HCN3

Summary

HCN3 (hyperpolarization activated cyclic nucleotide gated potassium channel 3, HGNC:19183) is a protein-coding gene on chromosome 1q22, encoding Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 (Q9P1Z3). Hyperpolarization-activated ion channel that are permeable to sodium and potassium ions, with an about 3:1 preference for potassium ions.

This gene encodes a multi-pass membrane protein that functions as a voltage gated cation channel. The encoded protein is a member of a family of closely related cyclic adenosine monophosphate-binding channel proteins. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 57657 — RefSeq curated summary.

At a glance

• GWAS associations: 19
• Clinical variants (ClinVar): 130 total
• Druggable target: yes
• MANE Select transcript: NM_020897

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:19183
Approved symbol	HCN3
Name	hyperpolarization activated cyclic nucleotide gated potassium channel 3
Location	1q22
Locus type	gene with protein product
Status	Approved
Aliases	KIAA1535
Ensembl gene	ENSG00000143630
Ensembl biotype	protein_coding
OMIM	609973
Entrez	57657

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 6 protein_coding, 3 protein_coding_CDS_not_defined

ENST00000368358, ENST00000467204, ENST00000492035, ENST00000496230, ENST00000877986, ENST00000931756, ENST00000931757, ENST00000967751, ENST00000967752

RefSeq mRNA: 1 — MANE Select: NM_020897 NM_020897

CCDS: CCDS1108

Canonical transcript exons

ENST00000368358 — 8 exons

Exon	Start	End
ENSE00001446962	155287781	155289848
ENSE00001446964	155277463	155277868
ENSE00001765873	155283974	155284135
ENSE00003533570	155287173	155287337
ENSE00003568604	155285165	155285311
ENSE00003597006	155282411	155282840
ENSE00003605808	155285724	155285964
ENSE00003670414	155284539	155284757

Expression profiles

Bgee: expression breadth ubiquitous, 132 present calls, max score 90.96.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.3842 / max 67.8884, expressed in 1272 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
5592	3.3842	1272

Top tissues by expression

133 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cortical plate	UBERON:0005343	90.96	gold quality
right hemisphere of cerebellum	UBERON:0014890	90.28	gold quality
cerebellum	UBERON:0002037	89.75	gold quality
cerebellar cortex	UBERON:0002129	89.74	gold quality
cerebellar hemisphere	UBERON:0002245	89.72	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.90	gold quality
ganglionic eminence	UBERON:0004023	87.48	gold quality
mucosa of transverse colon	UBERON:0004991	86.17	gold quality
ventricular zone	UBERON:0003053	84.48	gold quality
lower esophagus mucosa	UBERON:0035834	82.11	gold quality
pituitary gland	UBERON:0000007	81.99	gold quality
adenohypophysis	UBERON:0002196	80.89	gold quality
hypothalamus	UBERON:0001898	80.78	gold quality
superior frontal gyrus	UBERON:0002661	80.35	gold quality
transverse colon	UBERON:0001157	79.71	gold quality
right frontal lobe	UBERON:0002810	79.04	gold quality
primary visual cortex	UBERON:0002436	78.73	gold quality
skin of leg	UBERON:0001511	78.37	gold quality
zone of skin	UBERON:0000014	77.98	gold quality
cortex of kidney	UBERON:0001225	77.94	gold quality
small intestine Peyer’s patch	UBERON:0003454	77.54	gold quality
skin of abdomen	UBERON:0001416	77.52	gold quality
brain	UBERON:0000955	77.23	gold quality
duodenum	UBERON:0002114	77.16	gold quality
esophagus mucosa	UBERON:0002469	76.80	gold quality
small intestine	UBERON:0002108	76.69	gold quality
anterior cingulate cortex	UBERON:0009835	76.62	gold quality
right adrenal gland	UBERON:0001233	76.33	gold quality
stromal cell of endometrium	CL:0002255	76.06	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	75.80	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	2.91

