HES1

Summary

HES1 (hes family bHLH transcription factor 1, HGNC:5192) is a protein-coding gene on chromosome 3q29, encoding Transcription factor HES-1 (Q14469). Transcriptional repressor of genes that require a bHLH protein for their transcription.

This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box.

Source: NCBI Gene 3280 — RefSeq curated summary.

At a glance

• GWAS associations: 5
• Clinical variants (ClinVar): 33 total
• Druggable target: yes
• Transcription factor: yes — 99 downstream targets (CollecTRI)
• MANE Select transcript: NM_005524

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:5192
Approved symbol	HES1
Name	hes family bHLH transcription factor 1
Location	3q29
Locus type	gene with protein product
Status	Approved
Aliases	FLJ20408, HES-1, bHLHb39
Ensembl gene	ENSG00000114315
Ensembl biotype	protein_coding
OMIM	139605
Entrez	3280

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 5 protein_coding, 1 retained_intron

ENST00000232424, ENST00000476918, ENST00000909759, ENST00000909760, ENST00000909761, ENST00000913418

RefSeq mRNA: 1 — MANE Select: NM_005524 NM_005524

CCDS: CCDS3305

Canonical transcript exons

ENST00000232424 — 4 exons

Exon	Start	End
ENSE00000781704	194136617	194136712
ENSE00001143632	194136148	194136488
ENSE00001190561	194137683	194138732
ENSE00001649673	194136961	194137048

Expression profiles

Bgee: expression breadth ubiquitous, 290 present calls, max score 99.49.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 60.0250 / max 1101.3866, expressed in 1628 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
40634	59.7471	1628
40635	0.2780	141

Top tissues by expression

296 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
renal medulla	UBERON:0000362	99.49	gold quality
ventricular zone	UBERON:0003053	99.40	gold quality
nipple	UBERON:0002030	99.30	gold quality
pharyngeal mucosa	UBERON:0000355	99.15	gold quality
lower esophagus mucosa	UBERON:0035834	99.08	gold quality
urethra	UBERON:0000057	98.69	gold quality
saphenous vein	UBERON:0007318	98.45	gold quality
pylorus	UBERON:0001166	98.40	gold quality
pericardium	UBERON:0002407	98.31	gold quality
vena cava	UBERON:0004087	98.07	gold quality
body of tongue	UBERON:0011876	98.02	gold quality
cervix squamous epithelium	UBERON:0006922	97.89	gold quality
seminal vesicle	UBERON:0000998	97.84	gold quality
skin of leg	UBERON:0001511	97.84	gold quality
penis	UBERON:0000989	97.49	gold quality
skin of abdomen	UBERON:0001416	97.41	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	97.39	gold quality
pigmented layer of retina	UBERON:0001782	97.26	gold quality
retina	UBERON:0000966	97.24	gold quality
right lobe of thyroid gland	UBERON:0001119	97.14	gold quality
left lobe of thyroid gland	UBERON:0001120	97.04	gold quality
tongue	UBERON:0001723	97.03	gold quality
trachea	UBERON:0003126	97.01	gold quality
zone of skin	UBERON:0000014	96.95	gold quality
ganglionic eminence	UBERON:0004023	96.91	gold quality
esophagus mucosa	UBERON:0002469	96.81	gold quality
synovial joint	UBERON:0002217	96.77	gold quality
minor salivary gland	UBERON:0001830	96.70	gold quality
thyroid gland	UBERON:0002046	96.54	gold quality
mouth mucosa	UBERON:0003729	96.33	gold quality

Single-cell (SCXA)

Detected in 23 experiment(s), a significant marker in 20.

Experiment	Marker?	Max mean expression
E-CURD-114	yes	710.19
E-MTAB-8894	yes	669.81
E-GEOD-98556	yes	284.15
E-GEOD-75140	yes	133.38
E-MTAB-10287	yes	80.77
E-GEOD-93593	yes	75.94
E-MTAB-10553	yes	50.05
E-HCAD-5	yes	42.38
E-GEOD-134144	yes	34.97
E-GEOD-137537	yes	34.22
E-MTAB-7316	yes	31.48
E-MTAB-6701	yes	29.04
E-ANND-3	yes	24.99
E-GEOD-84465	yes	22.23
E-GEOD-135922	yes	22.20

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

99 targets.

