulation of gene expression, epigenetic	1
heterochromatin organization	1
regulation of DNA repair	1
positive regulation of response to stimulus	1
positive regulation of DNA metabolic process	1
cell cycle	1
sexual reproduction	1
reproductive process	1
meiotic nuclear division	1
protein localization to chromosome	1
DNA damage response	1
protein polyubiquitination	1
double-strand break repair via homologous recombination	1
regulation of double-strand break repair via homologous recombination	1
positive regulation of DNA recombination	1
positive regulation of double-strand break repair	1
nucleic acid binding	1
DNA binding	1
structural molecule activity	1
protein dimerization activity	1
chromatin binding	1

Protein interactions and networks

STRING

3880 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
H2AX	MDC1	Q14676	998
H2AX	TP53BP1	Q12888	997
H2AX	H2BC21	Q16778	986
H2AX	ATM	Q13315	984
H2AX	BRCA1	P38398	983
H2AX	CCNB1	P14635	950
H2AX	BCLAF1	Q9NYF8	923
H2AX	RAD51	Q06609	921
H2AX	CHEK2	O96017	911
H2AX	BRCA2	P51587	900
H2AX	RNF8	O76064	898
H2AX	UIMC1	Q96RL1	884
H2AX	XRCC6	P12956	883
H2AX	CHEK1	O14757	880
H2AX	XRCC5	P13010	862

IntAct

323 interactions, top by confidence:

A	B	Type	Score
MDC1	H2AX	psi-mi:“MI:0403”(colocalization)	0.970
H2AX	MDC1	psi-mi:“MI:0915”(physical association)	0.970
MDC1	H2AX	psi-mi:“MI:0407”(direct interaction)	0.970
MDC1	H2AX	psi-mi:“MI:0915”(physical association)	0.970
NBN	H2AX	psi-mi:“MI:0403”(colocalization)	0.860
NBN	H2AX	psi-mi:“MI:0915”(physical association)	0.860
H2AX	NBN	psi-mi:“MI:0915”(physical association)	0.860
H4C16	H2AX	psi-mi:“MI:0915”(physical association)	0.850
PARP1	H2AX	psi-mi:“MI:0403”(colocalization)	0.840
H2AX	PARP1	psi-mi:“MI:0914”(association)	0.840
H2AX	MRE11	psi-mi:“MI:0914”(association)	0.810
MRE11	H2AX	psi-mi:“MI:0403”(colocalization)	0.810
MRE11	H2AX	psi-mi:“MI:0915”(physical association)	0.810
TP53BP1	H2AX	psi-mi:“MI:0403”(colocalization)	0.790

BioGRID (1043): UBC (Affinity Capture-Western), H2AFX (Biochemical Activity), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-Western), H2AFX (Affinity Capture-Western), H2AFX (Co-fractionation), H2AFX (Affinity Capture-MS), H2AFX (Affinity Capture-MS)

ESM2 similar proteins: A1C5F1, A1D0C1, A2R702, A3GHC1, A4QVR2, A5DQL2, A5DXC6, O81826, P02263, P08985, P08992, P0C0S8, P0CC09, P0CO00, P0CO01, P16104, P16865, P16866, P25470, P27661, P35063, P40282, P48003, P50567, Q09FM9, Q0C919, Q0UG93, Q12692, Q1DTG2, Q27511, Q2GUP0, Q2UJ80, Q43213, Q4IMD1, Q4WE68, Q5AEE1, Q5AUJ1, Q6BQE9, Q6C341, Q6CUC8

Diamond homologs: A0A097I2B5, A1A4R1, A2WQG7, A2XLI0, A2YMC5, A2YMC6, A2YVE5, A2ZK29, A9UMV8, C0HKE1, C0HKE2, C0HKE3, C0HKE4, C0HKE5, C0HKE6, C0HKE7, C0HKE8, C0HKE9, L7HZV6, O04848, O74268, O81826, P02262, P02263, P02264, P02269, P02275, P04735, P04908, P06897, P07793, P09588, P0C0S8, P0C0S9, P0C169, P0C170, P0CC09, P0CN98, P0CN99, P0CT12

SIGNOR signaling

26 interactions.

