HBZ

Summary

HBZ (hemoglobin subunit zeta, HGNC:4835) is a protein-coding gene on chromosome 16p13.3, encoding Hemoglobin subunit zeta (P02008). The zeta chain is an alpha-type chain of mammalian embryonic hemoglobin.

Zeta-globin is an alpha-like hemoglobin. The zeta-globin polypeptide is synthesized in the yolk sac of the early embryo, while alpha-globin is produced throughout fetal and adult life. The zeta-globin gene is a member of the human alpha-globin gene cluster that includes five functional genes and two pseudogenes. The order of genes is: 5’ - zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 -alpha-1 - theta1 - 3'.

Source: NCBI Gene 3050 — RefSeq curated summary.

At a glance

• GWAS associations: 14
• Clinical variants (ClinVar): 18 total
• Druggable target: yes
• MANE Select transcript: NM_005332

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4835
Approved symbol	HBZ
Name	hemoglobin subunit zeta
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	HBZ1, HBZ-T1
Ensembl gene	ENSG00000130656
Ensembl biotype	protein_coding
OMIM	142310
Entrez	3050

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000252951, ENST00000652335

RefSeq mRNA: 1 — MANE Select: NM_005332 NM_005332

CCDS: CCDS10397

Canonical transcript exons

ENST00000252951 — 3 exons

Exon	Start	End
ENSE00001143658	154272	154503
ENSE00001143667	152644	153004
ENSE00003606697	153892	154096

Expression profiles

Bgee: expression breadth ubiquitous, 117 present calls, max score 87.10.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 4.9859 / max 713.1711, expressed in 97 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
151855	2.4859	79
151857	1.9685	76
151856	0.3055	62
151854	0.1999	48
151852	0.0131	3
151851	0.0129	4

Top tissues by expression

132 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.10	silver quality
left testis	UBERON:0004533	78.44	gold quality
right testis	UBERON:0004534	78.25	gold quality
testis	UBERON:0000473	77.59	gold quality
blood	UBERON:0000178	74.46	gold quality
ganglionic eminence	UBERON:0004023	65.31	gold quality
bone marrow	UBERON:0002371	63.60	gold quality
bone marrow cell	CL:0002092	59.32	silver quality
adrenal tissue	UBERON:0018303	58.23	gold quality
subcutaneous adipose tissue	UBERON:0002190	55.24	gold quality
anterior cingulate cortex	UBERON:0009835	54.73	gold quality
amygdala	UBERON:0001876	54.72	gold quality
temporal lobe	UBERON:0001871	54.71	gold quality
ectocervix	UBERON:0012249	54.14	gold quality
placenta	UBERON:0001987	53.76	gold quality
monocyte	CL:0000576	53.52	gold quality
nucleus accumbens	UBERON:0001882	53.28	gold quality
right frontal lobe	UBERON:0002810	53.09	gold quality
thoracic mammary gland	UBERON:0005200	52.53	gold quality
Ammon’s horn	UBERON:0001954	52.12	gold quality
leukocyte	CL:0000738	51.89	gold quality
cortical plate	UBERON:0005343	51.59	gold quality
cerebral cortex	UBERON:0000956	51.17	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	51.04	gold quality
skin of leg	UBERON:0001511	50.88	gold quality
primary visual cortex	UBERON:0002436	50.83	gold quality
right lung	UBERON:0002167	50.40	gold quality
adipose tissue	UBERON:0001013	50.25	gold quality
frontal cortex	UBERON:0001870	50.20	gold quality
Brodmann (1909) area 9	UBERON:0013540	49.68	gold quality

Single-cell (SCXA)

Detected in 11 experiment(s), a significant marker in 10.

