H3-3B

Summary

H3-3B (H3.3 histone B, HGNC:4765) is a protein-coding gene on chromosome 17q25.1, encoding Histone H3.3 (P84243). Variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. It is a selective cancer dependency (DepMap: 16.6% of cell lines).

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded by this gene is a replication-independent histone that is a member of the histone H3 family. Pseudogenes of this gene have been identified on the X chromosome, and on chromosomes 5, 13 and 17.

Source: NCBI Gene 3021 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Bryant-Li-Bhoj neurodevelopmental syndrome 2 (Strong, GenCC)
• GWAS associations: 2
• Clinical variants (ClinVar): 51 total — 4 pathogenic, 12 likely-pathogenic
• Phenotypes (HPO): 41
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 16.6% of screened cell lines
• MANE Select transcript: NM_005324

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4765
Approved symbol	H3-3B
Name	H3.3 histone B
Location	17q25.1
Locus type	gene with protein product
Status	Approved
Aliases	H3.3B
Ensembl gene	ENSG00000132475
Ensembl biotype	protein_coding
OMIM	601058
Entrez	3021

Gene structure

Transcript identifiers

Ensembl transcripts: 24 — 19 protein_coding, 4 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000254810, ENST00000586270, ENST00000586518, ENST00000586607, ENST00000587171, ENST00000587560, ENST00000589417, ENST00000589599, ENST00000589949, ENST00000591890, ENST00000591893, ENST00000592643, ENST00000593254, ENST00000852230, ENST00000852231, ENST00000852232, ENST00000852233, ENST00000917670, ENST00000917671, ENST00000917672, ENST00000917673, ENST00000948409, ENST00000948410, ENST00000948411

RefSeq mRNA: 1 — MANE Select: NM_005324 NM_005324

CCDS: CCDS11729

Canonical transcript exons

ENST00000254810 — 4 exons

Exon	Start	End
ENSE00000905164	75779047	75779184
ENSE00001361414	75776434	75778723
ENSE00001361571	75779657	75779779
ENSE00002381554	75778810	75778963

Expression profiles

Bgee: expression breadth ubiquitous, 308 present calls, max score 99.99.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 357.7698 / max 4544.1315, expressed in 1828 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
168096	357.3396	1828
168095	0.4227	227
168098	0.0076	3

Top tissues by expression

308 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
oocyte	CL:0000023	99.99	gold quality
secondary oocyte	CL:0000655	99.99	gold quality
trigeminal ganglion	UBERON:0001675	99.92	gold quality
mammary duct	UBERON:0001765	99.91	gold quality
caput epididymis	UBERON:0004358	99.90	gold quality
adult organism	UBERON:0007023	99.89	gold quality
epithelium of mammary gland	UBERON:0003244	99.88	gold quality
cauda epididymis	UBERON:0004360	99.88	gold quality
lower lobe of lung	UBERON:0008949	99.88	gold quality
male germ cell	CL:0000015	99.86	gold quality
sperm	CL:0000019	99.86	gold quality
pericardium	UBERON:0002407	99.86	gold quality
corpus epididymis	UBERON:0004359	99.86	gold quality
left testis	UBERON:0004533	99.86	gold quality
right testis	UBERON:0004534	99.86	gold quality
pharyngeal mucosa	UBERON:0000355	99.85	gold quality
olfactory bulb	UBERON:0002264	99.85	gold quality
vena cava	UBERON:0004087	99.85	gold quality
urethra	UBERON:0000057	99.82	gold quality
nipple	UBERON:0002030	99.82	gold quality
vein	UBERON:0001638	99.81	gold quality
synovial joint	UBERON:0002217	99.81	gold quality
amniotic fluid	UBERON:0000173	99.80	gold quality
penis	UBERON:0000989	99.80	gold quality
skin of hip	UBERON:0001554	99.80	gold quality
saphenous vein	UBERON:0007318	99.80	gold quality
dorsal root ganglion	UBERON:0000044	99.79	gold quality
blood	UBERON:0000178	99.79	gold quality
testis	UBERON:0000473	99.79	gold quality
pons	UBERON:0000988	99.78	gold quality

Single-cell (SCXA)

Detected in 39 experiment(s), a significant marker in 13.

Experiment	Marker?	Max mean expression
E-MTAB-10042	yes	2672.39
E-HCAD-4	yes	132.76
E-HCAD-1	yes	56.39
E-CURD-122	yes	44.41
E-CURD-88	yes	39.67
E-CURD-46	yes	37.54
E-MTAB-9221	yes	31.88
E-GEOD-134144	yes	31.29
E-MTAB-8410	yes	28.07
E-HCAD-9	yes	25.22
E-GEOD-130148	yes	13.43
E-MTAB-9067	yes	13.36
E-HCAD-25	yes	6.31
E-MTAB-8498	no	11437.48
E-MTAB-10485	no	10047.97

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

1 targets.