A	Effect	B	Mechanism
H2AX	up-regulates	NBN	binding
H2AX	up-regulates	MDC1	binding
RNF8	up-regulates	H2AX	ubiquitination
UBE2N	up-regulates	H2AX	ubiquitination
ATM	up-regulates	H2AX	phosphorylation
MAPK9	up-regulates	H2AX	phosphorylation
PPM1D	down-regulates	H2AX	dephosphorylation
EYA1	down-regulates	H2AX	dephosphorylation
EYA3	down-regulates	H2AX	dephosphorylation
BAZ1B	up-regulates	H2AX	phosphorylation
MAPK8	up-regulates	H2AX	phosphorylation
PRKDC	up-regulates	H2AX	phosphorylation
RNF168	unknown	H2AX	ubiquitination
KDM4C	“down-regulates quantity by repression”	H2AX	“transcriptional regulation”
SLBP	“up-regulates quantity by expression”	H2AX	“translation regulation”
NatA	“down-regulates activity”	H2AX	acetylation
DZIP3	“up-regulates activity”	H2AX	monoubiquitination
VRK1	“up-regulates activity”	H2AX	phosphorylation
STK4	“up-regulates activity”	H2AX	phosphorylation
BMI1	“up-regulates activity”	H2AX	ubiquitination
RPS6KA3	“up-regulates activity”	H2AX	phosphorylation
ATR	“up-regulates activity”	H2AX	phosphorylation
PLK3	“up-regulates activity”	H2AX	phosphorylation
“BRCA1-BARD1 complex”	“up-regulates activity”	H2AX	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 155 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
DNA Double Strand Break Response	9	40.0×	4e-11
Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks	23	31.5×	3e-26
Nonhomologous End-Joining (NHEJ)	18	28.2×	1e-19
Diseases of DNA repair	5	26.7×	1e-05
Packaging Of Telomere Ends	11	22.6×	1e-10
G2/M DNA damage checkpoint	20	22.5×	1e-19
Processing of DNA double-strand break ends	21	22.4×	1e-20
DNA Damage/Telomere Stress Induced Senescence	14	21.4×	3e-13

GO biological processes:

GO term	Partners	Fold	FDR
mitotic G2/M transition checkpoint	6	35.1×	3e-06
response to ionizing radiation	9	27.0×	2e-08
positive regulation of DNA repair	8	20.9×	1e-06
double-strand break repair	12	17.8×	4e-09
mitotic G2 DNA damage checkpoint signaling	5	16.2×	1e-03
double-strand break repair via nonhomologous end joining	5	15.4×	1e-03
telomere maintenance	7	13.7×	1e-04
nucleosome assembly	8	8.2×	6e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

130 predictions. Top by Δscore:

Variant	Effect	Δscore
11:119094456:TCACC:T	donor_loss	0.9900
11:119094457:CACCT:C	donor_loss	0.9900
11:119094458:A:AC	donor_gain	0.9800
11:119094459:C:CC	donor_gain	0.9800
11:119094971:C:CA	donor_gain	0.9600
11:119094459:CCTT:C	donor_gain	0.9400
11:119094996:G:A	donor_gain	0.9300
11:119094968:ACT:A	donor_gain	0.9100
11:119094969:CTC:C	donor_gain	0.9100
11:119094258:AGACC:A	acceptor_loss	0.9000
11:119094260:ACC:A	acceptor_loss	0.9000
11:119094263:T:G	acceptor_loss	0.8900
11:119094852:G:A	donor_gain	0.8900
11:119094459:CCT:C	donor_gain	0.8700
11:119094490:TGCC:T	donor_gain	0.8700
11:119094458:AC:A	donor_gain	0.8500
11:119094459:CC:C	donor_gain	0.8500
11:119095078:C:CA	donor_gain	0.8500
11:119094881:T:A	donor_gain	0.8200
11:119094970:T:TA	donor_gain	0.8200
11:119094458:ACCTT:A	donor_gain	0.8000
11:119094459:CCTTC:C	donor_gain	0.8000
11:119094530:T:TA	donor_gain	0.8000
11:119094262:C:CC	acceptor_gain	0.7800
11:119094268:A:AC	acceptor_gain	0.7600
11:119094455:CTCA:C	donor_gain	0.7600
11:119094257:CAGAC:C	acceptor_gain	0.7500
11:119094454:A:AC	donor_gain	0.7500
11:119094455:C:CC	donor_gain	0.7500
11:119094457:CA:C	donor_gain	0.7500

AlphaMissense

885 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:119095075:C:T	G107D	1.000
11:119095076:C:G	G107R	1.000
11:119095122:G:C	D91E	1.000
11:119095122:G:T	D91E	1.000
11:119095123:T:A	D91V	1.000
11:119095123:T:C	D91G	1.000
11:119095123:T:G	D91A	1.000
11:119095124:C:G	D91H	1.000
11:119095129:C:G	R89P	1.000
11:119095138:A:G	L86P	1.000
11:119095159:A:T	I79N	1.000
11:119095177:T:A	D73V	1.000
11:119095183:G:T	A71D	1.000
11:119095192:C:A	G68V	1.000
11:119095192:C:T	G68D	1.000
11:119095193:C:G	G68R	1.000
11:119095198:A:G	L66P	1.000
11:119095202:C:T	E65K	1.000
11:119095204:A:G	L64P	1.000
11:119095210:T:A	E62V	1.000
11:119095219:A:G	L59P	1.000
11:119095223:A:G	Y58H	1.000
11:119095225:T:A	E57V	1.000
11:119095324:A:T	L24H	1.000
11:119095060:A:G	I112T	0.999
11:119095060:A:T	I112N	0.999
11:119095066:G:T	P110H	0.999
11:119095075:C:A	G107V	0.999
11:119095076:C:A	G107C	0.999
11:119095078:C:A	G106V	0.999