Experiment	Marker?	Max mean expression
E-MTAB-7407	yes	208381.29
E-CURD-98	yes	175477.97
E-HCAD-24	yes	155061.76
E-HCAD-56	yes	79912.52
E-MTAB-8205	yes	13669.02
E-ANND-5	yes	1060.67
E-MTAB-10042	yes	43.09
E-MTAB-9388	yes	9.31
E-MTAB-9067	yes	6.46
E-HCAD-10	yes	5.83
E-ANND-3	no	1.08

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): BCL11A, GATA1, JUN, JUND, RREB1, RUNX1, SP1, ZNF274

miRNA regulators (miRDB)

1 targeting HBZ, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-29B-2-5P	99.67	68.98	1726

Literature-anchored findings (GeneRIF, showing 4)

• Chimeric zeta globin exhibits oxygen binding characteristics which fall within the range observed in adult human and human embryonic hemoglobins. (PMID:11747442)
• Hb zeta(2)beta(2)(S) exhibits an O(2) affinity as well as a Hill coefficient, Bohr response, and allosteric properties in vitro that are suboptimally suited for physiological O(2) transport in vivo (PMID:15555579)
• Data indicate a tetranucleotide 3’UTR motif that is required for the high-level accumulation of zeta-globin transcripts in cultured cells, and demonstrate that it prolongs their cytoplasmic half-lives. (PMID:24751163)
• Assessment of Bcl-xL, TAX, and HBZ Gene Expression in Adult T cell Leukemia/Lymphoma Patients. (PMID:37565279)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
mus_musculus	Hba-x	ENSMUSG00000055609
rattus_norvegicus	Hbz	ENSRNOG00000020536
drosophila_melanogaster	glob1	FBGN0027657
caenorhabditis_elegans		WBGENE00008996
caenorhabditis_elegans		WBGENE00077763

Paralogs (11): HBQ1 (ENSG00000086506), CYGB (ENSG00000161544), HBA2 (ENSG00000188536), HBG2 (ENSG00000196565), MB (ENSG00000198125), HBA1 (ENSG00000206172), HBM (ENSG00000206177), HBE1 (ENSG00000213931), HBG1 (ENSG00000213934), HBD (ENSG00000223609), HBB (ENSG00000244734)

Protein

Protein identifiers

Hemoglobin subunit zeta — P02008 (reviewed: P02008)

Alternative names: HBAZ, Hemoglobin zeta chain, Zeta-globin

All UniProt accessions (2): P02008, A0A494C057

UniProt curated annotations — full annotation on UniProt →

Function. The zeta chain is an alpha-type chain of mammalian embryonic hemoglobin.

Subunit / interactions. Heterotetramer of two zeta chains and two epsilon chains in early embryonic hemoglobin Gower-1; two zeta chains and two gamma chains in fetal hemoglobin Portland-1. Heterotetramer of two zeta chains and two beta chains in hemoglobin Portland-2, detected in fetuses and neonates with homozygous alpha-thalassemia.

Tissue specificity. Detected in fetal erythrocytes (at protein level).

Similarity. Belongs to the globin family.

RefSeq proteins (1): NP_005323* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000971	Globin	Domain
IPR002338	Hemoglobin_a-typ	Family
IPR002340	Hemoglobin_zeta	Family
IPR009050	Globin-like_sf	Homologous_superfamily
IPR012292	Globin/Proto	Homologous_superfamily
IPR050056	Hemoglobin_oxygen_transport	Family

Pfam: PF00042

UniProt features (22 total): helix 10, modified residue 5, turn 2, binding site 2, initiator methionine 1, chain 1, domain 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
3W4U	X-RAY DIFFRACTION	1.95
1JEB	X-RAY DIFFRACTION	2.1

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P02008-F1	97.89	0.99

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (2): 59 (distal binding residue); 88 (proximal binding residue)

Post-translational modifications (5): 2, 29, 53, 73, 82

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 98 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, GOBP_MYELOID_CELL_HOMEOSTASIS, GOBP_MYELOID_CELL_DEVELOPMENT, GOBP_ERYTHROCYTE_HOMEOSTASIS, ADDYA_ERYTHROID_DIFFERENTIATION_BY_HEMIN, BROWNE_HCMV_INFECTION_48HR_DN, GATA3_01, GOBP_ONE_CARBON_COMPOUND_TRANSPORT, GOBP_GAS_TRANSPORT, GOBP_OXYGEN_TRANSPORT, GATA1_04, WELCH_GATA1_TARGETS, MODULE_88, GOBP_MULTICELLULAR_ORGANISMAL_LEVEL_HOMEOSTASIS, GATA1_02