Target	Regulation
ADAMTS5	Activation
AKT1
ALDH2
ASCL1	Repression
ASCL2	Repression
ATOH1	Repression
BBC3	Repression
BCL2
BGLAP
BNIP3	Repression
CBLN4	Activation
CCNE1	Repression
CD3E
CD4	Repression
CD44
CD8A
CDKN1A	Unknown
CDKN1B	Repression
CDKN1C	Unknown
CFD
CKM
COL1A1	Unknown
COL1A2	Unknown
COL2A1	Repression
CRABP1	Activation
CTNND2	Repression
CXCL2	Repression
DBF4	Activation
DDR1
DLL1	Repression

JASPAR motifs

Motif	Name	Family
MA1099.2	HES1	Hairy-related factors
MA1099.3	HES1	Hairy-related factors

JASPAR matrix evidence (PMIDs): PMID:15870295

Upstream regulators (CollecTRI, top): AR, ASCL1, ATF2, CCNC, CCNT1, CDK8, CDK9, CREB1, CTNNB1, DLL4, EGR1, ESR1, FOXC1, FOXG1, GLI1, GLI2, HDAC1, HES1, HES3, HEY1, HEY2, HEYL, HIF1A, ID1, ID2, ID3, IKBKB, IKZF1, JUN, LMO3, LMX1A, LMX1B, MAML1, MAML2, MYC, MYT1L, NANOG, NCOR1, NEUROD1, NEUROG2

miRNA regulators (miRDB)

41 targeting HES1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-12133	99.92	71.82	2006
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-1271-5P	99.91	71.99	1972
HSA-MIR-374A-5P	99.90	71.34	2923
HSA-MIR-374B-5P	99.90	69.98	2734
HSA-MIR-182-5P	99.87	74.03	2589
HSA-MIR-369-3P	99.85	70.52	2264
HSA-MIR-374C-5P	99.80	72.06	2910
HSA-MIR-655-3P	99.80	72.19	2909
HSA-MIR-3150A-3P	99.76	64.44	1640
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-4517	99.76	69.19	1867
HSA-MIR-1283	99.69	72.42	3009
HSA-MIR-7152-5P	99.60	69.33	2094
HSA-MIR-208B-5P	99.42	70.83	1952
HSA-MIR-372-5P	99.41	69.11	2299
HSA-MIR-323B-3P	99.14	68.89	725

Literature-anchored findings (GeneRIF, showing 40)