Target	Regulation
GLI1	Activation

Upstream regulators (CollecTRI, top): DDIT3

miRNA regulators (miRDB)

117 targeting H3-3B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-499A-5P	99.98	70.79	1323
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-22-3P	99.93	68.13	917
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 16.6% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 13)

• DAXX functions as a bona fide histone chaperone involved in the replication-independent deposition of H3.3 (PMID:20504901)
• A remarkable picture of tumor type specificity for histone H3.3 driver alterations emerges, indicating that histone H3.3 residues, mutations and genes have distinct functions. (PMID:24162739)
• H3F3A and H3F3B mutation analysis appears to be a highly specific, although less sensitive, diagnostic tool for the distinction of GCTB and chondroblastoma from other giant cell-containing tumors. (PMID:26457357)
• It has been suggested that H3.3K36M mutant proteins alter epigenomes of specific progenitor cells, which in turn lead to cellular transformation and tumorigenesis. (PMID:28129023)
• Report H3F3A/B mutations in cell tumors of bone, chondroblastomas, and aneurysmal bone cysts. (PMID:28882701)
• evidence that a SNP in the gene H3F3B is associated with a broad schizophrenia spectrum phenotype and also alters the function of a miRNA target site within the 3’ UTR of the gene. (PMID:29529098)
• SNPs in SLC22A3 and H3F3B may influence lipid levels through altering the expression of local genes. SNPs in H3F3B may influence CAD risk through altering the expression of local genes. (PMID:29894858)
• The interaction of histone modification related H3F3B and NSD2 genes increases the susceptibility to schizophrenia in a Chinese population. (PMID:32169559)
• The histone variant H3.3 regulates the transcription of the hepatitis B virus. (PMID:33007428)
• Histone H3.3 G34 mutations promote aberrant PRC2 activity and drive tumor progression. (PMID:33067396)
• Histone H3.3 beyond cancer: Germline mutations in Histone 3 Family 3A and 3B cause a previously unidentified neurodegenerative disorder in 46 patients. (PMID:33268356)
• Gene of the month: H3F3A and H3F3B. (PMID:34782425)
• Pediatric glioma histone H3.3 K27M/G34R mutations drive abnormalities in PML nuclear bodies. (PMID:38066546)

Cross-species orthologs

1 orthologs

Organism	Symbol	Gene ID
caenorhabditis_elegans		WBGENE00001945

Paralogs (20): CENPA (ENSG00000115163), H3-3A (ENSG00000163041), H3-4 (ENSG00000168148), H3C13 (ENSG00000183598), H3-5 (ENSG00000188375), H3C12 (ENSG00000197153), H3C4 (ENSG00000197409), H3C14 (ENSG00000203811), H3C15 (ENSG00000203852), H3Y2 (ENSG00000268799), H3Y1 (ENSG00000269466), H3-7 (ENSG00000273213), H3C8 (ENSG00000273983), H3C6 (ENSG00000274750), H3C11 (ENSG00000275379), H3C1 (ENSG00000275714), H3C7 (ENSG00000277775), H3C10 (ENSG00000278828), H3C2 (ENSG00000286522), H3C3 (ENSG00000287080)

Protein

Protein identifiers

Histone H3.3 — P84243 (reviewed: P84243)

All UniProt accessions (6): P84243, B2R4P9, K7EK07, K7EMV3, K7EP01, K7ES00

UniProt curated annotations — full annotation on UniProt →

Function. Variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. Constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis. Deposited at sites of nucleosomal displacement throughout transcribed genes, suggesting that it represents an epigenetic imprint of transcriptionally active chromatin. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Subunit / interactions. The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. Interacts with HIRA, a chaperone required for its incorporation into nucleosomes. Interacts with ZMYND11; when trimethylated at ‘Lys-36’ (H3.3K36me3). Found in a co-chaperone complex with DNJC9, MCM2 and histone H3.3-H4 dimers. Within the complex, interacts with DNJC9 (via C-terminus); the interaction is direct. Interacts with ASF1A, MCM2, NASP and SPT2. Interacts with DAXX; the interaction is direct. Interacts with NASP; NASP is a histone chaperone that stabilizes and maintains a soluble pool of Histone H3-H4 dimers.

Subcellular location. Nucleus. Chromosome.