GO Biological Process (5): negative regulation of transcription by RNA polymerase II (GO:0000122), carbon dioxide transport (GO:0015670), oxygen transport (GO:0015671), erythrocyte maturation (GO:0043249), erythrocyte development (GO:0048821)

GO Molecular Function (6): oxygen carrier activity (GO:0005344), iron ion binding (GO:0005506), oxygen binding (GO:0019825), heme binding (GO:0020037), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (3): hemoglobin complex (GO:0005833), haptoglobin-hemoglobin complex (GO:0031838), extracellular exosome (GO:0070062)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
gas transport	2
protein-containing complex	2
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
negative regulation of DNA-templated transcription	1
one-carbon compound transport	1
cell maturation	1
erythrocyte development	1
erythrocyte differentiation	1
myeloid cell development	1
oxygen transport	1
oxygen binding	1
molecular carrier activity	1
transition metal ion binding	1
small molecule binding	1
tetrapyrrole binding	1
binding	1
cation binding	1
cytosol	1
extracellular vesicle	1

Protein interactions and networks

STRING

1058 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HBZ	SMAD2	Q15796	909
HBZ	JUND	P17535	886
HBZ	JUN	P05412	879
HBZ	EP300	Q09472	860
HBZ	CREB1	P16220	814
HBZ	MPG	P29372	768
HBZ	CREM	Q03060	758
HBZ	KLF1	Q13351	728
HBZ	CENPV	Q7Z7K6	720
HBZ	FOXP3	Q9BZS1	624
HBZ	SMAD3	P84022	619
HBZ	PPP1R15A	O75807	603
HBZ	HBE1	P02100	594
HBZ	ATF3	P18847	581
HBZ	SOCS2	O14508	570

IntAct

108 interactions, top by confidence:

A	B	Type	Score
HBZ	HBB	psi-mi:“MI:0915”(physical association)	0.860
HBB	HBZ	psi-mi:“MI:0915”(physical association)	0.860
HBB	HBZ	psi-mi:“MI:0407”(direct interaction)	0.860
HBZ	HBD	psi-mi:“MI:0915”(physical association)	0.720
HBZ	HBE1	psi-mi:“MI:0915”(physical association)	0.680
HBE1	HBZ	psi-mi:“MI:0407”(direct interaction)	0.680
HBZ	KHDRBS2	psi-mi:“MI:0915”(physical association)	0.670
HBZ	NOTCH2NLA	psi-mi:“MI:0915”(physical association)	0.670
KHDRBS2	HBZ	psi-mi:“MI:0915”(physical association)	0.670
	HBZ	psi-mi:“MI:0915”(physical association)	0.560
KRTAP10-7	HBZ	psi-mi:“MI:0915”(physical association)	0.560
KRTAP10-9	HBZ	psi-mi:“MI:0915”(physical association)	0.560
KRT40	HBZ	psi-mi:“MI:0915”(physical association)	0.560
HBZ	DOCK8	psi-mi:“MI:0915”(physical association)	0.560
HBZ	KRTAP10-7	psi-mi:“MI:0915”(physical association)	0.560
HBZ	KRTAP10-9	psi-mi:“MI:0915”(physical association)	0.560
HBZ	KRT40	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (58): HBZ (Two-hybrid), DOCK8 (Two-hybrid), KRT40 (Two-hybrid), KHDRBS2 (Two-hybrid), KRTAP10-7 (Two-hybrid), KRTAP10-9 (Two-hybrid), KRTAP10-3 (Two-hybrid), NOTCH2NL (Two-hybrid), HBZ (Affinity Capture-MS), SIRT5 (Affinity Capture-MS), HBZ (Affinity Capture-MS), HBZ (Affinity Capture-MS), MYO18A (Affinity Capture-MS), CUL1 (Affinity Capture-Western), HBZ (Affinity Capture-MS)