dbSNP variants (sampled 300 via entrez): RS1000700484 (11:119095205 G>A,T), RS1000809642 (11:119095563 T>C), RS1001541110 (11:119095607 C>T), RS1001596868 (11:119095883 C>T), RS1001996468 (11:119094079 CG>C), RS1004877876 (11:119095460 A>C,G), RS1005001625 (11:119095039 T>C), RS1008153715 (11:119094156 C>G), RS1008640104 (11:119093599 C>T), RS1009294998 (11:119094815 CGAGGGGAGGG>C,CGAGGG,CGAGGGGAGGGGAGGG,CGAGGGGAGGGGAGGGGAGGG), RS1010947065 (11:119096168 G>T), RS1010978045 (11:119095950 TTTC>T), RS1013147344 (11:119096490 A>G), RS1013981300 (11:119094157 C>G), RS1014365858 (11:119094451 C>G)

Disease associations

OMIM: gene MIM:601772 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST90002391_245	Mean corpuscular hemoglobin concentration	1.000000e-09

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004528	mean corpuscular hemoglobin concentration

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

540 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Acetylcysteine	affects reaction, increases abundance, decreases reaction, increases phosphorylation, increases expression (+2 more)	28
Cisplatin	decreases reaction, increases phosphorylation, increases reaction, increases expression, increases ubiquitination (+4 more)	27
Benzo(a)pyrene	decreases reaction, increases abundance, affects cotreatment, increases methylation, increases expression (+3 more)	21
sodium arsenite	affects reaction, increases expression, increases reaction, increases phosphorylation, decreases expression	18
Doxorubicin	increases reaction, affects cotreatment, decreases reaction, increases phosphorylation, affects reaction (+7 more)	17
Aflatoxin B1	affects reaction, increases metabolic processing, increases reaction, increases expression, affects cotreatment (+4 more)	13
hydroquinone	affects response to substance, decreases expression, affects localization, affects reaction, decreases reaction (+5 more)	12
Resveratrol	decreases expression, increases activity, decreases reaction, affects cotreatment, increases expression (+3 more)	11
Camptothecin	increases response to substance, increases expression, affects localization, increases activity, increases reaction (+5 more)	10
Etoposide	increases reaction, decreases reaction, increases phosphorylation, increases expression	10
Hydrogen Peroxide	decreases reaction, increases expression, increases phosphorylation, affects expression, affects response to substance (+2 more)	10
bisphenol A	increases phosphorylation, affects expression, decreases phosphorylation, increases reaction, decreases expression (+2 more)	9
2-morpholin-4-yl-6-thianthren-1-yl-pyran-4-one	affects cotreatment, decreases reaction, increases expression, increases phosphorylation, increases activity (+2 more)	9
Arsenic Trioxide	affects cotreatment, increases phosphorylation, decreases reaction, increases expression	7
Arsenic	affects expression, affects reaction, increases expression, decreases reaction, affects response to substance (+3 more)	6
Caffeine	increases reaction, decreases reaction, increases phosphorylation, increases expression	6
Estradiol	increases phosphorylation, increases reaction, increases expression, decreases reaction	6
Hydroxyurea	increases reaction, increases phosphorylation, increases expression	6
Mitomycin	increases expression, increases phosphorylation	6
Particulate Matter	increases abundance, increases expression, increases phosphorylation, increases response to substance	6
veliparib	increases expression, increases reaction, affects cotreatment, decreases reaction	5
Fluorouracil	affects reaction, decreases expression, affects cotreatment, decreases reaction, increases phosphorylation (+3 more)	5
Tobacco Smoke Pollution	affects expression, increases expression	5
Cadmium Chloride	increases abundance, increases expression, affects localization, increases phosphorylation, decreases reaction	5
4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone	decreases reaction, increases expression, increases phosphorylation, affects cotreatment, increases reaction	4
nickel chloride	affects reaction, increases abundance, increases expression, decreases expression, decreases reaction (+2 more)	4
pifithrin	increases reaction, decreases phosphorylation, decreases reaction, increases phosphorylation, increases expression	4
N-(oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide hydrochloride	decreases reaction, decreases response to substance, increases expression, increases phosphorylation	4
ON 01910	increases phosphorylation, increases reaction, increases expression	4
2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide	decreases reaction, increases expression, increases abundance, decreases expression	4

Cellosaurus cell lines

5 cell lines: 3 embryonic stem cell, 1 spontaneously immortalized cell line, 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A2J9	SEES3-1V human H2AFX, clone1	Embryonic stem cell	Male
CVCL_A2K0	SEES3-1V human H2AFX, clone2	Embryonic stem cell	Male
CVCL_A2K1	SEES3-1V human H2AFX, clone3	Embryonic stem cell	Male
CVCL_RR10	MCF10A H2AFX (-/-)	Spontaneously immortalized cell line	Female
CVCL_SQ75	HAP1 H2AFX (-)	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.