HDAC10

Summary

HDAC10 (histone deacetylase 10, HGNC:18128) is a protein-coding gene on chromosome 22q13.33, encoding Polyamine deacetylase HDAC10 (Q969S8). Polyamine deacetylase (PDAC), which acts preferentially on N(8)-acetylspermidine, and also on acetylcadaverine and acetylputrescine.

The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 83933 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 159 total — 2 pathogenic
• Druggable target: yes — 30 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_032019

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18128
Approved symbol	HDAC10
Name	histone deacetylase 10
Location	22q13.33
Locus type	gene with protein product
Status	Approved
Aliases	DKFZP761B039
Ensembl gene	ENSG00000100429
Ensembl biotype	protein_coding
OMIM	608544
Entrez	83933

Gene structure

Transcript identifiers

Ensembl transcripts: 33 — 14 protein_coding, 9 retained_intron, 6 protein_coding_CDS_not_defined, 4 nonsense_mediated_decay

ENST00000216271, ENST00000349505, ENST00000415993, ENST00000429374, ENST00000448072, ENST00000454936, ENST00000470378, ENST00000470965, ENST00000471375, ENST00000475965, ENST00000476310, ENST00000477814, ENST00000482213, ENST00000483222, ENST00000488270, ENST00000489424, ENST00000496235, ENST00000496909, ENST00000497483, ENST00000497952, ENST00000498366, ENST00000626012, ENST00000895900, ENST00000895901, ENST00000895902, ENST00000895903, ENST00000895904, ENST00000895905, ENST00000895906, ENST00000895907, ENST00000895908, ENST00000948608, ENST00000948609

RefSeq mRNA: 2 — MANE Select: NM_032019 NM_001159286, NM_032019

CCDS: CCDS14088, CCDS54545

Canonical transcript exons

ENST00000216271 — 20 exons

Exon	Start	End
ENSE00001128454	50250974	50251265
ENSE00003459287	50247692	50247776
ENSE00003518676	50250771	50250905
ENSE00003526205	50249860	50249964
ENSE00003526408	50245910	50246092
ENSE00003531211	50245675	50245827
ENSE00003535196	50249103	50249168
ENSE00003535827	50246679	50246735
ENSE00003544215	50248831	50248890
ENSE00003544867	50249635	50249703
ENSE00003554203	50250063	50250160
ENSE00003567162	50249328	50249454
ENSE00003571370	50247890	50248145
ENSE00003579541	50246875	50246966
ENSE00003579843	50248225	50248292
ENSE00003581414	50246298	50246376
ENSE00003583275	50245183	50245530
ENSE00003675664	50248662	50248751
ENSE00003693647	50248366	50248472
ENSE00003694225	50250427	50250523

Expression profiles

Bgee: expression breadth ubiquitous, 185 present calls, max score 97.18.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.2761 / max 267.7466, expressed in 1787 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
194711	11.1096	1777
194712	0.8080	448
194713	0.3585	164

Top tissues by expression

230 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	97.18	gold quality
right uterine tube	UBERON:0001302	95.99	gold quality
right hemisphere of cerebellum	UBERON:0014890	95.70	gold quality
adenohypophysis	UBERON:0002196	94.97	gold quality
cerebellar hemisphere	UBERON:0002245	94.95	gold quality
cerebellar cortex	UBERON:0002129	94.80	gold quality
mucosa of transverse colon	UBERON:0004991	94.45	gold quality
pituitary gland	UBERON:0000007	94.17	gold quality
spleen	UBERON:0002106	93.87	gold quality
small intestine Peyer’s patch	UBERON:0003454	93.72	gold quality
right ovary	UBERON:0002118	93.41	gold quality
cerebellum	UBERON:0002037	93.33	gold quality
endocervix	UBERON:0000458	93.01	gold quality
right frontal lobe	UBERON:0002810	93.00	gold quality
left ovary	UBERON:0002119	92.98	gold quality
body of stomach	UBERON:0001161	92.56	gold quality
transverse colon	UBERON:0001157	92.54	gold quality
minor salivary gland	UBERON:0001830	92.51	gold quality
skin of abdomen	UBERON:0001416	92.50	gold quality
skin of leg	UBERON:0001511	92.45	gold quality
metanephros cortex	UBERON:0010533	92.35	gold quality
right lobe of thyroid gland	UBERON:0001119	92.32	gold quality
right lobe of liver	UBERON:0001114	92.26	gold quality
left lobe of thyroid gland	UBERON:0001120	92.05	gold quality
ectocervix	UBERON:0012249	91.69	gold quality
left uterine tube	UBERON:0001303	91.65	gold quality
right adrenal gland	UBERON:0001233	91.61	gold quality
body of pancreas	UBERON:0001150	91.59	gold quality
vermiform appendix	UBERON:0001154	91.55	gold quality
left adrenal gland cortex	UBERON:0035825	91.47	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.92

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

1 targets.

Target	Regulation
TXNIP	Repression

miRNA regulators (miRDB)

10 targeting HDAC10, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-6787-5P	97.54	63.85	457
HSA-MIR-5194	96.77	63.91	1021
HSA-MIR-10396B-5P	94.99	63.57	358
HSA-MIR-1908-5P	94.99	63.41	352
HSA-MIR-663A	94.99	63.54	378
HSA-MIR-4706	89.76	60.23	156
HSA-MIR-3178	89.40	60.05	100
HSA-MIR-10394-3P	85.92	60.60	39

Literature-anchored findings (GeneRIF, showing 24)

• another histone deacetylase (PMID:11739383)
• molecular cloning and characterization of a novel class II histone deacetylase (PMID:11861901)
• Reduced expression of histone deacetylase 10 is associated lung cancer (PMID:15305372)
• Results suggest that the “T” allele of HDAC10-589C>T affect on the increased transcription activity, and might accelerate HCC development through increased expression of HDAC10. (PMID:17892858)
• Results not only show that HDAC10 regulates melanogenesis but also demonstrate that the transcriptional activities of Pax3 and KAP1 are intimately linked to their acetylation status. (PMID:20032463)
• HDAC10 is involved in transcriptional downregulation of TXNIP, leading to altered reactive oxygen species signaling in human gastric cancer cells. (PMID:20680488)
• Histone deacetylases 9 and 10 are required for homologous recombination. (PMID:21247901)
• results demonstrate that HDAC10 protects cancer cells from cytotoxic agents by mediating autophagy and identify this HDAC isozyme as a druggable regulator of advanced-stage tumor cell survival (PMID:23801752)
• HDAC10 suppresses expression of matrix metalloproteinase (MMP) 2 and 9 genes, which are known to be critical for cancer cell invasion and metastasis (PMID:23897811)
• this study is describing HDAC10 as a promoter of autophagy-mediated survival in neuroblastoma cells and identifying this HDAC isozyme as a druggable regulator of advanced-stage tumor cell survival. (PMID:24145760)
• Suggest HDAC10 expression as a prognostic marker for gastric cancer. (PMID:25337229)
• study identifies an HDAC10-mediated regulatory mechanism controlling the DNA mismatch repair function of MSH2. (PMID:26221039)
• HDAC10 regulates cyclin A2 expression by deacetylating histones near the let-7 promoter. (PMID:26240284)
• this study demonstrated that HDAC10 localizes and functions in the cytoplasm of lung cancer cells, thereby underscoring its potential role in the diagnosis and treatment of lung cancer (PMID:27449083)
• HDAC10 structure and molecular function as a polyamine deacetylase has been reported. (PMID:28516954)
• Authors show that depleting or inhibiting HDAC10 results in accumulation of lysosomes in chemotherapy-resistant neuroblastoma cell lines, as well as in the intracellular accumulation of the weakly basic chemotherapeutic doxorubicin within lysosomes. (PMID:29968769)
• The free modeled structure of HDAC10 and its complexes with quisinostat and the highest-ranked compound ZINC19749069 were submitted to molecular dynamics simulation. (PMID:30204052)
• HDAC10 upregulation contributed to IL-1beta-mediated inflammatory activation of SMSCs. (PMID:30515817)
• Histone deacetylase 10 knockout activates chaperone-mediated autophagy and accelerates the decomposition of its substrate. (PMID:31862140)
• Characterization of the Role of Host Cellular Factor Histone Deacetylase 10 during HIV-1 Replication. (PMID:31888084)
• Histone deacetylase 10 exerts antitumor effects on cervical cancer via a novel microRNA-223/TXNIP/Wnt/beta-catenin pathway. (PMID:33481334)
• Oncogenic miRNA-1908 targets HDAC10 and promotes the aggressive phenotype of cervical cancer cell. (PMID:33493381)
• Short communication: TNF-alpha and IGF-1 regulates epigenetic mechanisms of HDAC2 and HDAC10. (PMID:35143520)
• Knockdown of HDAC10 inhibits POLE2-mediated DNA damage repair in NSCLC cells by increasing SP1 acetylation levels. (PMID:37657752)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	hdac10	ENSDARG00000086458
mus_musculus	Hdac10	ENSMUSG00000062906
rattus_norvegicus	Hdac10	ENSRNOG00000031915
caenorhabditis_elegans		WBGENE00001838