• acid alpha-glucosidase gene is a novel target of the Notch-1/Hes-1 signaling pathway (PMID:12065598)
• HES-1 preserves the long-term reconstituting hematopoietic activity of 34-KSL stem cells ex vivo. (PMID:12406868)
• These results indicate that the molecular association between HES1-, HEY2- and SIRT1-related proteins is conserved among metazoans, from Drosophila to human, and suggest that the Sir2-bHLH interaction also plays important roles in human cells. (PMID:12535671)
• Hes1 transcription repression activity is inhibited by Hes6. (PMID:12972610)
• the estrogen receptor and AhR signaling pathways regulate HES-1, but with opposing effects, suggests the existence of a new pathway by which AhR represses E2-signaling. (PMID:14722248)
• HES-1 inhibits both estrogen- and heregulin-beta1-stimulated growth of breast cancer cells (PMID:15467735)
• IkappaBalpha is recruited to the promoter regions of the Notch-target gene, hes1 (PMID:15536134)
• Notch1 inhibits the development of erythroid/megakaryocytic cells by suppressing GATA-1 activity through HES1 (PMID:15563463)
• For marking and purifying neural stem cells to ascertain whether differences exist, we generated transgenic mice using promoters from Hes genes (pHes1 or pHes5) to drive expression of destabilized enhanced green fluorescent protein. (PMID:16214363)
• HES-1 is an upstream negative regulator of REST expression. (PMID:16253247)
• HES-1 alone is not able to substitute for Notch-1 signaling to induce T-cell differentiation of human CD34+ hematopoietic stem cells. (PMID:16322473)
• Notch protein binding to Hes5-GFP is extinguished fast and recovered slowly, whereas Hes1-GFP is inhibited late and recovered quickly (PMID:16365048)
• Expression of HES1 increased significantly during chondrogenesis in chondrocytes while expression in mesenchymal stem cells was maintained at a low level. (PMID:17072841)
• Increased expression of Notch3, Jagged1, Hes1, and Hes6 gene transcripts were observed during differentiation of cultured human skeletal muscle cells. (PMID:17301032)
• expression significantly higher in squamous cervical carcinoma than in CIN as well as higher in CIN than normal cervical epithelia (PMID:17388915)
• Overexpression of hes1 is associated with breast cancer (PMID:17822320)
• Notch-mediated Hes1 expression contributes to the maintenance of the proliferative crypt compartment of the small intestine by transcriptionally repressing two CDK inhibitors. (PMID:18274550)
• lack of nuclear expression of HES1 may contribute to the abundance of ASCL1 and to tumorigenesis in the endocrine pancreas. (PMID:18491256)
• regulates brain development process.[review] (PMID:18524252)
• HES1 interaction with Fanconi anemia (FA) core complex members is dependent on a functional FA pathway. Cells depleted of HES1 exhibit an FA-like phenotype. (PMID:18550849)
• Inhibition of HES-1 expression using shRNA resulted in significantly reduced pancreatic beta-cell replication and dedifferentiation (PMID:18599525)
• it is concluded that HES1 safeguards against irreversible cell cycle exit both during normal cellular quiescence and pathologically in the setting of tumorigenesis (PMID:18719287)
• These findings are consistent with a novel type of repressive estrogen response element in the distal 3’ region of the HES-1 gene. (PMID:19039095)
• The Notch signaling mediator, Hes1, potently suppressed V2 promoter activity through interaction with two Hes sites within the V2 exon. (PMID:19116245)
• ChIP-on-chip data reveal 3 oncogenic transcription factors, NOTCH1, MYC, and HES1, bind to several thousand target gene promoters (PMID:19118200)
• FA core complex interferes with HES1 binding to the co-repressor transducin-like-Enhancer of Split, suggesting that the core complex affects transcription both directly and indirectly. (PMID:19321451)
• we showed that SOX9 binding to the HES-1 enhancer was induced by retinoic acid (PMID:19322650)
• Hes1 protein expression was also found elevated in immune thrombocytopenic purpura and Hes1 of ITP was found expressed higher in cellular nucleus than that of controls. (PMID:19603167)
• Notch1 signaling pathway was activated in laryngeal carcinoma accompanied with up-regulation of Notch1 and Hes1 expression (PMID:19724860)
• This study first reports HES1-dependent SRC/STAT3 pathway that provides a functional link between Notch signaling and hypoxia pathway. (PMID:19808903)
• Hes1 is a key molecule in blast crisis transition in CML. (PMID:19861684)
• Hyperactivation of BRAF-MEK signaling activates MAP2 expression in melanoma cells by two independent mechanisms, promoter demethylation or down-regulation of neuronal transcription repressor HES1. (PMID:19880519)
• Expression of Hes-6 resulted in induction of E2F-1, a crucial target gene for the transcriptional repressor Hes-1. (PMID:19891787)
• Data show that inhibition of Hes1 activity can promote insulin expression and glucose responsiveness in gall bladder epithelial cells. (PMID:19935883)
• HES1 repressed gene expression in part by recruiting histone deacetylases in tumor cells.[Review] (PMID:20022559)
• The expression of HES1 is increased in advanced ovarian serous adenocarcinomas, and HES1 high-expression probably is a potential poor prognostic factor for the patients. (PMID:20091184)
• data suggest IkappaBalpha regulates Hes1-mediated activity in osteoclast differentiation and resorption, which supports a cross-talk between NF-kappaB and Notch in osteoclast activity (PMID:20515776)
• Combining Hes1 knockout studies and ptf1a-Cre-mediated lineage tracing showed that the inactivation of Hes1 induced the misexpression of ptf1a in discrete regions of the primitive stomach and duodenum, as well as the common bile duct. (PMID:20668890)
• Data show that HES-1 Orange domain is well folded in all conditions, forms stable dimers, and greatly increases protein resistance to thermal denaturation. (PMID:20816878)
• Hes1, a canonical Notch target and transcriptional repressor, is responsible for sustaining IKK activation in T-ALL. Hes1 exerts its effects by repressing the deubiquitinase CYLD, a negative IKK complex regulator. (PMID:20832754)

Cross-species orthologs

12 orthologs

Organism	Symbol	Gene ID
danio_rerio	her6	ENSDARG00000006514
mus_musculus	Hes1	ENSMUSG00000022528
rattus_norvegicus	Hes1	ENSRNOG00000001720
drosophila_melanogaster	E(spl)m8-HLH	FBGN0000591
drosophila_melanogaster	E(spl)m3-HLH	FBGN0002609
drosophila_melanogaster	E(spl)m5-HLH	FBGN0002631
drosophila_melanogaster	E(spl)m7-HLH	FBGN0002633
drosophila_melanogaster	E(spl)mbeta-HLH	FBGN0002733
drosophila_melanogaster	E(spl)mdelta-HLH	FBGN0002734
drosophila_melanogaster	E(spl)mgamma-HLH	FBGN0002735
drosophila_melanogaster	Hesr	FBGN0030899
drosophila_melanogaster	cwo	FBGN0259938