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

63 targeting HCN3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-3134	100.00	66.43	777
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-218-5P	99.93	72.22	2103
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-629-3P	99.85	67.99	1875
HSA-MIR-6079	99.84	68.54	1170
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-26A-5P	99.78	73.52	2303
HSA-MIR-26B-5P	99.78	73.51	2305
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-4465	99.71	72.56	2096
HSA-MIR-548AU-3P	99.70	68.22	1373
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-5004-5P	99.68	66.63	1294
HSA-MIR-6892-3P	99.68	66.40	1178

Literature-anchored findings (GeneRIF, showing 6)

• human HCN3 is not modulated by intracellular cAMP, in contrast to other HCN subtypes (PMID:16043489)
• Genetic analysis in 48 Sudden unexpected death in epilepsy cases identified six novel and three previously reported nonsynonymous (amino acid changing) variants in HCN1 , HCN2, HCN3 and HCN4. (PMID:21615589)
• KCTD3 is an accessory subunit of native HCN3 complexes (PMID:23382386)
• Reduced HCN3 expression in aganglionic bowel suggests its potential role in Hirschsprung’s disease pathophysiology. (PMID:25987789)
• Hyperpolarization-activated cyclic nucleotide-gated cation channel 3 promotes HCC development in a female-biased manner. (PMID:37733590)
• Cryo-EM structure of human HCN3 channel and its regulation by cAMP. (PMID:38636662)

Cross-species orthologs

18 orthologs

Organism	Symbol	Gene ID
danio_rerio	kcnh6a	ENSDARG00000001803
danio_rerio	kcnh6b	ENSDARG00000010296
danio_rerio	kcnh3	ENSDARG00000069560
danio_rerio	cngk	ENSDARG00000093267
mus_musculus	Hcn3	ENSMUSG00000028051
rattus_norvegicus	Hcn3	ENSRNOG00000020444
drosophila_melanogaster	sei	FBGN0003353
drosophila_melanogaster	Elk	FBGN0011589
drosophila_melanogaster	CG6026	FBGN0038676
drosophila_melanogaster	CngA	FBGN0261612
drosophila_melanogaster	Cngl	FBGN0263257
drosophila_melanogaster	Ih	FBGN0263397
drosophila_melanogaster	CngB	FBGN0266346
caenorhabditis_elegans		WBGENE00000487
caenorhabditis_elegans	tax-2	WBGENE00006525
caenorhabditis_elegans		WBGENE00006526
caenorhabditis_elegans		WBGENE00006830
caenorhabditis_elegans		WBGENE00022295

Paralogs (17): KCNH2 (ENSG00000055118), CNGB1 (ENSG00000070729), KCNH4 (ENSG00000089558), HCN2 (ENSG00000099822), CNGA4 (ENSG00000132259), KCNH3 (ENSG00000135519), HCN4 (ENSG00000138622), KCNH5 (ENSG00000140015), KCNH1 (ENSG00000143473), CNGA3 (ENSG00000144191), HCN1 (ENSG00000164588), CNGB3 (ENSG00000170289), KCNH6 (ENSG00000173826), CNGA2 (ENSG00000183862), KCNH8 (ENSG00000183960), KCNH7 (ENSG00000184611), CNGA1 (ENSG00000198515)

Protein

Protein identifiers

Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 — Q9P1Z3 (reviewed: Q9P1Z3)

All UniProt accessions (1): Q9P1Z3

UniProt curated annotations — full annotation on UniProt →

Function. Hyperpolarization-activated ion channel that are permeable to sodium and potassium ions, with an about 3:1 preference for potassium ions. Contributes to the native pacemaker currents in heart (If) and in neurons (Ih). In particular, plays a pivotal role in maintaining excitability and promoting rhythmic burst firing within hypothalamic nuclei. Exerts a significant influence on the configuration of the cardiac action potential waveform. Does not appear to play a prominent role in the processing of acute, neuropathic, or inflammatory pain.