Paralogs (10): HDAC9 (ENSG00000048052), HDAC7 (ENSG00000061273), HDAC4 (ENSG00000068024), HDAC6 (ENSG00000094631), HDAC5 (ENSG00000108840), HDAC1 (ENSG00000116478), HDAC8 (ENSG00000147099), HDAC11 (ENSG00000163517), HDAC3 (ENSG00000171720), HDAC2 (ENSG00000196591)

Protein

Protein identifiers

Polyamine deacetylase HDAC10 — Q969S8 (reviewed: Q969S8)

Alternative names: Histone deacetylase 10

All UniProt accessions (3): Q969S8, C9J8B8, Q08AP5

UniProt curated annotations — full annotation on UniProt →

Function. Polyamine deacetylase (PDAC), which acts preferentially on N(8)-acetylspermidine, and also on acetylcadaverine and acetylputrescine. Exhibits attenuated catalytic activity toward N(1),N(8)-diacetylspermidine and very low activity, if any, toward N(1)-acetylspermidine. Histone deacetylase activity has been observed in vitro. Has also been shown to be involved in MSH2 deacetylation. The physiological relevance of protein/histone deacetylase activity is unclear and could be very weak. May play a role in the promotion of late stages of autophagy, possibly autophagosome-lysosome fusion and/or lysosomal exocytosis in neuroblastoma cells. May play a role in homologous recombination. May promote DNA mismatch repair.

Subunit / interactions. Interacts with HDAC3. Interacts with HDAC2 and NCOR2/SMRT. Interacts with HSPA8/HSC70. Interacts with MSH2.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Widely expressed with high levels in liver and kidney.

Disease relevance. In neuroblastoma cells, may promote autophagy in response to chemotherapy-induced DNA damage and efflux of chemotherapeutics via lysosomal exocytosis, hence protecting cells from cytotoxic agents. Expression levels may correlate with survival in neuroblastoma patients, with low levels in the tumor correlating with long-term patient survival and high expression with poor prognosis. Therefore has been proposed as a biomarker to predict neuroblastoma chemoresistance and treatment outcome.

Miscellaneous. Like some other members of the HD type 2 subfamily, such as HDAC4, inhibited by the antitumor drug trichostatin A (TSA). May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Similarity. Belongs to the histone deacetylase family. HD type 2 subfamily.

Isoforms (4)

UniProt ID	Names	Canonical?
Q969S8-1	1, Alpha, HDAC10b, HDAC10v1	yes
Q969S8-2	2, Beta
Q969S8-4	4, A, HDAC10v2
Q969S8-5	5

RefSeq proteins (2): NP_001152758, NP_114408* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000286	HDACs	Family
IPR023696	Ureohydrolase_dom_sf	Homologous_superfamily
IPR023801	His_deacetylse_dom	Domain
IPR037138	His_deacetylse_dom_sf	Homologous_superfamily

Pfam: PF00850

Enzyme classification (BRENDA):

• EC 3.5.1.48 — acetylspermidine deacetylase (BRENDA: 5 organisms, 52 substrates, 134 inhibitors, 42 Km, 37 kcat entries)
• EC 3.5.1.98 — histone deacetylase (BRENDA: 33 organisms, 161 substrates, 590 inhibitors, 88 Km, 32 kcat entries)

Substrate kinetics (BRENDA)

44 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
N8-ACETYLSPERMIDINE	0.004–0.27	9
FLUOR DE LYS HDAC8 SUBSTRATE	0.14–1.1	9
7-(NALPHA-ACETYL-GLYCYL-L-ALANYL-NEPSILON-ACETYL	0.01–0.07	6
AC-KHK(ACETYL)K(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.273–2.403	6
FLUOR DE LYS HDAC SUBSTRATE	0.013–0.088	6
7-(NALPHA-ACETYL-L-ARGINYL-GLYCYL-NEPSILON-ACETY	0.066–0.15	5
ACETYLCADAVERINE	0.05–0.26	5
ACETYLPUTRESCINE	0.11–0.17	5
AC-FEK(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.0023–0.0359	5
AC-GGK(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.0043–0.0877	5
AC-GS(PO3)K(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.0123–0.0666	5
AC-GSK(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.004–0.0241	5
AC-IHK(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.0007–0.108	5
AC-KYK(ACETYL)-7-AMIDO-4-METHYLCOUMARIN	0.0044–0.107	4
FLUOR DE LYS	—	4

Catalyzed reactions (Rhea), 4 shown:

• N-acetylputrescine + H2O = putrescine + acetate (RHEA:23412)
• N(8)-acetylspermidine + H2O = spermidine + acetate (RHEA:23928)
• N-acetylcadaverine + H2O = cadaverine + acetate (RHEA:51892)
• N(6)-acetyl-L-lysyl-[protein] + H2O = L-lysyl-[protein] + acetate (RHEA:58108)

UniProt features (24 total): binding site 5, sequence conflict 5, splice variant 4, region of interest 2, chain 1, site 1, modified residue 1, sequence variant 1, mutagenesis site 1, short sequence motif 1, compositionally biased region 1, active site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q969S8-F1	90.57	0.79

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 272 (substrate specificity); 135 (proton donor/acceptor)

Ligand- & substrate-binding residues (5): 305; 20; 172; 174; 265

Post-translational modifications (1): 393

Mutagenesis-validated functional residues (1):

Position	Phenotype
135	abolishes deacetylase activity. does not affect interaction with hdac3. loss of autophagy regulation.

Function

Pathways and Gene Ontology

Reactome pathways

6 pathways

ID	Pathway
R-HSA-2122947	NOTCH1 Intracellular Domain Regulates Transcription
R-HSA-2644606	Constitutive Signaling by NOTCH1 PEST Domain Mutants
R-HSA-2894862	Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
R-HSA-3214815	HDACs deacetylate histones
R-HSA-350054	Notch-HLH transcription pathway
R-HSA-9976102	Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells)

MSigDB gene sets: 103 (showing top): GSE37336_LY6C_POS_VS_NEG_NAIVE_CD4_TCELL_DN, GSE45365_NK_CELL_VS_CD11B_DC_UP, PID_HDAC_CLASSI_PATHWAY, REACTOME_SIGNALING_BY_NOTCH, GOBP_MACROMOLECULE_DEACYLATION, GOBP_REGULATION_OF_DNA_REPAIR, GOBP_MACROAUTOPHAGY, NIKOLSKY_BREAST_CANCER_22Q13_AMPLICON, GOBP_POLYAMINE_METABOLIC_PROCESS, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, GOBP_DNA_DAMAGE_RESPONSE, GOBP_POSITIVE_REGULATION_OF_DNA_REPAIR, GOBP_REGULATION_OF_CELLULAR_RESPONSE_TO_STRESS, GOBP_MISMATCH_REPAIR, GOBP_CHROMATIN_REMODELING