Post-translational modifications. Acetylation is generally linked to gene activation. Acetylation on Lys-10 (H3K9ac) impairs methylation at Arg-9 (H3R8me2s). Acetylation on Lys-19 (H3K18ac) and Lys-24 (H3K24ac) favors methylation at Arg-18 (H3R17me). Acetylation at Lys-123 (H3K122ac) by EP300/p300 plays a central role in chromatin structure: localizes at the surface of the histone octamer and stimulates transcription, possibly by promoting nucleosome instability. Citrullination at Arg-9 (H3R8ci) and/or Arg-18 (H3R17ci) by PADI4 impairs methylation and represses transcription. Asymmetric dimethylation at Arg-18 (H3R17me2a) by CARM1 is linked to gene activation. Symmetric dimethylation at Arg-9 (H3R8me2s) by PRMT5 is linked to gene repression. Asymmetric dimethylation at Arg-3 (H3R2me2a) by PRMT6 is linked to gene repression and is mutually exclusive with H3 Lys-5 methylation (H3K4me2 and H3K4me3). H3R2me2a is present at the 3’ of genes regardless of their transcription state and is enriched on inactive promoters, while it is absent on active promoters. Specifically enriched in modifications associated with active chromatin such as methylation at Lys-5 (H3K4me), Lys-37 and Lys-80. Methylation at Lys-5 (H3K4me) facilitates subsequent acetylation of H3 and H4. Methylation at Lys-80 (H3K79me) is associated with DNA double-strand break (DSB) responses and is a specific target for TP53BP1. Methylation at Lys-10 (H3K9me) and Lys-28 (H3K27me), which are linked to gene repression, are underrepresented. Methylation at Lys-10 (H3K9me) is a specific target for HP1 proteins (CBX1, CBX3 and CBX5) and prevents subsequent phosphorylation at Ser-11 (H3S10ph) and acetylation of H3 and H4. Methylation at Lys-5 (H3K4me) and Lys-80 (H3K79me) require preliminary monoubiquitination of H2B at ‘Lys-120’. Methylation at Lys-10 (H3K9me) and Lys-28 (H3K27me) are enriched in inactive X chromosome chromatin. Monomethylation at Lys-57 (H3K56me1) by EHMT2/G9A in G1 phase promotes interaction with PCNA and is required for DNA replication. Phosphorylated at Thr-4 (H3T3ph) by VRK1. Phosphorylated at Thr-4 (H3T3ph) by HASPIN during prophase and dephosphorylated during anaphase. Phosphorylation at Ser-11 (H3S10ph) by AURKB is crucial for chromosome condensation and cell-cycle progression during mitosis and meiosis. In addition phosphorylation at Ser-11 (H3S10ph) by RPS6KA4 and RPS6KA5 is important during interphase because it enables the transcription of genes following external stimulation, like mitogens, stress, growth factors or UV irradiation and result in the activation of genes, such as c-fos and c-jun. Phosphorylation at Ser-11 (H3S10ph), which is linked to gene activation, prevents methylation at Lys-10 (H3K9me) but facilitates acetylation of H3 and H4. Phosphorylation at Ser-11 (H3S10ph) by AURKB mediates the dissociation of HP1 proteins (CBX1, CBX3 and CBX5) from heterochromatin. Phosphorylation at Ser-11 (H3S10ph) is also an essential regulatory mechanism for neoplastic cell transformation. Phosphorylated at Ser-29 (H3S28ph) by MAP3K20 isoform 1, RPS6KA5 or AURKB during mitosis or upon ultraviolet B irradiation. Phosphorylation at Thr-7 (H3T6ph) by PRKCB is a specific tag for epigenetic transcriptional activation that prevents demethylation of Lys-5 (H3K4me) by LSD1/KDM1A. At centromeres, specifically phosphorylated at Thr-12 (H3T11ph) from prophase to early anaphase, by DAPK3 and PKN1. Phosphorylation at Thr-12 (H3T11ph) by PKN1 or isoform M2 of PKM (PKM2) is a specific tag for epigenetic transcriptional activation that promotes demethylation of Lys-10 (H3K9me) by KDM4C/JMJD2C. Phosphorylation at Tyr-42 (H3Y41ph) by JAK2 promotes exclusion of CBX5 (HP1 alpha) from chromatin. Phosphorylation on Ser-32 (H3S31ph) is specific to regions bordering centromeres in metaphase chromosomes. Monoubiquitinated at Lys-15 (H3K14ub), Lys-19 (H3K18ub) and Lys-24 (H3K23ub) by UHRF1 and HLTF at hemimethylated DNA sites following DNA replication, promoting recruitment of DNMT1 DNA methyltransferase and replication-coupled DNA methylation maintenance. Monoubiquitinated by RAG1 in lymphoid cells, monoubiquitination is required for V(D)J recombination. Ubiquitinated by the CUL4-DDB-RBX1 complex in response to ultraviolet irradiation. This may weaken the interaction between histones and DNA and facilitate DNA accessibility to repair proteins. Lysine deamination at Lys-5 (H3K4all) to form allysine is mediated by LOXL2. Allysine formation by LOXL2 only takes place on H3K4me3 and results in gene repression. Crotonylation (Kcr) is specifically present in male germ cells and marks testis-specific genes in post-meiotic cells, including X-linked genes that escape sex chromosome inactivation in haploid cells. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. It is also associated with post-meiotically activated genes on autosomes. Butyrylation of histones marks active promoters and competes with histone acetylation. It is present during late spermatogenesis. Succinylation at Lys-80 (H3K79succ) by KAT2A takes place with a maximum frequency around the transcription start sites of genes. It gives a specific tag for epigenetic transcription activation. Desuccinylation at Lys-123 (H3K122succ) by SIRT7 in response to DNA damage promotes chromatin condensation and double-strand breaks (DSBs) repair. Serine ADP-ribosylation by PARP1 or PARP2 constitutes the primary form of ADP-ribosylation of proteins in response to DNA damage. Serine ADP-ribosylation at Ser-11 (H3S10ADPr) promotes recruitment of CHD1L. H3S10ADPr is mutually exclusive with phosphorylation at Ser-11 (H3S10ph) and impairs acetylation at Lys-10 (H3K9ac). Serotonylated by TGM2 at Gln-6 (H3Q5ser) during serotonergic neuron differentiation. H3Q5ser is associated with trimethylation of Lys-5 (H3K4me3) and enhances general transcription factor IID (TFIID) complex-binding to H3K4me3, thereby facilitating transcription. Dopaminylated by TGM2 at Gln-6 (H3Q5dop) in ventral tegmental area (VTA) neurons. H3Q5dop mediates neurotransmission-independent role of nuclear dopamine by regulating relapse-related transcriptional plasticity in the reward system. Lactylated in macrophages by EP300/P300 by using lactoyl-CoA directly derived from endogenous or exogenous lactate, leading to stimulates gene transcription.