Subunit / interactions. Homotetramer. The potassium channel is composed of a homo- or heterotetrameric complex of pore-forming subunits. Interacts with HCN11. Interacts with KCTD3; this interaction increases cell surface expression and current density of this channel. Interacts with PEX5L.

Subcellular location. Cell membrane.

Tissue specificity. Detected in brain.

Activity regulation. Unlike HCN2 and HCN4, HCN3 is insensitive to cyclic nucleotides, such as cAMP or cGMP. This lack of sensitivity of HCN3, despite harboring a functional cyclic nucleotide-binding domain (CNBD), may be explained by its shorter C-terminal sequence, which may alter the normal autoinhibition of the channel. Inhibited by Cs(1+) and ZD7288. Phosphatidylinositol-4,5-bisphosphate (PIP(2)) shifts HCN3 activation to more depolarized potentials and accelerated activation kinetics.

Domain organisation. The segment S4 is the voltage-sensor and is characterized by a series of positively charged amino acids at every third position. The ion-conducting pore region is between segment S5 and S6.

Similarity. Belongs to the potassium channel HCN family.

RefSeq proteins (1): NP_065948* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000595	cNMP-bd_dom	Domain
IPR003938	K_chnl_volt-dep_EAG/ELK/ERG	Family
IPR005821	Ion_trans_dom	Domain
IPR013621	Ion_trans_N	Domain
IPR014710	RmlC-like_jellyroll	Homologous_superfamily
IPR018490	cNMP-bd_dom_sf	Homologous_superfamily
IPR051413	K/Na_HCN_channel	Family

Pfam: PF00027, PF00520, PF08412

Catalyzed reactions (Rhea), 2 shown:

• K(+)(in) = K(+)(out) (RHEA:29463)
• Na(+)(in) = Na(+)(out) (RHEA:34963)

UniProt features (72 total): helix 26, strand 11, topological domain 8, binding site 7, transmembrane region 6, region of interest 4, sequence conflict 2, turn 2, chain 1, intramembrane region 1, compositionally biased region 1, modified residue 1, glycosylation site 1, sequence variant 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
8INZ	ELECTRON MICROSCOPY	2.72
8IO3	ELECTRON MICROSCOPY	3.02
8IO0	ELECTRON MICROSCOPY	3.19

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9P1Z3-F1	73.70	0.40

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (7): 492; 493; 495; 502; 503; 543; 546

Post-translational modifications (1): 634

Glycosylation sites (1): 291

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-1296061	HCN channels

MSigDB gene sets: 179 (showing top): GOBP_POTASSIUM_ION_TRANSPORT, E2F_Q4, GOBP_MEMBRANE_DEPOLARIZATION, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, AP1_01, E2F4DP1_01, GOBP_CIRCULATORY_SYSTEM_PROCESS, REACTOME_POTASSIUM_CHANNELS, GOBP_SODIUM_ION_TRANSMEMBRANE_TRANSPORT, GOBP_REGULATION_OF_MEMBRANE_DEPOLARIZATION, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, GOBP_MONOATOMIC_CATION_TRANSPORT, GOBP_CELL_CELL_SIGNALING, MODULE_331, E2F1DP1_01

GO Biological Process (14): regulation of membrane depolarization (GO:0003254), sodium ion transmembrane transport (GO:0035725), regulation of membrane potential (GO:0042391), cellular response to cAMP (GO:0071320), potassium ion transmembrane transport (GO:0071805), regulation of heart rate by cardiac conduction (GO:0086091), sodium ion import across plasma membrane (GO:0098719), regulation of SA node cell action potential (GO:0098907), potassium ion import across plasma membrane (GO:1990573), monoatomic ion transport (GO:0006811), potassium ion transport (GO:0006813), sodium ion transport (GO:0006814), monoatomic ion transmembrane transport (GO:0034220), transmembrane transport (GO:0055085)