GO Biological Process (14): negative regulation of transcription by RNA polymerase II (GO:0000122), DNA repair (GO:0006281), chromatin organization (GO:0006325), regulation of DNA-templated transcription (GO:0006355), macroautophagy (GO:0016236), positive regulation of mismatch repair (GO:0032425), homologous recombination (GO:0035825), negative regulation of DNA-templated transcription (GO:0045892), obsolete polyamine deacetylation (GO:0106047), obsolete spermidine deacetylation (GO:0106048), DNA recombination (GO:0006310), autophagy (GO:0006914), DNA damage response (GO:0006974), macromolecule deacylation (GO:0098732)

GO Molecular Function (11): histone deacetylase activity (GO:0004407), zinc ion binding (GO:0008270), deacetylase activity (GO:0019213), enzyme binding (GO:0019899), protein lysine deacetylase activity (GO:0033558), histone deacetylase binding (GO:0042826), acetylputrescine deacetylase activity (GO:0047609), acetylspermidine deacetylase activity (GO:0047611), protein binding (GO:0005515), hydrolase activity (GO:0016787), metal ion binding (GO:0046872)

GO Cellular Component (5): histone deacetylase complex (GO:0000118), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Signaling by NOTCH1	1
Signaling by NOTCH1 PEST Domain Mutants in Cancer	1
Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer	1
Chromatin modifying enzymes	1
Generic Transcription Pathway	1
Differentiation of T cells	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
deacetylase activity	3
cellular anatomical structure	3
DNA metabolic process	2
DNA-templated transcription	2
hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides	2
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
negative regulation of DNA-templated transcription	1
DNA damage response	1
cellular component organization	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
autophagosome assembly	1
autophagy	1
mismatch repair	1
regulation of mismatch repair	1
positive regulation of DNA repair	1
DNA recombination	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
catabolic process	1
transmembrane transport	1
process utilizing autophagic mechanism	1
cellular response to stress	1
macromolecule modification	1
protein lysine deacetylase activity	1
histone modifying activity	1
transition metal ion binding	1
deacylase activity	1
protein binding	1
catalytic activity, acting on a protein	1
enzyme binding	1
binding	1
catalytic activity	1
cation binding	1
nucleoplasm	1
nuclear protein-containing complex	1
catalytic complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1

Protein interactions and networks

STRING

2088 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HDAC10	NCOR2	Q9Y618	843
HDAC10	SIRT1	Q96EB6	676
HDAC10	KAT2A	Q92830	658
HDAC10	H4C7	Q99525	638
HDAC10	H4C16	P02304	636
HDAC10	SIRT2	Q8IXJ6	636
HDAC10	HDAC2	Q92769	634
HDAC10	SIRT7	Q9NRC8	625
HDAC10	SIRT4	Q9Y6E7	578
HDAC10	HDAC11	Q96DB2	575
HDAC10	SIRT5	Q9NXA8	571
HDAC10	SIRT6	Q8N6T7	570
HDAC10	TK2	O00142	547
HDAC10	MYC	P01106	546
HDAC10	SIRT3	Q9NTG7	541

IntAct

55 interactions, top by confidence:

A	B	Type	Score
HDAC10	APBB2	psi-mi:“MI:0915”(physical association)	0.560
HDAC10		psi-mi:“MI:0915”(physical association)	0.560
HDAC10	PMP22	psi-mi:“MI:0915”(physical association)	0.560
HDAC10	OPTN	psi-mi:“MI:0915”(physical association)	0.560
PEX26	HDAC10	psi-mi:“MI:0915”(physical association)	0.560
SNCA	HDAC10	psi-mi:“MI:0915”(physical association)	0.560
HTT	HDAC10	psi-mi:“MI:0915”(physical association)	0.560
ATXN3	HDAC10	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (58): HDAC10 (Affinity Capture-MS), PCBP3 (Affinity Capture-MS), LETMD1 (Affinity Capture-MS), NDUFB5 (Affinity Capture-MS), UQCRH (Affinity Capture-MS), ZFPL1 (Affinity Capture-MS), GNPAT (Affinity Capture-MS), EPHA4 (Affinity Capture-MS), SPG7 (Affinity Capture-MS), PI4K2B (Affinity Capture-MS), ABHD14A (Affinity Capture-MS), GPD2 (Affinity Capture-MS), HDAC10 (Two-hybrid), HDAC10 (Protein-peptide), HDAC10 (Affinity Capture-MS)

ESM2 similar proteins: A2AI05, D3ZDK7, E1BNQ4, O55240, O70249, P21139, P24298, P25409, P50336, P51175, P56602, P97849, Q03426, Q1JPJ0, Q27979, Q2KJF7, Q3T0A0, Q3ZKN0, Q498R1, Q4JIJ2, Q5E9M9, Q5E9T8, Q5R7A2, Q5RK23, Q60714, Q60HD5, Q6AYG0, Q6NRG5, Q6P1M0, Q6P3E7, Q6PCB7, Q6PFP6, Q7TSA0, Q8BNV1, Q8BZG5, Q8C1A3, Q8CHP8, Q8IXI1, Q8JZN7, Q8QZR5

Diamond homologs: A0A8I6GM68, D2HBJ8, F1QCV2, O17323, O27262, O30107, P28606, P38748, P53973, P56523, P56524, P72702, P83038, Q09440, Q0V9G5, Q20296, Q2QWU2, Q3JUN4, Q54QE6, Q569C4, Q57955, Q5A960, Q5R902, Q5XGZ2, Q613L4, Q6NTR6, Q6NZM9, Q6P3E7, Q6P9L4, Q70CQ1, Q70I53, Q7Z569, Q7ZUM8, Q80ZH1, Q8C2B3, Q8C2S0, Q8GXJ1, Q8LRK8, Q8RX28, Q8WUI4

SIGNOR signaling

6 interactions.

A	Effect	B	Mechanism
CUDC-907	down-regulates	HDAC10	“chemical inhibition”
3-[(dimethylamino)methyl]-N-[2-[4-[(hydroxyamino)-oxomethyl]phenoxy]ethyl]-2-benzofurancarboxamide	down-regulates	HDAC10	“chemical inhibition”
bufexamac	“down-regulates activity”	HDAC10	“chemical inhibition”
(S)-N-Hydroxy-4-(3-methyl-2-phenylbutanamido)benzamide	“down-regulates activity”	HDAC10	“chemical inhibition”
CUDC-101	“down-regulates activity”	HDAC10	“chemical inhibition”

Disease & clinical

Clinical variants and AI predictions

ClinVar

159 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	112
Likely benign	8
Benign	0

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
223119	Single allele	Pathogenic
2426562	NC_000022.10:g.(?50659287)(50697352_?)del	Pathogenic

SpliceAI

2883 predictions. Top by Δscore:

Variant	Effect	Δscore
22:50245671:TCACC:T	donor_loss	1.0000
22:50245672:CACCT:C	donor_loss	1.0000
22:50245825:GTT:G	acceptor_gain	1.0000
22:50245825:GTTC:G	acceptor_loss	1.0000
22:50245826:TT:T	acceptor_gain	1.0000
22:50245827:TC:T	acceptor_loss	1.0000
22:50245828:C:CC	acceptor_gain	1.0000
22:50245834:C:CT	acceptor_gain	1.0000
22:50245834:C:T	acceptor_gain	1.0000
22:50245835:A:T	acceptor_gain	1.0000
22:50245904:GCTTA:G	donor_loss	1.0000
22:50245905:CTTA:C	donor_loss	1.0000
22:50245906:TTACC:T	donor_loss	1.0000
22:50245907:TACC:T	donor_loss	1.0000
22:50245908:A:C	donor_loss	1.0000
22:50245909:C:G	donor_loss	1.0000
22:50246869:GCTTA:G	donor_loss	1.0000
22:50246870:CTTAC:C	donor_loss	1.0000
22:50246871:TTA:T	donor_loss	1.0000
22:50246872:TA:T	donor_loss	1.0000
22:50246874:C:CT	donor_loss	1.0000
22:50246874:CCT:C	donor_gain	1.0000
22:50246962:TTCAC:T	acceptor_gain	1.0000
22:50246963:TCAC:T	acceptor_gain	1.0000
22:50246964:CAC:C	acceptor_gain	1.0000
22:50246964:CACC:C	acceptor_gain	1.0000
22:50246965:AC:A	acceptor_gain	1.0000
22:50246966:CC:C	acceptor_gain	1.0000
22:50246967:C:CC	acceptor_gain	1.0000
22:50246968:T:A	acceptor_loss	1.0000