Disease relevance. Glioma (GLM) [MIM:137800] Gliomas are benign or malignant central nervous system neoplasms derived from glial cells. They comprise astrocytomas and glioblastoma multiforme that are derived from astrocytes, oligodendrogliomas derived from oligodendrocytes and ependymomas derived from ependymocytes. The gene represented in this entry is involved in disease pathogenesis. H3F3A mutations affecting residues involved in post-translational modifications of histone H3.3 are recurrent in malignant, aggressive gliomas including glioblastoma multiforme (GBM) and diffuse intrinsic pontine glioma (DIPG). The mechanism through which mutations lead to tumorigenesis involves altered histones methylation, impaired regulation of Polycomb repressive complex 2 (PRC2) activity, and aberrant epigenetic regulation of gene expression. Bryant-Li-Bhoj neurodevelopmental syndrome 1 (BRYLIB1) [MIM:619720] An autosomal dominant disorder predominantly characterized by global developmental delay, impaired intellectual development, poor or absent speech, and delayed motor milestones. Clinical manifestations are highly variable, including abnormal head shape, dysmorphic facial features, oculomotor abnormalities, feeding problems, and non-specific brain imaging abnormalities. Additional features may include hearing loss, seizures, short stature, and mild skeletal defects. The disease is caused by variants affecting the gene represented in this entry. BRYLIB1 is caused by variants in H3-3A. Bryant-Li-Bhoj neurodevelopmental syndrome 2 (BRYLIB2) [MIM:619721] An autosomal dominant disorder predominantly characterized by global developmental delay, impaired intellectual development, poor or absent speech, and delayed motor milestones. Clinical manifestations are highly variable, including abnormal head shape, dysmorphic facial features, oculomotor abnormalities, feeding problems, and non-specific brain imaging abnormalities. Additional features may include hearing loss, seizures, short stature, and mild skeletal defects. The disease is caused by variants affecting the gene represented in this entry. BRYLIB2 is caused by variants in H3-3B. H3F3A and H3F3B mutations affecting residues involved in post-translational modifications of histone H3.3 are implicated in the pathogenesis of some bone and cartilage neoplasms. Mutations have been found with high prevalence in chondroblastoma and giant cell tumors of bone, and with low frequency in osteosarcoma, conventional chondrosarcoma and clear cell chondrosarcoma. Chondroblastoma samples frequently carry a H3F3B mutation affecting residue Lys-37 (H3K36), although H3F3A is mutated in some cases. Most giant cell tumors of bone harbor H3F3A mutations affecting residue Gly-35 (H3G34).

Domain organisation. Specific interaction of trimethylated form at ‘Lys-36’ (H3.3K36me3) with ZMYND11 is mediated by the encapsulation of Ser-32 residue with a composite pocket formed by the tandem bromo-PWWP domains.

Similarity. Belongs to the histone H3 family.

RefSeq proteins (1): NP_005315* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000164	Histone_H3/CENP-A	Family
IPR007125	H2A/H2B/H3	Domain
IPR009072	Histone-fold	Homologous_superfamily

Pfam: PF00125

UniProt features (190 total): modified residue 121, sequence variant 44, strand 8, helix 5, cross-link 3, mutagenesis site 3, initiator methionine 1, chain 1, lipid moiety-binding region 1, sequence conflict 1, region of interest 1, site 1

Structure

Experimental structures (PDB)

103 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
3QL9	X-RAY DIFFRACTION	0.93
3ASL	X-RAY DIFFRACTION	1.41
4GNE	X-RAY DIFFRACTION	1.47
4L58	X-RAY DIFFRACTION	1.48
5JLB	X-RAY DIFFRACTION	1.5
4GNF	X-RAY DIFFRACTION	1.55
3QLA	X-RAY DIFFRACTION	1.6
3MUL	X-RAY DIFFRACTION	1.65
9G4A	X-RAY DIFFRACTION	1.65
4GNG	X-RAY DIFFRACTION	1.73
3MUK	X-RAY DIFFRACTION	1.75
4QQ4	X-RAY DIFFRACTION	1.75
1PDQ	X-RAY DIFFRACTION	1.76
4O62	X-RAY DIFFRACTION	1.78
6J9J	X-RAY DIFFRACTION	1.78
3JVK	X-RAY DIFFRACTION	1.8
7CIZ	X-RAY DIFFRACTION	1.8
4H9N	X-RAY DIFFRACTION	1.95
4H9Q	X-RAY DIFFRACTION	1.95
4N4I	X-RAY DIFFRACTION	2
5DX0	X-RAY DIFFRACTION	2.05
4H9O	X-RAY DIFFRACTION	2.05
5JJY	X-RAY DIFFRACTION	2.05
7W5M	X-RAY DIFFRACTION	2.15
5X7X	X-RAY DIFFRACTION	2.18
8RZU	X-RAY DIFFRACTION	2.19
4H9R	X-RAY DIFFRACTION	2.2
4H9P	X-RAY DIFFRACTION	2.2
6U04	X-RAY DIFFRACTION	2.2
7OKP	X-RAY DIFFRACTION	2.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P84243-F1	86.79	0.71

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 32 (interaction with zmynd11)

Post-translational modifications (125): 5, 65, 80, 80, 80, 80, 80, 80, 80, 80, 80, 5, 80, 80, 81, 87, 108, 116, 116, 123 …

Mutagenesis-validated functional residues (3):

Position	Phenotype
6	abolished serotonylation by tgm2.
43	reduced binding of histone h1 to histone h3.3-containing nucleosomes.
106–107	loss of interaction with dnajc9, but not with other histone chaperones, such as asf1a, mccm2, nasp or spt2.