GO Molecular Function (8): voltage-gated sodium channel activity (GO:0005248), voltage-gated potassium channel activity (GO:0005249), cAMP binding (GO:0030552), nucleotide binding (GO:0000166), monoatomic ion channel activity (GO:0005216), potassium channel activity (GO:0005267), sodium channel activity (GO:0005272), protein binding (GO:0005515)

GO Cellular Component (6): plasma membrane (GO:0005886), axon (GO:0030424), dendrite (GO:0030425), HCN channel complex (GO:0098855), membrane (GO:0016020), monoatomic ion channel complex (GO:0034702)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Potassium Channels	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
monoatomic cation transmembrane transport	2
inorganic cation import across plasma membrane	2
transport	2
metal ion transport	2
monoatomic cation channel activity	2
neuron projection	2
regulation of membrane potential	1
regulation of cellular process	1
membrane depolarization	1
sodium ion transport	1
monoatomic ion transmembrane transport	1
regulation of biological quality	1
response to cAMP	1
cellular response to nitrogen compound	1
cellular response to oxygen-containing compound	1
potassium ion transport	1
regulation of heart rate	1
cardiac conduction	1
sodium ion transmembrane transport	1
regulation of cell communication	1
SA node cell action potential	1
regulation of cardiac muscle cell action potential	1
potassium ion transmembrane transport	1
monoatomic ion transport	1
transmembrane transport	1
cellular process	1
sodium channel activity	1
potassium channel activity	1
voltage-gated monoatomic cation channel activity	1
cyclic nucleotide binding	1
adenyl ribonucleotide binding	1
anion binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
monoatomic ion transmembrane transporter activity	1
channel activity	1
potassium ion transmembrane transporter activity	1
sodium ion transmembrane transporter activity	1
binding	1
membrane	1

Protein interactions and networks

STRING

880 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HCN3	KCTD3	Q9Y597	688
HCN3	PEX5L	Q8IYB4	678
HCN3	HCN4	Q9Y3Q4	467
HCN3	NALCN	Q8IZF0	458
HCN3	KCNN1	Q92952	450
HCN3	CACNA1H	O95180	447
HCN3	PAXBP1	Q9Y5B6	431
HCN3	DUS2	Q9NX74	429
HCN3	KCNN3	Q9UGI6	425
HCN3	COPRS	Q9NQ92	419
HCN3	CACNA1G	O43497	419
HCN3	SCN5A	Q14524	414
HCN3	MAP6D1	Q9H9H5	409
HCN3	ENTREP3	P81408	408
HCN3	KCNC3	Q14003	407

IntAct

12 interactions, top by confidence:

A	B	Type	Score
Shank3	HCN3	psi-mi:“MI:0915”(physical association)	0.400
ICP0	ACOT8	psi-mi:“MI:0914”(association)	0.350
HCN1	USP27X	psi-mi:“MI:0914”(association)	0.350
HCN1	POTEF	psi-mi:“MI:0914”(association)	0.350
TTYH1	TMEM223	psi-mi:“MI:0914”(association)	0.350
HCN4	CFAP74	psi-mi:“MI:0914”(association)	0.350

BioGRID (7): HCN3 (Affinity Capture-Western), HCN3 (Affinity Capture-Western), HCN3 (Affinity Capture-MS), HCN3 (Affinity Capture-MS), HCN3 (Affinity Capture-MS), HCN3 (Affinity Capture-MS), HCN3 (Affinity Capture-RNA)

ESM2 similar proteins: A2APX8, A6H8H5, G5EFJ9, O18868, O18965, O60741, O70507, O88703, O88704, O95259, P04774, P15387, P17970, P35498, P55934, P58391, P58392, Q00194, Q02280, Q03041, Q03611, Q03717, Q14721, Q16281, Q29441, Q4ZHA6, Q60603, Q62897, Q62927, Q63099, Q63472, Q8MJD7, Q8NCM2, Q90805, Q920E3, Q95167, Q9EPI9, Q9ER33, Q9JKA7, Q9JKA8