ESM2 similar proteins: A2XE98, C0HJT7, I1LJI1, I3SPW2, K7N5M6, O04985, O04986, O13163, O13164, O24520, O93348, P02008, P02140, P02141, P06347, P07803, P13786, P23018, P23244, P45721, P45722, P68168, P68169, P80727, P82345, P83272, P83273, P83614, P83625, P84652, P85082, Q3C1F3, Q3C1F4, Q42785, Q42831, Q575S8, Q575S9, Q90485, Q90486, Q91473

Diamond homologs: A1A4Q3, B3EWD1, B3EWE1, B3EWE3, O12985, P01942, P01943, P01944, P01945, P01946, P01947, P01950, P01964, P01967, P01975, P01977, P01978, P01979, P01980, P01983, P01990, P01993, P02001, P02002, P02003, P02005, P02006, P02007, P02008, P02009, P02011, P04237, P04238, P04239, P04240, P04241, P04242, P04243, P04442, P06347

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 51 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
oxygen transport	6	143.6×	6e-10
erythrocyte development	6	71.8×	3e-08

Disease & clinical

Clinical variants and AI predictions

ClinVar

18 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	15
Likely benign	1
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

237 predictions. Top by Δscore:

Variant	Effect	Δscore
16:153002:GAG:G	donor_gain	1.0000
16:153005:GT:G	donor_loss	1.0000
16:153006:T:G	donor_loss	1.0000
16:153888:CCAG:C	acceptor_loss	1.0000
16:153890:A:AG	acceptor_gain	1.0000
16:153890:A:T	acceptor_loss	1.0000
16:153891:G:GG	acceptor_gain	1.0000
16:153891:GGCT:G	acceptor_gain	1.0000
16:153891:GGCTC:G	acceptor_gain	1.0000
16:153945:ACCCG:A	acceptor_gain	1.0000
16:154093:CAAG:C	donor_loss	1.0000
16:154094:AAGG:A	donor_loss	1.0000
16:154095:AG:A	donor_gain	1.0000
16:154095:AGGT:A	donor_loss	1.0000
16:154096:GG:G	donor_gain	1.0000
16:154097:GTGC:G	donor_loss	1.0000
16:153000:GAGAG:G	donor_gain	0.9900
16:153005:G:GG	donor_gain	0.9900
16:153890:AG:A	acceptor_gain	0.9900
16:153891:GG:G	acceptor_gain	0.9900
16:153891:GGC:G	acceptor_gain	0.9900
16:153945:ACCC:A	acceptor_gain	0.9900
16:154097:G:GG	donor_gain	0.9900
16:154270:A:AG	acceptor_gain	0.9900
16:154271:G:GG	acceptor_gain	0.9900
16:154266:CCCCA:C	acceptor_loss	0.9800
16:154267:CCCAG:C	acceptor_loss	0.9800
16:154268:CCAG:C	acceptor_loss	0.9800
16:154269:CAGC:C	acceptor_loss	0.9800
16:154271:GCTC:G	acceptor_gain	0.9800

AlphaMissense

917 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:154091:T:C	F99L	0.994
16:154093:C:A	F99L	0.994
16:154093:C:G	F99L	0.994
16:153926:T:C	F44L	0.991
16:153928:C:A	F44L	0.991
16:153928:C:G	F44L	0.991
16:154058:C:G	H88D	0.988
16:154062:C:A	A89D	0.988
16:154347:T:A	W126R	0.985
16:154347:T:C	W126R	0.985
16:152986:G:A	G26D	0.983
16:154005:C:A	A70E	0.983
16:153975:G:A	G60D	0.982
16:153927:T:C	F44S	0.981
16:154058:C:A	H88N	0.981
16:154092:T:C	F99S	0.981
16:154060:C:A	H88Q	0.980
16:154060:C:G	H88Q	0.980
16:154090:C:A	N98K	0.980
16:154090:C:G	N98K	0.980
16:154395:C:A	R142S	0.978
16:154004:G:C	A70P	0.977
16:153927:T:G	F44C	0.976
16:154392:T:C	Y141H	0.976
16:154080:A:G	D95G	0.974
16:154092:T:G	F99C	0.973
16:154074:G:C	R93P	0.970
16:154083:C:A	P96Q	0.970
16:153971:C:G	H59D	0.969
16:154396:G:C	R142P	0.969