Function

Pathways and Gene Ontology

Reactome pathways

39 pathways

ID	Pathway
R-HSA-1912408	Pre-NOTCH Transcription and Translation
R-HSA-201722	Formation of the beta-catenin:TCF transactivating complex
R-HSA-212300	PRC2 methylates histones and DNA
R-HSA-2299718	Condensation of Prophase Chromosomes
R-HSA-2559580	Oxidative Stress Induced Senescence
R-HSA-2559582	Senescence-Associated Secretory Phenotype (SASP)
R-HSA-427359	SIRT1 negatively regulates rRNA expression
R-HSA-427389	ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression
R-HSA-427413	NoRC negatively regulates rRNA expression
R-HSA-5250924	B-WICH complex positively regulates rRNA expression
R-HSA-5334118	DNA methylation
R-HSA-5578749	Transcriptional regulation by small RNAs
R-HSA-5617472	Activation of anterior HOX genes in hindbrain development during early embryogenesis
R-HSA-5625886	Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
R-HSA-68616	Assembly of the ORC complex at the origin of replication
R-HSA-73728	RNA Polymerase I Promoter Opening
R-HSA-73772	RNA Polymerase I Promoter Escape
R-HSA-8936459	RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function
R-HSA-8939236	RUNX1 regulates transcription of genes involved in differentiation of HSCs
R-HSA-9018519	Estrogen-dependent gene expression
R-HSA-912446	Meiotic recombination
R-HSA-9616222	Transcriptional regulation of granulopoiesis
R-HSA-9670095	Inhibition of DNA recombination at telomere
R-HSA-9710421	Defective pyroptosis
R-HSA-9764725	Negative Regulation of CDH1 Gene Transcription
R-HSA-977225	Amyloid fiber formation
R-HSA-9821002	Chromatin modifications during the maternal to zygotic transition (MZT)
R-HSA-9821993	Replacement of protamines by nucleosomes in the male pronucleus
R-HSA-983231	Factors involved in megakaryocyte development and platelet production
R-HSA-9841922	MLL4 and MLL3 complexes regulate expression of PPARG target genes in adipogenesis and hepatic steatosis

MSigDB gene sets: 569 (showing top): GSE45365_NK_CELL_VS_CD8_TCELL_DN, REACTOME_MEIOTIC_RECOMBINATION, RNGTGGGC_UNKNOWN, GOBP_CHROMOSOME_ORGANIZATION, REACTOME_DNA_REPLICATION, REACTOME_SIGNALING_BY_NOTCH, GGTGTGT_MIR329, CCAWYNNGAAR_UNKNOWN, KANG_FLUOROURACIL_RESISTANCE_UP, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, NKX25_02, TTTGTAG_MIR520D, GOBP_CHROMOSOME_LOCALIZATION, GOBP_GROWTH, ACEVEDO_NORMAL_TISSUE_ADJACENT_TO_LIVER_TUMOR_DN

GO Biological Process (16): oocyte maturation (GO:0001556), osteoblast differentiation (GO:0001649), nucleosome assembly (GO:0006334), nucleus organization (GO:0006997), spermatid development (GO:0007286), single fertilization (GO:0007338), embryo implantation (GO:0007566), cell population proliferation (GO:0008283), male gonad development (GO:0008584), positive regulation of cell growth (GO:0030307), pericentric heterochromatin formation (GO:0031508), subtelomeric heterochromatin formation (GO:0031509), telomere organization (GO:0032200), multicellular organism growth (GO:0035264), muscle cell differentiation (GO:0042692), negative regulation of chromosome condensation (GO:1902340)

GO Molecular Function (7): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979), structural constituent of chromatin (GO:0030527), nucleosomal DNA binding (GO:0031492), protein heterodimerization activity (GO:0046982), DNA binding (GO:0003677), protein binding (GO:0005515)

GO Cellular Component (10): chromosome, telomeric region (GO:0000781), nucleosome (GO:0000786), inner kinetochore (GO:0000939), Barr body (GO:0001740), extracellular region (GO:0005576), nucleus (GO:0005634), nucleoplasm (GO:0005654), protein-containing complex (GO:0032991), extracellular exosome (GO:0070062), chromosome (GO:0005694)

Reactome top-level categories

Rollup of top-14 pathways:

Category	Pathways
Epigenetic regulation of gene expression	2
Cellular Senescence	2
Negative epigenetic regulation of rRNA expression	2
Positive epigenetic regulation of rRNA expression	2
RNA Polymerase I Promoter Clearance	2
Transcriptional regulation by RUNX1	2
Pre-NOTCH Expression and Processing	1
TCF dependent signaling in response to WNT	1
Mitotic Prophase	1
Gene Silencing by RNA	1
Activation of HOX genes during differentiation	1
RHO GTPases activate PKNs	1
Assembly of the pre-replicative complex	1
ESR-mediated signaling	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cell differentiation	2
constitutive heterochromatin formation	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
chromatin	2
cellular anatomical structure	2
developmental process involved in reproduction	1
cell maturation	1
oocyte development	1
ossification	1
chromatin organization	1
nucleosome organization	1
protein-DNA complex assembly	1
organelle organization	1
germ cell development	1
spermatid differentiation	1
fertilization	1
multicellular organism development	1
female pregnancy	1
reproductive process	1
cellular process	1
gonad development	1
development of primary male sexual characteristics	1
regulation of cell growth	1
cell growth	1
positive regulation of growth	1
positive regulation of cellular process	1
chromosome, telomeric region	1
chromosome organization	1
multicellular organismal process	1
developmental growth	1
muscle structure development	1
chromosome condensation	1
regulation of chromosome condensation	1
negative regulation of chromosome organization	1
cis-regulatory region sequence-specific DNA binding	1
core promoter sequence-specific DNA binding	1
structural molecule activity	1
chromatin DNA binding	1
nucleosome binding	1
protein dimerization activity	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

220 interactions, top by confidence:

A	B	Type	Score
ASF1A	H4C16	psi-mi:“MI:0914”(association)	0.950
IKI3	IKI1	psi-mi:“MI:0192”(acetylation reaction)	0.940
H3-3A	H4C16	psi-mi:“MI:0915”(physical association)	0.860
H3-3A	H4C16	psi-mi:“MI:0914”(association)	0.860
H3-3A	H4C16	psi-mi:“MI:0407”(direct interaction)	0.860
H3-3A	DAXX	psi-mi:“MI:0915”(physical association)	0.850
H3-3A	DAXX	psi-mi:“MI:0914”(association)	0.780
DAXX	H3-3A	psi-mi:“MI:0915”(physical association)	0.780
ASF1B	MCM2	psi-mi:“MI:0915”(physical association)	0.770
KIF3A	KIF3C	psi-mi:“MI:0914”(association)	0.730
H3-3A	ASF1B	psi-mi:“MI:0915”(physical association)	0.720
H3-3A	ASF1B	psi-mi:“MI:0914”(association)	0.720
Zmynd11	H3-3A	psi-mi:“MI:0407”(direct interaction)	0.690
Zmynd11	H3-3A	psi-mi:“MI:0915”(physical association)	0.690
H3-3A	Zmynd11	psi-mi:“MI:0915”(physical association)	0.690
CBX5	H3-3A	psi-mi:“MI:0407”(direct interaction)	0.670
H3-3A	MCM2	psi-mi:“MI:0915”(physical association)	0.660

BioGRID (1375): H3F3A (Affinity Capture-MS), H3F3B (Affinity Capture-MS), NASP (Two-hybrid), H3F3A (Affinity Capture-MS), H3F3A (Biochemical Activity), H3F3A (Reconstituted Complex), H3F3B (Reconstituted Complex), H3F3B (Affinity Capture-MS), H3F3B (Affinity Capture-MS), EHMT2 (Two-hybrid), H3F3A (Affinity Capture-MS), H3F3B (Affinity Capture-RNA), H3F3A (Affinity Capture-MS), H3F3A (Affinity Capture-MS), H3F3A (Affinity Capture-MS)

ESM2 similar proteins: A2Y533, C0HL66, C0HL67, P06352, P08437, P08903, P59226, P68427, P68428, P68429, P68430, P69071, P69072, P69073, P69074, P69075, P69076, P69077, P69078, P69079, P69246, P69248, P84231, P84243, P84244, P84245, P84246, P84247, P84248, P84250, Q10453, Q2RAD9, Q402E1, Q42681, Q4P7J7, Q5E9F8, Q5RCC9, Q6LBE3, Q6LBE8, Q6LCK1

Diamond homologs: A1CP80, A1D240, A2QRR5, A2Y533, A3GHN6, A3LXD5, A4RCX7, A5DFC5, A5DG57, A5DWE2, A5E094, C0HL66, C0HL67, P02299, P02301, P07041, P08903, P09988, P0CO04, P0CO05, P10651, P23753, P59226, P61830, P61831, P61832, P61833, P61834, P61835, P61836, P68427, P68428, P68429, P68430, P68431, P68432, P68433, P69071, P69072, P69073

SIGNOR signaling

69 interactions.

A	Effect	B	Mechanism
AURKB	“up-regulates activity”	H3-3A	phosphorylation
RPS6KA1	“down-regulates activity”	H3-3A	phosphorylation
RPS6KA3	“down-regulates activity”	H3-3A	phosphorylation
RPS6KA5	“down-regulates activity”	H3-3A	phosphorylation
FYN	“down-regulates activity”	H3-3A	phosphorylation
CHEK1	“down-regulates activity”	H3-3A	phosphorylation
UNII-XH2662798I	down-regulates	H3-3A
EP300	“down-regulates activity”	H3-3A	acetylation
RPS6KA5	“up-regulates activity”	H3-3A	phosphorylation
CBP/p300	“down-regulates activity”	H3-3A	acetylation
AKT	“down-regulates activity”	H3-3A	phosphorylation
RPS6K	“down-regulates activity”	H3-3A	phosphorylation
ERK1/2	“down-regulates activity”	H3-3A	phosphorylation
KDM4C	“down-regulates activity”	H3-3A	demethylation
H3-3A	“form complex”	“Nucleosome_H3.3 variant”	binding
SETDB2	“up-regulates activity”	H3-3A	methylation
KDM5A	“up-regulates activity”	H3-3A	demethylation
KDM5B	“up-regulates activity”	H3-3A	demethylation
P2RY2	“up-regulates activity”	H3-3A	demethylation
KDM5D	“up-regulates activity”	H3-3A	demethylation
“Set1-Ash2 HMT complex”	“down-regulates activity”	H3-3A	methylation
CBX5	“up-regulates activity”	H3-3A	binding
CBX1	“up-regulates activity”	H3-3A	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 139 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RUNX1 interacts with co-factors whose precise effect on RUNX1 targets is not known	5	16.0×	7e-04
SUMOylation of transcription cofactors	6	15.5×	2e-04
PTEN Regulation	6	14.6×	3e-04
DNA methylation	7	13.3×	2e-04
Regulation of PTEN gene transcription	7	13.3×	2e-04
Inhibition of DNA recombination at telomere	7	12.5×	2e-04
FXIIa activates plasma kallikrein-kinin system	6	11.0×	8e-04
Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3	6	10.7×	9e-04