Diamond homologs: O60741, O70507, O88703, O88704, O88705, P05987, P07278, P31320, P36600, Q2K5E1, Q6BZG7, Q6CPK7, Q6FQL6, Q8MMZ8, Q98GN8, Q9JKA7, Q9JKA8, Q9JKA9, Q9JKB0, Q9MZS1, Q9P1Z3, Q9TV66, Q9UL51, Q9Y3Q4, P9WM60, P9WM61, Q03042, Q03043, A5K0N4, A0A509AKL0, A0R3F9, A3RL54, A8X6H1, O05581, O14448, O42794, O59922, O76360, O77676, P00514

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

130 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	112
Likely benign	3
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

2155 predictions. Top by Δscore:

Variant	Effect	Δscore
1:155278235:C:CG	donor_gain	1.0000
1:155282409:A:AG	acceptor_gain	1.0000
1:155282410:G:GG	acceptor_gain	1.0000
1:155282747:GGCCC:G	donor_gain	1.0000
1:155282774:GATCC:G	donor_gain	1.0000
1:155282787:C:G	donor_gain	1.0000
1:155282819:C:G	donor_gain	1.0000
1:155282831:G:GG	donor_gain	1.0000
1:155282838:G:GT	donor_gain	1.0000
1:155285137:T:A	acceptor_gain	1.0000
1:155285143:T:TA	acceptor_gain	1.0000
1:155285144:G:A	acceptor_gain	1.0000
1:155285147:A:AG	acceptor_gain	1.0000
1:155285147:AAT:A	acceptor_gain	1.0000
1:155285147:AATGG:A	acceptor_gain	1.0000
1:155285148:A:G	acceptor_gain	1.0000
1:155285273:G:GT	donor_gain	1.0000
1:155285274:A:T	donor_gain	1.0000
1:155285291:C:G	donor_gain	1.0000
1:155285308:CGAG:C	donor_loss	1.0000
1:155285309:GAGGT:G	donor_loss	1.0000
1:155285310:AG:A	donor_loss	1.0000
1:155285311:GG:G	donor_loss	1.0000
1:155285312:GTGGG:G	donor_loss	1.0000
1:155285313:T:A	donor_loss	1.0000
1:155287169:GCAG:G	acceptor_loss	1.0000
1:155287170:CA:C	acceptor_loss	1.0000
1:155287171:A:AC	acceptor_loss	1.0000
1:155287171:A:AG	acceptor_gain	1.0000
1:155287172:G:GA	acceptor_loss	1.0000

AlphaMissense

4970 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:155282455:T:C	L108P	1.000
1:155282467:C:A	P112H	1.000
1:155282467:C:G	P112R	1.000
1:155282481:T:C	F117L	1.000
1:155282483:C:A	F117L	1.000
1:155282483:C:G	F117L	1.000
1:155282677:C:A	P182H	1.000
1:155282791:G:C	R220T	1.000
1:155282791:G:T	R220M	1.000
1:155282794:T:C	L221P	1.000
1:155284026:T:C	L254P	1.000
1:155284044:T:C	L260P	1.000
1:155284049:T:C	C262R	1.000
1:155284055:T:A	W264R	1.000
1:155284055:T:C	W264R	1.000
1:155284061:G:C	G266R	1.000
1:155284062:G:A	G266D	1.000
1:155284064:T:C	C267R	1.000
1:155284065:G:A	C267Y	1.000
1:155284066:T:G	C267W	1.000
1:155284068:T:C	L268P	1.000
1:155284073:T:C	F270L	1.000
1:155284075:C:A	F270L	1.000
1:155284075:C:G	F270L	1.000
1:155284077:T:C	L271P	1.000
1:155284112:T:A	W283R	1.000
1:155284112:T:C	W283R	1.000
1:155284114:G:C	W283C	1.000
1:155284114:G:T	W283C	1.000
1:155284587:A:C	S307R	1.000