AlphaMissense

4257 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
22:50248855:A:C	F264L	0.992
22:50248855:A:T	F264L	0.992
22:50248857:A:G	F264L	0.992
22:50249336:A:G	W228R	0.992
22:50249336:A:T	W228R	0.992
22:50249683:T:A	D172V	0.992
22:50249922:G:C	F144L	0.992
22:50249922:G:T	F144L	0.992
22:50249924:A:G	F144L	0.992
22:50249343:G:C	N225K	0.991
22:50249343:G:T	N225K	0.991
22:50249435:G:C	H195D	0.991
22:50249687:A:G	W171R	0.991
22:50249687:A:T	W171R	0.991
22:50248888:A:C	F253L	0.990
22:50248888:A:T	F253L	0.990
22:50248890:A:G	F253L	0.990
22:50248853:T:A	D265V	0.989
22:50249412:G:C	F202L	0.989
22:50249412:G:T	F202L	0.989
22:50249414:A:G	F202L	0.989
22:50249682:A:C	D172E	0.984
22:50249682:A:T	D172E	0.984
22:50248722:G:C	F282L	0.983
22:50248722:G:T	F282L	0.983
22:50248724:A:G	F282L	0.983
22:50248852:G:C	D265E	0.983
22:50248852:G:T	D265E	0.983
22:50249910:G:C	N148K	0.983
22:50249910:G:T	N148K	0.983

dbSNP variants (sampled 300 via entrez): RS1000182798 (22:50247761 C>G,T), RS1000223681 (22:50244804 G>A), RS1000333177 (22:50252381 C>A), RS1000612242 (22:50251777 A>G), RS1001067669 (22:50251604 G>A,C), RS1001452828 (22:50252177 G>A,T), RS1001485241 (22:50247776 C>A), RS1001543055 (22:50249447 A>G), RS1001563613 (22:50245240 C>A,T), RS1001824376 (22:50250686 C>A,T), RS1001920771 (22:50251194 A>C), RS1001951598 (22:50246508 G>A,C), RS1002016040 (22:50245545 G>A,T), RS1002765535 (22:50245625 CGGCAGAGCCAGGCCCCAG>C,CGGCAGAGCCAGGCCCCAGGGCAGAGCCAGGCCCCAG), RS1003559464 (22:50246695 C>A,G)

Disease associations

OMIM: gene MIM:608544 | disease phenotypes:

GenCC curated gene-disease

Mondo (2): epilepsy (MONDO:0005027), autism spectrum disorder (MONDO:0005258)

Orphanet (1): NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST002481_12	Acne (severe)	4.000000e-06
GCST009733_128	Urinary metabolite levels in chronic kidney disease	1.000000e-24

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0005116	urinary metabolite measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D004827	Epilepsy	C10.228.140.490

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL2093865 (PROTEIN FAMILY), CHEMBL5103 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

30 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 469,436 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL118	CELECOXIB	4	112,844
CHEMBL1469	PHENYLBUTANOIC ACID	4	37,081
CHEMBL1746	SODIUM PHENYLBUTYRATE	4	5,577
CHEMBL343448	ROMIDEPSIN	4	12,963
CHEMBL408513	BELINOSTAT	4	7,765
CHEMBL483254	PANOBINOSTAT	4	11,666
CHEMBL98	VORINOSTAT	4	50,361
CHEMBL1213492	GIVINOSTAT	4	2,827
CHEMBL487253	BENDAMUSTINE	4	30,877
CHEMBL94394	BUFEXAMAC	4	6,619
CHEMBL140	CURCUMIN	3	93,882
CHEMBL145	CAFFEIC ACID	3	36,305
CHEMBL1851943	PRACINOSTAT	3	1,998
CHEMBL235191	TACEDINALINE	3	2,950
CHEMBL27759	ENTINOSTAT	3	6,584
CHEMBL3621988	TUCIDINOSTAT	3	2,182
CHEMBL2103863	ABEXINOSTAT	3	2,195
CHEMBL1801250	NANATINOSTAT	2	754
CHEMBL191482	AR-42	2	2,061
CHEMBL284616	CHLOROGENIC ACID	2	41,945
CHEMBL356066	DACINOSTAT	2
CHEMBL3622533	FIMEPINOSTAT	2
CHEMBL2105763	QUISINOSTAT	2
CHEMBL2364628	RICOLINOSTAT	2
CHEMBL4283683	DOMATINOSTAT	2
CHEMBL353581	PYROXAMIDE	1
CHEMBL598797	CUDC-101	1
CHEMBL609583	R-306465	1
CHEMBL96	GAMMA-AMINOBUTYRIC ACID	1
CHEMBL99	TRICHOSTATIN	1

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — 3.5.1.- Histone deacetylases (HDACs)

Most potent curated ligand interactions (9 total), top 9:

Ligand	Action	Affinity	Parameter
quisinostat	Inhibition	9.34	pIC50
fimepinostat	Inhibition	8.55	pIC50
CUDC-101	Inhibition	7.58	pIC50
BML-281	Inhibition	7.55	pIC50
pracinostat	Inhibition	7.4	pIC50
vorinostat	Inhibition	7.3	pKi
compound 30 [PMID: 37057760]	Inhibition	6.9	pIC50
KA1010	Inhibition	6.19	pIC50
bufexamac	Inhibition	4.91	pKd

Binding affinities (BindingDB)