GO biological processes:

GO term	Partners	Fold	FDR
negative regulation of gene expression via chromosomal CpG island methylation	5	43.5×	4e-05
nucleosome assembly	16	18.6×	4e-13
heterochromatin formation	7	14.8×	7e-05
cellular response to UV	5	12.2×	5e-03
chromatin organization	10	8.2×	7e-05
chromatin remodeling	12	7.2×	4e-05
DNA damage response	13	5.8×	7e-05
DNA repair	10	5.3×	2e-03

Disease & clinical

Cancer significance

Clinical variants and AI predictions

ClinVar

51 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	4
Likely pathogenic	12
Uncertain significance	13
Likely benign	1
Benign	2

Top pathogenic / likely-pathogenic (16)

Variant ID	HGVS	Classification
1339273	NM_005324.5(H3-3B):c.88G>C (p.Ala30Pro)	Pathogenic
1339274	NM_005324.5(H3-3B):c.365C>G (p.Pro122Arg)	Pathogenic
1696881	NM_005324.5(H3-3B):c.31T>C (p.Ser11Pro)	Pathogenic
4531680	NM_005324.5(H3-3B):c.29A>G (p.Lys10Arg)	Pathogenic
1183982	NM_005324.5(H3-3B):c.28A>G (p.Lys10Glu)	Likely pathogenic
1183983	NM_005324.5(H3-3B):c.68C>A (p.Thr23Lys)	Likely pathogenic
1183985	NM_005324.5(H3-3B):c.410_411del (p.Ter137CysextTer?)	Likely pathogenic
1682569	NM_005324.5(H3-3B):c.37G>A (p.Gly13Ser)	Likely pathogenic
1697246	NM_005324.5(H3-3B):c.68C>G (p.Thr23Arg)	Likely pathogenic
1708061	NM_005324.5(H3-3B):c.35C>T (p.Thr12Ile)	Likely pathogenic
2571003	NM_005324.5(H3-3B):c.98C>T (p.Thr33Ile)	Likely pathogenic
2573076	NM_005324.5(H3-3B):c.376C>A (p.Gln126Lys)	Likely pathogenic
3374710	NM_005324.5(H3-3B):c.11C>T (p.Thr4Ile)	Likely pathogenic
3376158	NM_005324.5(H3-3B):c.91C>T (p.Pro31Ser)	Likely pathogenic
4086480	NM_005324.5(H3-3B):c.68C>T (p.Thr23Met)	Likely pathogenic
4293548	NM_005324.5(H3-3B):c.365C>T (p.Pro122Leu)	Likely pathogenic

SpliceAI

673 predictions. Top by Δscore:

Variant	Effect	Δscore
17:75778719:GCCTC:G	acceptor_gain	1.0000
17:75778720:CCTCC:C	acceptor_gain	1.0000
17:75778721:CTC:C	acceptor_gain	1.0000
17:75778722:TC:T	acceptor_gain	1.0000
17:75778723:CC:C	acceptor_gain	1.0000
17:75778724:C:CC	acceptor_gain	1.0000
17:75778724:CT:C	acceptor_loss	1.0000
17:75778725:T:C	acceptor_loss	1.0000
17:75778805:CTTAC:C	donor_loss	1.0000
17:75778807:TACC:T	donor_loss	1.0000
17:75778808:A:AC	donor_gain	1.0000
17:75778808:A:AT	donor_loss	1.0000
17:75778809:C:CC	donor_gain	1.0000
17:75778809:CCTG:C	donor_gain	1.0000
17:75778959:CGGGC:C	acceptor_gain	1.0000
17:75778960:GGGC:G	acceptor_gain	1.0000
17:75778961:GGC:G	acceptor_gain	1.0000
17:75778962:GC:G	acceptor_gain	1.0000
17:75778963:CC:C	acceptor_gain	1.0000
17:75778964:C:CC	acceptor_gain	1.0000
17:75778965:T:C	acceptor_loss	1.0000
17:75778967:C:CT	acceptor_gain	1.0000
17:75778968:A:T	acceptor_gain	1.0000
17:75778970:C:CT	acceptor_gain	1.0000
17:75779042:CCTA:C	donor_loss	1.0000
17:75779043:CTAC:C	donor_loss	1.0000
17:75779044:TA:T	donor_loss	1.0000
17:75779045:A:AC	donor_gain	1.0000
17:75779045:A:T	donor_loss	1.0000
17:75779046:C:CA	donor_loss	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000160446 (17:75778942 T>C,G), RS1000377083 (17:75781318 G>A), RS1000757772 (17:75776676 T>A), RS1000847097 (17:75776828 TAATCTCATTCTGAAGCACAGTGAGGAATC>T), RS1002220375 (17:75776503 T>C), RS1002274019 (17:75776625 C>A), RS1002490299 (17:75780809 C>G), RS1002521363 (17:75781022 G>A,C), RS1002702243 (17:75777928 T>C,G), RS1003123791 (17:75778055 T>C), RS1003715931 (17:75777373 C>G,T), RS1004110816 (17:75777227 G>A,C), RS1004231996 (17:75779521 G>A), RS1004284442 (17:75779632 C>T), RS1004559742 (17:75779933 A>C,G,T)