dbSNP variants (sampled 300 via entrez): RS1000035505 (1:155276296 T>C), RS1000184855 (1:155279041 C>G), RS1000233629 (1:155283615 T>C), RS1000260937 (1:155286076 C>A), RS1001219174 (1:155284929 C>T), RS1001261884 (1:155284835 A>T), RS1001333791 (1:155284437 G>A), RS1001641388 (1:155277696 C>G), RS1001893221 (1:155277182 G>A), RS1002113500 (1:155288606 T>C), RS1002251024 (1:155275927 G>A), RS1002422815 (1:155277373 GGTCTTGGCGCGGCCCTCGCCAGGGGGCGCCGC>G), RS1002481530 (1:155289568 T>A), RS1002549462 (1:155289020 T>G), RS1003171314 (1:155276229 A>G)

Disease associations

OMIM: gene MIM:609973 | disease phenotypes: MIM:266200

GenCC curated gene-disease

Mondo (1): pyruvate kinase deficiency of red cells (MONDO:0009950)

Orphanet (1): Hemolytic anemia due to red cell pyruvate kinase deficiency (Orphanet:766)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

19 associations (top):

Study	Trait	p-value
GCST002990_1	Gastric adenocarcinoma (histologically verified)	2.000000e-08
GCST002992_1	Gastric cancer	2.000000e-09
GCST002992_2	Gastric cancer	8.000000e-10
GCST004131_70	Inflammatory bowel disease	6.000000e-08
GCST004132_44	Crohn’s disease	2.000000e-07
GCST007294_124	Body fat distribution (trunk fat ratio)	8.000000e-35
GCST007294_3	Body fat distribution (trunk fat ratio)	6.000000e-21
GCST007294_50	Body fat distribution (trunk fat ratio)	1.000000e-15
GCST007295_17	Body fat distribution (leg fat ratio)	3.000000e-13
GCST007295_37	Body fat distribution (leg fat ratio)	7.000000e-17
GCST007295_72	Body fat distribution (leg fat ratio)	1.000000e-28
GCST010696_19	Cortical thickness (min-P)	2.000000e-10
GCST010697_10	Cortical surface area (min-P)	3.000000e-10
GCST010698_59	Subcortical volume (min-P)	9.000000e-10
GCST010699_20	Brain morphology (min-P)	7.000000e-10
GCST010700_5	Cortical thickness (MOSTest)	8.000000e-17
GCST010701_66	Cortical surface area (MOSTest)	1.000000e-09
GCST010702_43	Subcortical volume (MOSTest)	3.000000e-10
GCST010703_253	Brain morphology (MOSTest)	4.000000e-14

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004341	body fat distribution
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C564858	Pyruvate Kinase Deficiency of Red Cells (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL1795173 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: vgic — Cyclic nucleotide-regulated channels (CNG)

Most potent curated ligand interactions (5 total), top 5:

Ligand	Action	Affinity	Parameter
cilobradine	Antagonist	6.0	pIC50
zatebradine	Antagonist	5.7	pIC50
ivabradine	Antagonist	5.7	pIC50
ZD7288	Antagonist	4.5	pIC50
Cs+	Antagonist	3.8	pIC50

ChEMBL bioactivities

3 potent at pChembl≥5 of 3 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.50	IC50	3162	nM	CHEMBL1823882
5.34	IC50	4600	nM	CHEMBL6195028

PubChem BioAssay actives

1 with measured affinity, of 2 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-ethoxy-N-[(1-piperazin-1-ylcyclohexyl)methyl]benzamide	617263: Inhibition of human HCN3 heterologously expressed in HEK-293 cells after 30 mins by VIPR assay	ic50	3.1623	uM