35 measured of 42 human assays (42 total across all organisms); most potent 35 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
CHEBI:46024	IC50	4.9 nM
R-TSA	IC50	5.76 nM
3-[(dimethylamino)methyl]-N-{2-[4-(hydroxycarbamoyl)phenoxy]ethyl}-1-benzofuran-2-carboxamide	KI	7 nM
HDAC inhibitor, Compound 2	IC50	7.93 nM
HDAC inhibitor, Compound 1	IC50	10.1 nM
N-[3-(1-benzyl-1H-1,2,3-triazol-4-yl)phenyl]-N’-hydroxyoctanediamide	IC50	14.5 nM
N-(3-{1-[2-(3-bromophenyl)-2-hydroxyethyl]-1H-1,2,3-triazol-4-yl}phenyl)-N’-hydroxyoctanediamide	IC50	14.9 nM
Bendamustine	IC50	17 nM	US-9096627: Hydroxamic acid derivatives
N-(3-{1-[(4-fluorophenyl)methyl]-1H-1,2,3-triazol-4-yl}phenyl)-N’-hydroxyoctanediamide	IC50	17.6 nM
N-hydroxy-N’-[3-(1-phenyl-1H-1,2,3-triazol-4-yl)phenyl]octanediamide	IC50	18 nM
N-[3-(1-benzyl-1H-1,2,3-triazol-5-yl)phenyl]-N’-hydroxyoctanediamide	IC50	18.6 nM
(2E,4E,6R)-7-[4-(dimethylamino)phenyl]-N-hydroxy-4,6-dimethyl-7-oxohepta-2,4-dienamide	IC50	19 nM
N-(3-{1-[2-(3-bromophenyl)-2-hydroxyethyl]-1H-1,2,3-triazol-5-yl}phenyl)-N’-hydroxyoctanediamide	IC50	23.4 nM
N-(3-{1-[(4-fluorophenyl)methyl]-1H-1,2,3-triazol-5-yl}phenyl)-N’-hydroxyoctanediamide	IC50	25.9 nM
N-hydroxy-N’-[4-(1-phenyl-1H-1,2,3-triazol-4-yl)phenyl]octanediamide	IC50	27.1 nM
N-hydroxy-N’-[3-(1-phenyl-1H-1,2,3-triazol-5-yl)phenyl]octanediamide	IC50	33.4 nM
3-(furan-3-yl)-N-[[4-(hydroxycarbamoyl)phenyl]methyl]-5-(4-hydroxyphenyl)-1H-pyrrole-2-carboxamide	IC50	49.9 nM	US-8685992: Histone deacetylase inhibitors based simultaneously on trisubstituted 1H-pyrroles and aromatic and heteroaromatic spacers
N-(4-{1-[(4-fluorophenyl)methyl]-1H-1,2,3-triazol-5-yl}phenyl)-N’-hydroxyoctanediamide	IC50	52.4 nM
N-[4-(1-benzyl-1H-1,2,3-triazol-5-yl)phenyl]-N’-hydroxyoctanediamide	IC50	68.3 nM
N-(4-{1-[2-(3-bromophenyl)-2-hydroxyethyl]-1H-1,2,3-triazol-4-yl}phenyl)-N’-hydroxyoctanediamide	IC50	69.2 nM
N-(4-{1-[2-(3-bromophenyl)-2-hydroxyethyl]-1H-1,2,3-triazol-5-yl}phenyl)-N’-hydroxyoctanediamide	IC50	69.9 nM
N-hydroxy-N’-[4-(1-phenyl-1H-1,2,3-triazol-5-yl)phenyl]octanediamide	IC50	70.5 nM
N-[[4-[(2-aminophenyl)carbamoyl]phenyl]methyl]-3-(4-hydroxyphenyl)-5-thiophen-3-yl-1H-pyrrole-2-carboxamide	IC50	71 nM	US-8685992: Histone deacetylase inhibitors based simultaneously on trisubstituted 1H-pyrroles and aromatic and heteroaromatic spacers
N-hydroxy-7-[pyridin-2-yl(quinolin-2-yl)amino]heptanamide	IC50	71 nM	US-8748458: Scriptaid isosteres and their use in therapy
3-(4-methoxyphenyl)-5-phenyl-N-[[4-(2-sulfanylethylcarbamoyl)phenyl]methyl]-1H-pyrrole-2-carboxamide	IC50	84.2 nM	US-8685992: Histone deacetylase inhibitors based simultaneously on trisubstituted 1H-pyrroles and aromatic and heteroaromatic spacers
N-(4-{1-[(4-fluorophenyl)methyl]-1H-1,2,3-triazol-4-yl}phenyl)-N’-hydroxyoctanediamide	IC50	97.8 nM
N-[4-(1-benzyl-1H-1,2,3-triazol-4-yl)phenyl]-N’-hydroxyoctanediamide	IC50	113 nM
N-hydroxy-4-[(3-oxo-[1,2]thiazolo[5,4-b]pyridin-2-yl)methyl]benzamide	IC50	175 nM	US-10011611: Histone deacetylase inhibitors and methods for use thereof
N-[[4-[(2-aminophenyl)carbamoyl]phenyl]methyl]-3-(furan-3-yl)-5-(4-hydroxyphenyl)-1H-pyrrole-2-carboxamide	IC50	184 nM	US-8685992: Histone deacetylase inhibitors based simultaneously on trisubstituted 1H-pyrroles and aromatic and heteroaromatic spacers
S-TSA	IC50	206 nM
MS-275	IC50	243 nM
3-(4-fluorophenyl)-N-[[4-(hydroxycarbamoyl)phenyl]methyl]-5-pyridin-3-yl-1H-pyrrole-2-carboxamide	IC50	332 nM	US-8685992: Histone deacetylase inhibitors based simultaneously on trisubstituted 1H-pyrroles and aromatic and heteroaromatic spacers
Octanedioic acid adamantan-1-ylamide hydroxyamide	IC50	420 nM
N’-(2-aminophenyl)-N-(4-methylphenyl)heptanediamide	IC50	2000 nM	US-9265734: Compositions including 6-aminohexanoic acid derivatives as HDAC inhibitors
N-(4-{(2R,4R,6S)-4-{[(4,5-diphenyl-1,3-oxazol-2-yl)sulfanyl]methyl}-6-[4-(hydroxymethyl)phenyl]-1,3-dioxan-2-yl}phenyl)-N -hydroxyoctanediamide	IC50	16400 nM	US-9249087: HDAC inhibitors and therapeutic methods using the same

ChEMBL bioactivities

3623 potent at pChembl≥5 of 3968 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.30	Ki	0.05	nM	QUISINOSTAT
9.77	IC50	0.17	nM	CHEMBL5433552
9.70	IC50	0.2	nM	CHEMBL3329621
9.70	IC50	0.2	nM	CHEMBL2371007
9.70	IC50	0.2	nM	CHEMBL5395502
9.70	IC50	0.2	nM	CHEMBL1793811
9.70	IC50	0.2	nM	CHEMBL1793991
9.70	IC50	0.2	nM	CHEMBL1793985
9.52	IC50	0.3	nM	CHEMBL2370998
9.52	IC50	0.3	nM	CHEMBL5199116
9.52	IC50	0.3	nM	CHEMBL5170036
9.52	IC50	0.3	nM	CHEMBL1793822
9.46	IC50	0.35	nM	VORINOSTAT
9.40	IC50	0.4	nM	CHEMBL2371000
9.40	IC50	0.4	nM	CHEMBL1793816
9.34	IC50	0.46	nM	QUISINOSTAT
9.30	IC50	0.5	nM	LARGAZOLE THIOL
9.30	IC50	0.5	nM	CHEMBL3329622
9.30	IC50	0.5	nM	CHEMBL3593247
9.30	IC50	0.5	nM	QUISINOSTAT
9.24	IC50	0.58	nM	CHEMBL4532398
9.08	IC50	0.83	nM	PANOBINOSTAT
9.07	IC50	0.86	nM	CHEMBL3827517
9.05	IC50	0.9	nM	ROMIDEPSIN
9.05	IC50	0.9	nM	CHEMBL5618885
9.05	IC50	0.9	nM	FR-135313
9.05	IC50	0.9	nM	CHEMBL605110
9.02	IC50	0.95	nM	CHEMBL595479
9.00	IC50	1	nM	CHEMBL3356916
9.00	IC50	1	nM	CHEMBL3758184
9.00	IC50	1	nM	APICIDIN
9.00	IC50	1	nM	CHEMBL2371003
9.00	IC50	1	nM	ROMIDEPSIN
9.00	IC50	1	nM	CHEMBL4467135
9.00	IC50	1	nM	TRICHOSTATIN
9.00	IC50	1	nM	CHEMBL595711
9.00	IC50	1	nM	CHEMBL595910
9.00	IC50	1	nM	CHEMBL1793947
9.00	IC50	1	nM	CHEMBL1793810
9.00	IC50	1	nM	CHEMBL1793823
8.99	IC50	1.03	nM	CHEMBL1214760
8.98	IC50	1.05	nM	CHEMBL594544
8.92	Ki	1.2	nM	CHEMBL4237803
8.92	IC50	1.2	nM	CHEMBL604796
8.92	IC50	1.2	nM	CHEMBL608416
8.92	IC50	1.2	nM	CHEMBL594544
8.89	IC50	1.3	nM	CHEMBL1793992
8.85	IC50	1.4	nM	CHEMBL99661
8.85	IC50	1.42	nM	TRICHOSTATIN
8.85	IC50	1.43	nM	CHEMBL4552057