Paralogs (12): HES2 (ENSG00000069812), BHLHE41 (ENSG00000123095), BHLHE40 (ENSG00000134107), HEY2 (ENSG00000135547), HES6 (ENSG00000144485), HEYL (ENSG00000163909), HEY1 (ENSG00000164683), HES3 (ENSG00000173673), HES7 (ENSG00000179111), HELT (ENSG00000187821), HES4 (ENSG00000188290), HES5 (ENSG00000197921)

Protein

Protein identifiers

Transcription factor HES-1 — Q14469 (reviewed: Q14469)

Alternative names: Class B basic helix-loop-helix protein 39, Hairy and enhancer of split 1, Hairy homolog, Hairy-like protein

All UniProt accessions (1): Q14469

UniProt curated annotations — full annotation on UniProt →

Function. Transcriptional repressor of genes that require a bHLH protein for their transcription. May act as a negative regulator of myogenesis by inhibiting the functions of MYOD1 and ASH1. Binds DNA on N-box motifs: 5’-CACNAG-3’ with high affinity and on E-box motifs: 5’-CANNTG-3’ with low affinity. May play a role in a functional FA core complex response to DNA cross-link damage, being required for the stability and nuclear localization of FA core complex proteins, as well as for FANCD2 monoubiquitination in response to DNA damage.

Subunit / interactions. Transcription repression requires formation of a complex with a corepressor protein of the Groucho/TLE family. Interacts (via WPRW motif) with TLE1, and more weakly with TLE2. Interacts with HES6. Interacts with SIRT1. Interacts with an FA complex, composed of FANCA, FANCF, FANCG and FANCL, but not of FANCC, nor FANCE.

Subcellular location. Nucleus.

Post-translational modifications. (Microbial infection) Ubiquitinated via human cytomegalovirus/HCMV protein IE1 that assembles a HES1 ubiquitination complex; leading to HES1 proteasomal degradation.

Domain organisation. Has a particular type of basic domain (presence of a helix-interrupting proline) that binds to the N-box (CACNAG), rather than the canonical E-box (CANNTG). The C-terminal WRPW motif is a transcriptional repression domain necessary for the interaction with Groucho/TLE family members, transcriptional corepressors recruited to specific target DNA by Hairy-related proteins. The bHLH, as well as cooperation between the central Orange domain and the C-terminal WRPW motif, is required for transcriptional repressor activity.

RefSeq proteins (1): NP_005515* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003650	Orange_dom	Domain
IPR011598	bHLH_dom	Domain
IPR036638	HLH_DNA-bd_sf	Homologous_superfamily
IPR050370	HES_HEY	Family

Pfam: PF00010, PF07527

UniProt features (18 total): compositionally biased region 5, helix 5, region of interest 3, domain 2, chain 1, strand 1, short sequence motif 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
2MH3	SOLUTION NMR
7C4O	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q14469-F1	70.11	0.28

Function

Pathways and Gene Ontology

Reactome pathways

9 pathways

ID	Pathway
R-HSA-210744	Regulation of gene expression in late stage (branching morphogenesis) pancreatic bud precursor cells
R-HSA-2122947	NOTCH1 Intracellular Domain Regulates Transcription
R-HSA-2197563	NOTCH2 intracellular domain regulates transcription
R-HSA-2644606	Constitutive Signaling by NOTCH1 PEST Domain Mutants
R-HSA-2894862	Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
R-HSA-8940973	RUNX2 regulates osteoblast differentiation
R-HSA-8941856	RUNX3 regulates NOTCH signaling
R-HSA-9013508	NOTCH3 Intracellular Domain Regulates Transcription
R-HSA-9013695	NOTCH4 Intracellular Domain Regulates Transcription

MSigDB gene sets: 740 (showing top): PID_FANCONI_PATHWAY, GSE45365_NK_CELL_VS_BCELL_DN, GOBP_CARDIAC_CHAMBER_DEVELOPMENT, AHRARNT_01, GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_REGULATION_OF_CELL_ACTIVATION, FXR_IR1_Q6, GOBP_METANEPHRIC_NEPHRON_MORPHOGENESIS, GOBP_LABYRINTHINE_LAYER_DEVELOPMENT, GOBP_HINDBRAIN_DEVELOPMENT, GOBP_HEMATOPOIETIC_PROGENITOR_CELL_DIFFERENTIATION, REACTOME_SIGNALING_BY_NOTCH, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, GOBP_HEPATICOBILIARY_SYSTEM_DEVELOPMENT