Disease associations

OMIM: gene MIM:601058 | disease phenotypes: MIM:619721

GenCC curated gene-disease

Disease	Classification	Inheritance
Bryant-Li-Bhoj neurodevelopmental syndrome 2	Strong	Autosomal dominant

Mondo (4): intellectual disability (MONDO:0001071), Bryant-Li-Bhoj neurodevelopmental syndrome 2 (MONDO:0030607), neurodevelopmental disorder (MONDO:0700092), hemiparkinsonism-hemiatrophy syndrome (MONDO:0017636)

Orphanet (2): Hemiparkinsonism-hemiatrophy syndrome (Orphanet:306669), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

41 total (30 of 41 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000256	Macrocephaly
HP:0000268	Dolichocephaly
HP:0000303	Mandibular prognathia
HP:0000343	Long philtrum
HP:0000348	High forehead
HP:0000365	Hearing impairment
HP:0000964	Eczematoid dermatitis
HP:0001166	Arachnodactyly
HP:0001182	Tapered finger
HP:0001212	Prominent fingertip pads
HP:0001263	Global developmental delay
HP:0001357	Plagiocephaly
HP:0001382	Joint hypermobility
HP:0001508	Failure to thrive
HP:0001548	Overgrowth
HP:0001601	Laryngomalacia
HP:0001631	Atrial septal defect
HP:0001647	Bicuspid aortic valve
HP:0001761	Pes cavus
HP:0001763	Pes planus
HP:0001795	Hyperconvex nail
HP:0002007	Frontal bossing
HP:0002020	Gastroesophageal reflux
HP:0002650	Scoliosis
HP:0002857	Genu valgum
HP:0003593	Infantile onset
HP:0004209	Clinodactyly of the 5th finger

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST010204_183	Low density lipoprotein cholesterol levels	1.000000e-13
GCST010243_233	Apolipoprotein B levels	4.000000e-10

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004615	apolipoprotein B measurement

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5724667 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

51 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
trichostatin A	affects cotreatment, decreases expression	3
(+)-JQ1 compound	decreases expression, increases expression	2
Valproic Acid	affects expression, decreases expression, decreases methylation	2
dicrotophos	decreases expression	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	decreases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, decreases expression	1
methacrylaldehyde	affects cotreatment, increases oxidation, increases abundance	1
beta-methylcholine	affects expression	1
pinosylvin	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
ICG 001	decreases expression	1
abrine	decreases expression	1
ON 01910	increases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
jinfukang	decreases expression, affects cotreatment	1
PCI 5002	affects cotreatment, increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Acetaminophen	decreases expression	1
Acrolein	affects cotreatment, increases oxidation, increases abundance	1
Air Pollutants	increases abundance, increases oxidation, affects cotreatment	1
Arsenic	affects methylation	1
Cadmium	increases abundance, increases expression	1
Carbamazepine	affects expression	1
Cisplatin	decreases expression, affects cotreatment	1
Coumestrol	affects cotreatment, decreases expression	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Dietary Carbohydrates	decreases expression	1

ChEMBL screening assays

6 unique, capped per target: 6 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5697225	Binding	Inhibition of H3F3A (unknown origin) assessed as fold change at 10 uM incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	Inhibition of BET recruitment to chromatin as an effective treatment for MLL-fusion leukaemia. — Nature

Cellosaurus cell lines

3 cell lines: 2 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2YG	Abcam HEK293T H3-3B KO	Transformed cell line	Female
CVCL_SQ83	HAP1 H3F3B (-) 1	Cancer cell line	Male
CVCL_SQ84	HAP1 H3F3B (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

197 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients
NCT02513277	Not specified	COMPLETED	Diabetes Screening & Prevention for People With Learning (Intellectual) Disabilities:STOP Diabetes Study
NCT02561754	Not specified	COMPLETED	Weight Management for Adolescents With IDD
NCT02591446	Not specified	COMPLETED	Transcranial Magnetic Stimulation Studies in Autism Spectrum Disorders
NCT02714868	Not specified	COMPLETED	Evaluation of Project TEAM (Teens Making Environmental and Activity Modifications)
NCT02721394	Not specified	UNKNOWN	FCT With Young Children With ID in the UK: A Feasibility Project V.1
NCT02746614	Not specified	COMPLETED	Psychomotor Therapy Effects in Adaptive Behavior and Motor Proficiency in Intellectual Disability
NCT02836405	Not specified	COMPLETED	TMS for the Investigation of Brain Plasticity in Autism Spectrum Disorders