PubChem BioAssay actives

2666 with measured affinity, of 6100 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
N-hydroxy-2-[4-(4-methylphenyl)sulfonylpiperazin-1-yl]-1,3-thiazole-5-carboxamide	1941741: Inhibition of HDAC (unknown origin)	ic50	0.0001	uM
N-hydroxy-2-[4-[[(1-methylindol-3-yl)methylamino]methyl]piperidin-1-yl]pyrimidine-5-carboxamide	1236451: Inhibition of human HDAC10	ki	0.0001	uM
(5R,8S,11S)-5-methyl-11-[(E)-4-[[(E)-4-[(5R,8S,11S)-5-methyl-6,9,13-trioxo-8-propan-2-yl-10-oxa-3,17-dithia-7,14,19,20-tetrazatricyclo[14.2.1.12,5]icosa-1(18),2(20),16(19)-trien-11-yl]but-3-enyl]disulfanyl]but-1-enyl]-8-propan-2-yl-10-oxa-3,17-dithia-7,14,19,20-tetrazatricyclo[14.2.1.12,5]icosa-1(18),2(20),16(19)-triene-6,9,13-trione	1188985: Inhibition of HDAC10 (unknown origin) incubated for 30 mins in presence of BSA and DTT by fluorescence assay	ic50	0.0002	uM
7-[4-[[4-[3-(tert-butylsulfamoyl)anilino]-5-methylpyrimidin-2-yl]amino]-2-fluorophenoxy]-N-hydroxyheptanamide	2031064: Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis	ic50	0.0002	uM
7-[4-[[4-[3-(tert-butylsulfamoyl)anilino]-5-methylpyrimidin-2-yl]amino]phenoxy]-N-hydroxyheptanamide	2031064: Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis	ic50	0.0002	uM
(9S,12R)-3-[(2S)-butan-2-yl]-9-(6-hydroxy-5-oxoheptyl)-6-[(1-methoxyindol-3-yl)methyl]-1,4,7,10-tetrazabicyclo[10.4.0]hexadecane-2,5,8,11-tetrone	1847765: Inhibition of HDAC (unknown origin)	ic50	0.0003	uM
(9S,12R)-3-[(2S)-butan-2-yl]-6-(1H-indol-3-ylmethyl)-9-(5-oxoheptyl)-1,4,7,10-tetrazabicyclo[10.4.0]hexadecane-2,5,8,11-tetrone	1847765: Inhibition of HDAC (unknown origin)	ic50	0.0003	uM
(3S,6S,9S,12R)-3-[(2S)-butan-2-yl]-9-(7-hydroxy-6-oxooctyl)-6-[(1-methoxyindol-3-yl)methyl]-1,4,7,10-tetrazabicyclo[10.4.0]hexadecane-2,5,8,11-tetrone	90356: Inhibitory concentration against human Histone deacetylase in Hela cells	ic50	0.0003	uM
Vorinostat	2031064: Inhibition of HDAC in human HeLa cells nuclear extract incubated for 30 mins by multiplate reader analysis	ic50	0.0003	uM
tert-butyl (2R)-2-[(2-methylpropan-2-yl)oxycarbonylamino]-3-[[(E)-4-[(5R,8S,11S)-5-methyl-6,9,13-trioxo-8-propan-2-yl-10-oxa-3,17-dithia-7,14,19,20-tetrazatricyclo[14.2.1.12,5]icosa-1(18),2(20),16(19)-trien-11-yl]but-3-enyl]disulfanyl]propanoate	1188985: Inhibition of HDAC10 (unknown origin) incubated for 30 mins in presence of BSA and DTT by fluorescence assay	ic50	0.0005	uM
(5R,8S,11S)-5-methyl-8-propan-2-yl-11-[(E)-4-sulfanylbut-1-enyl]-10-oxa-3,17-dithia-7,14,19,20-tetrazatricyclo[14.2.1.12,5]icosa-1(18),2(20),16(19)-triene-6,9,13-trione	1466462: Inhibition of N-terminal GST-tagged/C-terminal His-tagged human HDAC10 (1 to 481 residues) expressed in baculovirus infected Sf9 insect cells using BPS HDAC substrate 3 after 30 mins by fluorescence assay	ic50	0.0005	uM
(2R)-N-[4-[1-[7-(hydroxyamino)-7-oxoheptyl]-4-morpholin-4-ylpyrazolo[5,4-d]pyrimidin-6-yl]phenyl]-2-methylmorpholine-4-carboxamide	1614131: Inhibition of recombinant full length N-terminal FLAG-tagged human HDAC10 expressed in baculovirus infected sf9 cells using Ac-peptide-AMC as substrate preincubated for 15 mins followed by substrate addition and measured after 1 hr by fluorescence assay	ic50	0.0006	uM
N-hydroxy-2-[methyl-[(9-methyl-6-morpholin-4-yl-2-pyridin-4-ylpurin-8-yl)methyl]amino]pyrimidine-5-carboxamide	1312860: Inhibition of human recombinant HDAC10 expressed in baculovirus infected insect Sf9 cells using Ac-peptide-AMC as substrate assessed as release of AMC preincubated for 15 mins followed by substrate addition measured after 1 hr by fluorescence assay	ic50	0.0009	uM
N-hydroxy-2-[4-[(E)-1-hydroxy-4-(4-phenylphenyl)but-3-en-2-yl]piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0009	uM
N-hydroxy-2-[4-[(E)-1-hydroxy-4-(4-methoxyphenyl)but-3-en-2-yl]piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0009	uM
N-hydroxy-2-[4-[(E)-1-hydroxy-4-phenylbut-3-en-2-yl]piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0010	uM
2-[4-[(E)-4-(4-fluorophenyl)-1-hydroxybut-3-en-2-yl]piperazin-1-yl]-N-hydroxypyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0010	uM
(3S,6R,9S,12R)-3-[(2S)-butan-2-yl]-6-[(1-methoxyindol-2-yl)methyl]-9-(6-oxooctyl)-1,4,10-triazabicyclo[10.4.0]hexadecane-2,5,8,11-tetrone	1622995: Inhibition of HDAC (unknown origin)	ic50	0.0010	uM
N-hydroxy-6-[(2S,5S,8S,11S)-8-(1H-indol-3-ylmethyl)-2-methyl-11-(2-methylpropyl)-3,6,9,13-tetraoxo-1,4,7,10-tetrazacyclotridec-5-yl]hexanamide	447991: Inhibition of HDAC in human HeLa cell nuclear extract after 30 mins by fluorimetric assay	ic50	0.0010	uM
(2E,4E,6R)-7-[4-(dimethylamino)phenyl]-N-hydroxy-4,6-dimethyl-7-oxohepta-2,4-dienamide	2022342: Inhibition of recombinant full-length human HDAC10 using FITC-H3K27(Ac)-NH2 as substrate by electrophoretic mobility shift assay	ic50	0.0010	uM
N-hydroxy-2-[4-[(E)-1-hydroxy-4-(4-methylphenyl)but-3-en-2-yl]piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0010	uM
6-[(5S,8S,11R)-11-[(2S)-butan-2-yl]-8-(1H-indol-2-ylmethyl)-3,6,9,13-tetraoxo-1,4,7,10-tetrazacyclotridec-5-yl]-N-hydroxyhexanamide	487230: Inhibition of HDAC in human HeLa cells	ic50	0.0010	uM
7-[4-[4-[[[(2S,3R,4S,6R)-2-[[(2R,4R,5R,6R,8R,11R,12S,19R,20R)-11-ethyl-4-methoxy-2,4,6,8,12,19-hexamethyl-7,9,14-trioxo-10,13-dioxa-15,18-diazatricyclo[10.6.2.015,20]icos-1(18)-en-5-yl]oxy]-3-hydroxy-6-methyloxan-4-yl]-methylamino]methyl]phenyl]triazol-1-yl]-N-hydroxyheptanamide	499799: Inhibition of HDAC in human HeLa cell nuclear extracts	ic50	0.0010	uM