CTD chemical–gene interactions

16 total (human), top 16 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Nickel	decreases expression	2
aristolochic acid I	increases expression	1
beta-lapachone	decreases expression	1
beta-methylcholine	affects expression	1
CGP 52608	affects binding, increases reaction	1
Sunitinib	increases expression	1
Acetaminophen	increases expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	decreases methylation	1
Testosterone	increases expression	1
Tobacco Smoke Pollution	decreases expression	1
Tretinoin	increases expression	1
Isotretinoin	decreases expression	1
Cyclosporine	decreases expression	1
Okadaic Acid	decreases expression	1
Lactic Acid	increases expression	1

ChEMBL screening assays

3 unique, capped per target: 1 binding, 1 admet, 1 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1825386	Binding	Inhibition of human HCN3 heterologously expressed in HEK-293 cells after 30 mins by VIPR assay	Discovery of a novel series of selective HCN1 blockers. — Bioorg Med Chem Lett
CHEMBL4407445	ADMET	Inhibition of HCN3 (unknown origin) at 3 uM relative to control	Discovery of 3,4,6-Trisubstituted Piperidine Derivatives as Orally Active, Low hERG Blocking Akt Inhibitors via Conformational Restriction and Structure-Based Design. — J Med Chem
CHEMBL6194498	Functional	Inhibition of human HCN3 in HCN3 overexpressing HEK293 cells (tetracycline inducible) using Automated patch clamp after a single hyperpolarizing pulse -100 mV (HCN3)	Data for DCP probe RO-275

Cellosaurus cell lines

1 cell lines: 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_RQ83	PrecisION hHCN3-HEK	Transformed cell line	Female

Clinical trials (associated diseases)

14 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05777993	PHASE4	ENROLLING_BY_INVITATION	A Study to Provide Continued Access to Mitapivat for Participants Who Previously Completed an Agios-Sponsored Mitapivat Study
NCT03548220	PHASE3	COMPLETED	A Study to Evaluate Efficacy and Safety of AG-348 in Not Regularly Transfused Adult Participants With Pyruvate Kinase Deficiency (PKD)
NCT03559699	PHASE3	COMPLETED	A Study Evaluating the Efficacy and Safety of AG-348 in Regularly Transfused Adult Participants With Pyruvate Kinase Deficiency (PKD)
NCT03853798	PHASE3	COMPLETED	Extension Study of AG-348 in Adult Participants With Pyruvate Kinase Deficiency Previously Enrolled in AG-348-006 or AG348-C-007
NCT02476916	PHASE2	COMPLETED	A Study of AG-348 in Adult Participants With Pyruvate Kinase (PK) Deficiency
NCT06422351	PHASE2	SUSPENDED	Clinical Trial to Evaluate the Efficacy of Gene Therapy for Pyruvate Kinase Deficiency
NCT04105166	PHASE1	COMPLETED	Gene Therapy for Pyruvate Kinase Deficiency (PKD)
NCT07612345	PHASE1	NOT_YET_RECRUITING	High-Dose Vitamin C in G6PDA and Pyruvate Kinase Deficiency: A Safety Study
NCT02053480	Not specified	COMPLETED	Pyruvate Kinase Deficiency Natural History Study
NCT03481738	Not specified	ACTIVE_NOT_RECRUITING	Pyruvate Kinase Deficiency Global Longitudinal Registry
NCT03866590	Not specified	COMPLETED	Pyruvate Kinase Deficiency Epidemiological Study (PIECE)
NCT04902833	Not specified	COMPLETED	Acquired Pyruvate Kinase Deficiency In Clonal Myeloid Neoplasms
NCT04964323	Not specified	TERMINATED	Pyruvate Kinase (PK) Deficiency Global Longitudinal Registry: Patient-Reported Outcomes (PRO)
NCT04995315	Not specified	COMPLETED	Pyruvate Kinase Deficiency Global Longitudinal Registry Substudy of Protocol AG348-C-008