dbSNP variants (sampled 300 via entrez): RS1000689351 (16:150820 T>G), RS1000741228 (16:151018 T>C), RS1001607930 (16:151756 C>G), RS1001995715 (16:154386 G>A,C,T), RS1002031558 (16:153223 GAGGACAGATAGCGTTCCCTCTCAGTGAGGAGAGCAGGGTA>G), RS1002060106 (16:152058 A>C,T), RS1002344905 (16:153142 G>A,T), RS1005617977 (16:152533 T>C), RS1006023332 (16:152456 G>C), RS1006102427 (16:151329 A>G), RS1006211552 (16:151583 C>G,T), RS1006675968 (16:151440 T>A), RS1007102327 (16:152005 G>A), RS1007785549 (16:154993 A>G), RS1008158580 (16:151315 G>C)

Disease associations

OMIM: gene MIM:142310 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

14 associations (top):

Study	Trait	p-value
GCST003122_1	Hemoglobin levels	6.000000e-18
GCST004602_219	Mean corpuscular volume	8.000000e-15
GCST004630_167	Mean corpuscular hemoglobin	1.000000e-33
GCST005951_12	Body mass index	5.000000e-11
GCST005992_20	Mean corpuscular hemoglobin concentration	7.000000e-30
GCST005993_12	Mean corpuscular hemoglobin	2.000000e-78
GCST005996_2	Red blood cell count	2.000000e-12
GCST006011_44	Mean corpuscular volume	5.000000e-55
GCST006585_1712	Blood protein levels	2.000000e-10
GCST008991_6	Early cardiac repolarization	1.000000e-06
GCST90002384_352	Hemoglobin	2.000000e-12
GCST90002390_626	Mean corpuscular hemoglobin	6.000000e-17
GCST90002403_655	Red blood cell count	1.000000e-22
GCST90002403_656	Red blood cell count	1.000000e-17

EFO canonical traits (7, from GWAS)

EFO ID	Trait name
EFO:0004509	hemoglobin measurement
EFO:0007629	hemoglobin A1 measurement
EFO:0004527	mean corpuscular hemoglobin
EFO:0004340	body mass index
EFO:0004528	mean corpuscular hemoglobin concentration
EFO:0004305	erythrocyte count
EFO:0004885	early cardiac repolarization measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6066981 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.28	Kd	522.1	nM	CHEMBL5653589
6.28	ED50	522.1	nM	CHEMBL5653589

PubChem BioAssay actives

1 with measured affinity, of 2 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148490: Binding affinity to human HBZ incubated for 45 mins by Kinobead based pull down assay	kd	0.5221	uM

CTD chemical–gene interactions

13 total (human), top 13 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases expression, increases methylation, affects cotreatment	2
2,4,6-tribromophenol	decreases expression	1
decabromobiphenyl ether	decreases expression	1
tetrabromobisphenol A	decreases expression	1
thrombin receptor-activating peptide SFLLRNPNDKY	increases secretion	1
entinostat	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
Benzo(a)pyrene	decreases methylation, increases methylation	1
Hydralazine	affects cotreatment, decreases expression	1
Hydrogen Peroxide	decreases expression, increases expression	1
T-2 Toxin	increases expression	1
Aflatoxin B1	decreases methylation	1
Butyric Acid	increases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5651532	Binding	Binding affinity to human HBZ incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.