(E)-N-hydroxy-3-[4-oxo-1’-(2-phenylethyl)spiro[3H-chromene-2,3’-piperidine]-6-yl]prop-2-enamide	1273866: Inhibition of HDAC in human HeLa cells nuclear extract using Fluor de lys as substrate after 15 mins by fluorometric analysis	ic50	0.0010	uM
N-hydroxy-6-[[2-(4-methoxyanilino)-3,4-dioxocyclobuten-1-yl]amino]hexanamide	1399823: Inhibition of human recombinant HDAC10 using fluorogenic HDAC substrate after 45 mins by fluorimetrc method	ki	0.0012	uM
2-[4-[(E)-4-(3-fluorophenyl)-1-hydroxybut-3-en-2-yl]piperazin-1-yl]-N-hydroxypyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0012	uM
2-[4-[(E)-4-(4-chlorophenyl)-1-hydroxybut-3-en-2-yl]piperazin-1-yl]-N-hydroxypyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0012	uM
7-[6-(4-aminophenyl)-4-morpholin-4-ylpyrazolo[5,4-d]pyrimidin-1-yl]-N-hydroxyheptanamide	1614131: Inhibition of recombinant full length N-terminal FLAG-tagged human HDAC10 expressed in baculovirus infected sf9 cells using Ac-peptide-AMC as substrate preincubated for 15 mins followed by substrate addition and measured after 1 hr by fluorescence assay	ic50	0.0014	uM
N’-hydroxy-N-[(2R)-4-(methylamino)-3-oxo-1-phenylbutan-2-yl]octanediamide	90195: Concentration required to inhibit Histone Deacetylase (HDAC) from K562 erythroleukemia cells	ic50	0.0014	uM
N-hydroxy-2-[4-(naphthalen-2-ylmethyl)piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0015	uM
N-hydroxy-2-[4-[(E)-1-methoxy-4-phenylbut-3-en-2-yl]piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0015	uM
N-hydroxy-2-[4-[[[(E)-1-hydroxy-4-phenylbut-3-en-2-yl]amino]methyl]piperidin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0015	uM
N-hydroxy-2-[4-[(E)-4-phenylbut-3-en-2-yl]piperazin-1-yl]pyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0017	uM
7-[2-(6-amino-3-pyridinyl)-6-morpholin-4-ylpurin-9-yl]-N-hydroxyheptanamide	1702069: Inhibition of N-terminal FLAG-tagged human HDAC10 (2 to 631 residues) expressed in baculovirus infected Sf9 cells using fluorogenic HDAC substrate 3 measured after 30 mins by fluorescence based assay	ic50	0.0017	uM
N-hydroxy-6-[4-(6-methoxynaphthalen-2-yl)triazol-1-yl]hexanamide	382342: Inhibition of human HDAC in HeLa cells by flour de lys assay	ic50	0.0018	uM
N-hydroxy-6-[4-(3-phenylphenyl)triazol-1-yl]hexanamide	382342: Inhibition of human HDAC in HeLa cells by flour de lys assay	ic50	0.0019	uM
2-[2-[2-[[(2E)-3-(3-bromo-4-hydroxyphenyl)-2-hydroxyiminopropanoyl]amino]ethyldisulfanyl]ethylamino]-2-oxoacetic acid	90530: Inhibitory concentration against isolated Histone deacetylase	ic50	0.0020	uM
(3S,6S,9S,12R)-3-[(2S)-butan-2-yl]-6-(1H-indol-3-ylmethyl)-9-(6-oxooctyl)-1,4,7,10-tetrazabicyclo[10.4.0]hexadecane-2,5,8,11-tetrone	81887: Inhibitory activity against histone deacetylase (HDAC) enzyme derived from partially purified extracts of human HeLa cells using [3H]11 as radioligand	ic50	0.0020	uM
(2R)-1-methyl-N-[(2S)-1-(3-methylanilino)-1-oxo-7-sulfanylheptan-2-yl]-5-oxopyrrolidine-2-carboxamide	1164785: Inhibition of HDAC10 (unknown origin) using fluorogenic tetrapeptide RHKK(Ac) substrate by fluorescence assay	ic50	0.0020	uM
6-[4-[[5-chloro-4-(4-chloroanilino)pyrimidin-2-yl]amino]pyrazol-1-yl]-N-hydroxyhexanamide	1550094: Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay	ic50	0.0020	uM
5-cyclopropyl-N-[(1S)-1-[4-(hydroxycarbamoyl)phenyl]ethyl]-2-(5-phenyl-1,3-thiazol-2-yl)-1,3-thiazole-4-carboxamide	1559814: Inhibition of recombinant human His6/GST-tagged HDAC10 expressed in baculovirus infected High5 insect cells using Ac-Lys-Tyr-Lys(epsilon-acetyl)-AMC as susbtrate after 24 hrs by fluorescence based assay	ic50	0.0020	uM
7-[4-[[5-chloro-4-(4-chloroanilino)pyrimidin-2-yl]amino]pyrazol-1-yl]-N-hydroxyheptanamide	1550094: Inhibition of HDAC in human HeLa nuclear extract using Boc-Lys(acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition and measured after 30 mins by fluorescence assay	ic50	0.0020	uM
4-[(E)-3-[[(2S)-1-(4-bromoanilino)-3-(1H-indol-3-yl)-1-oxopropan-2-yl]amino]-3-oxoprop-1-enyl]-N-hydroxybenzamide	1390020: Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence assay	ic50	0.0020	uM
4-[(E)-3-[[(2S)-1-(4-fluoroanilino)-3-(1H-indol-3-yl)-1-oxopropan-2-yl]amino]-3-oxoprop-1-enyl]-N-hydroxybenzamide	1390020: Inhibition of HDAC in human HeLa cell nuclear extract using Boc-Lys (acetyl)-AMC as substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by fluorescence assay	ic50	0.0020	uM
2-(6-ethoxy-3-pyridinyl)-N-[7-(hydroxyamino)-7-oxoheptyl]-9-(2-methoxy-3-pyridinyl)-8-oxo-7H-purine-6-carboxamide	2079009: Inhibition of HDAC in human HeLa cells nuclear extract	ic50	0.0020	uM
2-[4-[(E)-4-(2-fluorophenyl)-1-hydroxybut-3-en-2-yl]piperazin-1-yl]-N-hydroxypyrimidine-5-carboxamide	454842: Inhibition of HDAC in human HeLa cells extractt	ic50	0.0020	uM
N-hydroxy-7-[5-(4-methoxyphenyl)-1,3-oxazol-2-yl]heptanamide	316872: Inhibition of HDAC from human K562 cells	ic50	0.0021	uM
ethyl N-[3-[2-[[7-(hydroxyamino)-7-oxoheptanoyl]amino]-1,3-thiazol-4-yl]phenyl]carbamate	1602231: Inhibition of HDAC10 (unknown origin) using (FAM)-labeled acetylated peptide as substrate measured after 17 hrs by fluorescence assay	ic50	0.0021	uM
N-hydroxy-6-[4-(4-methoxyphenyl)triazol-1-yl]hexanamide	382342: Inhibition of human HDAC in HeLa cells by flour de lys assay	ic50	0.0021	uM
tert-butyl (8R,9R,12S)-12-[[6-(hydroxyamino)-6-oxohexyl]carbamoyl]-9-(2-methylpropyl)-2-oxa-11-azabicyclo[12.2.2]octadeca-1(16),14,17-triene-8-carboxylate	90195: Concentration required to inhibit Histone Deacetylase (HDAC) from K562 erythroleukemia cells	ic50	0.0021	uM

CTD chemical–gene interactions

29 total (human), top 29 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases abundance, increases expression	2
bisphenol S	decreases expression, decreases methylation, affects cotreatment	2
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression, affects cotreatment	1
potassium perchlorate	decreases expression	1
titanium dioxide	increases expression	1
beta-lapachone	decreases expression, increases expression	1
butyraldehyde	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
(+)-JQ1 compound	decreases expression	1
Bortezomib	decreases expression	1
Sunitinib	decreases expression	1
Air Pollutants	affects expression, increases abundance	1
Arsenic	increases abundance, increases expression	1
Benzo(a)pyrene	increases methylation	1
Dexamethasone	affects cotreatment, decreases expression	1
Diethylstilbestrol	decreases expression	1
Indomethacin	decreases expression, affects cotreatment	1
Lead	decreases expression	1
Methotrexate	decreases expression	1
Ozone	affects expression, increases abundance	1
Polychlorinated Biphenyls	affects expression	1
Rotenone	increases expression	1
Smoke	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Triclosan	increases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	1
Okadaic Acid	decreases expression	1

ChEMBL screening assays

1643 unique, capped per target: 1630 binding, 8 admet, 4 functional, 1 toxicity

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1003756	Binding	Inhibition of HDAC in human NB4 cells assessed as induction of histone H3 acetylation after 6 hrs by Western blot analysis	Design, synthesis and preliminary biological evaluation of new hydroxamate histone deacetylase inhibitors as potential antileukemic agents. — Bioorg Med Chem Lett
CHEMBL4346553	ADMET	Inhibition of HDAC in HUVEC using Boc-Lys(Ac)-AMC as substrate preincubated for 12 hrs followed by substrate addition and measured after 4 hrs by fluorimetry	Discovery of Novel Fungal Lanosterol 14α-Demethylase (CYP51)/Histone Deacetylase Dual Inhibitors to Treat Azole-Resistant Candidiasis. — J Med Chem
CHEMBL5049470	Functional	In vivo inhibition of HDAC in HEL cells xenografted in BALB/C mouse assessed as upregulation of caspase-9 levels at 5 to 10 mg/kg by immunohistochemical staining method	Evodiamine-Inspired Topoisomerase-Histone Deacetylase Dual Inhibitors: Novel Orally Active Antitumor Agents for Leukemia Therapy. — J Med Chem

Cellosaurus cell lines

6 cell lines: 6 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1N0	Abcam K-562 HDAC10 KO	Cancer cell line	Female
CVCL_D2JK	Abcam Raji HDAC10 KO	Cancer cell line	Male
CVCL_SR02	HAP1 HDAC10 (-) 1	Cancer cell line	Male
CVCL_SR03	HAP1 HDAC10 (-) 2	Cancer cell line	Male
CVCL_UQ67	Abcam Jurkat HDAC10 KO	Cancer cell line	Male
CVCL_W922	THJ-29T	Cancer cell line	Female

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00004637	PHASE4	COMPLETED	Double-Blind, Placebo-Controlled Trial of Vitamin E as Add-on Therapy for Children With Epilepsy
NCT00043914	PHASE4	COMPLETED	Measurement Of Serum Levels Of Two Antiepileptic Drugs During Conversion In Patients With Epilepsy
NCT00132223	PHASE4	UNKNOWN	Effects on the Diagnostic Accuracy of Magnetic Imaging Angiographies of the Supra-Aortic Vessels by Three Different Magnetic Resonance Contrast Agents in Patients
NCT00133081	PHASE4	UNKNOWN	Study to Improve the Treatment of Epilepsy (SITE)
NCT00137709	PHASE4	UNKNOWN	Hormone Profiles in Adults With Newly Diagnosed Epilepsy
NCT00154076	PHASE4	COMPLETED	A Multicenter Comparative Trial of Zonisamide and Topiramate as Initial Monotherapy in Untreated Epilepsies
NCT00165828	PHASE4	TERMINATED	Efficacy and Safety of an add-on Treatment With Zonisamide in Adults With Focal Epileptic Seizures With or Without Secondary Generalization
NCT00181116	PHASE4	COMPLETED	Levetiracetam for Benign Rolandic Epilepsy
NCT00207935	PHASE4	COMPLETED	Use of Sustained Release Antiepileptic Medication (Depakote® ER) for Pediatric Epilepsy in a Mental Retardation/Developmental Disorder Population
NCT00215592	PHASE4	COMPLETED	Open Label, Zonegran (Zonisamide) In Partial Onset Seizures
NCT00266604	PHASE4	COMPLETED	A Study to Evaluate the Dosing, Effectiveness and Safety of Topiramate for the Treatment of Epilepsy
NCT00288639	PHASE4	COMPLETED	Lyrica (Pregabalin) Administered as an Add-on Therapy for Partial Seizures (LEADER).
NCT00312676	PHASE4	UNKNOWN	Compare Tolerability of an Overnight Switch to Gradual Switch Between Two Different Forms of Depakote
NCT00323947	PHASE4	COMPLETED	Methylphenidate for Treating Attention Deficit Hyperactivity Disorder in Children With Both ADHD and Epilepsy
NCT00385411	PHASE4	COMPLETED	Study of Valproate in Young Patients Suffering From Epilepsy
NCT00522418	PHASE4	TERMINATED	Study Comparing Best Medical Practice With or Without VNS Therapy in Pharmacoresistant Partial Epilepsy Patients
NCT00537940	PHASE4	COMPLETED	Comparative Study Of Pregabalin And Gabapentin As Adjunctive Therapy In Subjects With Partial Seizures
NCT00552526	PHASE4	UNKNOWN	Ketogenic Diet vs.Antiepileptic Drug Treatment in Drug Resistant Epilepsy
NCT00564915	PHASE4	COMPLETED	RCT of the Efficacy of the Ketogenic Diet in the Treatment of Epilepsy
NCT00571155	PHASE4	COMPLETED	Trial of Levetiracetam in Patients With Primary Brain Tumors and Symptomatic Seizures Who Undergo Surgery
NCT00572195	PHASE4	COMPLETED	RNS® System LTT Study
NCT00610532	PHASE4	TERMINATED	Evaluating the Transporter Protein Inhibitor Probenecid In Patients With Epilepsy
NCT00630357	PHASE4	COMPLETED	Trial to Evaluate the Safety and Efficacy of Keppra After Conversion to Mono-therapy in Subjects With Partial Epilepsy
NCT00630630	PHASE4	COMPLETED	Study on Safety and Efficacy of Levetiracetam in the Adjunctive Treatment of Female Subjects With C1 Catamenial Epilepsy
NCT00630968	PHASE4	COMPLETED	S.K.A.T.E.: Safety of Keppra as Adjunctive Therapy in Epilepsy
NCT00631150	PHASE4	COMPLETED	A Phase IV-Pharmacovigilance Study of Keppra Greece - S.K.A.T.E.: Safety of Keppra as Adjunctive Therapy in Epilepsy
NCT00659958	PHASE4	COMPLETED	ZAGAL Study: Evaluating Effectiveness and Tolerability of Zonisamide as Adjunctive Therapy in Patients With Partial Onset Seizures Treated With Two Antiepileptic Drugs
NCT00713622	PHASE4	COMPLETED	Comparing The Effect On Cognition Of Adjunctive Therapy With Zonisamide Versus Sodium Valproate
NCT00807989	PHASE4	COMPLETED	The Efficacy and Safety of Low Dose Combination of LTG and VPA Compared to CBZ Monotherapy
NCT00832884	PHASE4	COMPLETED	The Safety of Intravenous Lacosamide
NCT00869622	PHASE4	COMPLETED	Antiepileptic Drugs and Osteoporotic Prevention Trial
NCT00896987	PHASE4	COMPLETED	Lamotrigine Cognitive Function Study in Adult Untreated Epilepsies
NCT00952081	PHASE4	COMPLETED	A Pilot Study to Evaluate Efficacy and Safety of Clevidipine in Neurosurgical Patients
NCT01118455	PHASE4	TERMINATED	Trial to Assess Vagus Nerve Stimulation Therapy vs. Anti-Epileptic Drug (AED) Treatment in Children With Refractory Seizures
NCT01127165	PHASE4	COMPLETED	Low and High Dose Zonisamide in Children as Monotherapy
NCT01127256	PHASE4	COMPLETED	Comparative Study of Zonisamide and Carbamazepine as an Initial Monotherapy: Efficacy and Safety Evaluation
NCT01140867	PHASE4	COMPLETED	Open-label, Multi-center Trial of Zonisamide as Adjunctive Therapy in Patients With Uncontrolled Partial Epilepsy
NCT01175954	PHASE4	COMPLETED	Cognitive and Behavioral Effects of Lacosamide
NCT01229735	PHASE4	COMPLETED	Levetiracetam Versus Topiramate as Adjunctive Therapy to Evaluate Efficacy and Safety in Subjects With Refractory Partial Onset Seizures
NCT01244724	PHASE4	TERMINATED	Lexapro for Major Depression in Patients With Epilepsy