GO Biological Process (115): negative regulation of transcription by RNA polymerase II (GO:0000122), cell fate determination (GO:0001709), liver development (GO:0001889), embryonic heart tube morphogenesis (GO:0003143), outflow tract morphogenesis (GO:0003151), regulation of secondary heart field cardioblast proliferation (GO:0003266), ventricular septum development (GO:0003281), pancreatic A cell differentiation (GO:0003310), regulation of transcription by RNA polymerase II (GO:0006357), cell adhesion (GO:0007155), Notch signaling pathway (GO:0007219), smoothened signaling pathway (GO:0007224), nervous system development (GO:0007399), positive regulation of cell population proliferation (GO:0008284), response to virus (GO:0009615), anterior/posterior pattern specification (GO:0009952), positive regulation of gene expression (GO:0010628), negative regulation of gene expression (GO:0010629), negative regulation of neuron projection development (GO:0010977), cell migration (GO:0016477), telencephalon development (GO:0021537), midbrain-hindbrain boundary morphogenesis (GO:0021555), oculomotor nerve development (GO:0021557), trochlear nerve development (GO:0021558), hindbrain morphogenesis (GO:0021575), forebrain radial glial cell differentiation (GO:0021861), Cajal-Retzius cell differentiation (GO:0021870), adenohypophysis development (GO:0021984), lung development (GO:0030324), BMP signaling pathway (GO:0030509), positive regulation of BMP signaling pathway (GO:0030513), midbrain development (GO:0030901), somatic stem cell population maintenance (GO:0035019), amacrine cell differentiation (GO:0035881), ascending aorta morphogenesis (GO:0035910), T cell proliferation (GO:0042098), positive regulation of T cell proliferation (GO:0042102), inner ear auditory receptor cell differentiation (GO:0042491), positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531), regulation of protein-containing complex assembly (GO:0043254)

GO Molecular Function (20): DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), transcription corepressor binding (GO:0001222), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), DNA binding (GO:0003677), chromatin binding (GO:0003682), JUN kinase binding (GO:0008432), protein homodimerization activity (GO:0042803), histone deacetylase binding (GO:0042826), HLH domain binding (GO:0043398), sequence-specific DNA binding (GO:0043565), protein-containing complex binding (GO:0044877), protein-folding chaperone binding (GO:0051087), RNA polymerase II-specific DNA-binding transcription factor binding (GO:0061629), E-box binding (GO:0070888), N-box binding (GO:0071820), sequence-specific double-stranded DNA binding (GO:1990837), DNA-binding transcription repressor activity (GO:0001217), protein binding (GO:0005515), identical protein binding (GO:0042802), protein dimerization activity (GO:0046983)

GO Cellular Component (6): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), nuclear matrix (GO:0016363), protein-containing complex (GO:0032991)

Reactome top-level categories

Rollup of top-9 pathways:

Category	Pathways
Regulation of beta-cell development	1
Signaling by NOTCH1	1
Signaling by NOTCH2	1
Signaling by NOTCH1 PEST Domain Mutants in Cancer	1
Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer	1
RUNX2 regulates bone development	1
Transcriptional regulation by RUNX3	1
Signaling by NOTCH3	1
Signaling by NOTCH4	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
binding	3
protein binding	3
regulation of transcription by RNA polymerase II	2
transcription by RNA polymerase II	2
negative regulation of DNA-templated transcription	2
heart morphogenesis	2
cell surface receptor signaling pathway	2
gene expression	2
regulation of gene expression	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
DNA-binding transcription factor activity	2
RNA polymerase II cis-regulatory region sequence-specific DNA binding	2
nuclear lumen	2
cell fate commitment	1
cellular developmental process	1
gland development	1
hepaticobiliary system development	1
embryonic heart tube development	1
embryonic organ morphogenesis	1
embryonic morphogenesis	1
epithelial tube morphogenesis	1
anatomical structure morphogenesis	1
regulation of cardioblast proliferation	1
cardiac ventricle development	1
cardiac septum development	1
endocrine pancreas development	1
enteroendocrine cell differentiation	1
regulation of DNA-templated transcription	1
cellular process	1
system development	1
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
response to other organism	1
regionalization	1
positive regulation of macromolecule biosynthetic process	1
negative regulation of macromolecule biosynthetic process	1
regulation of neuron projection development	1
neuron projection development	1

Protein interactions and networks

STRING

994 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HES1	NOTCH1	P46531	725
HES1	MGAM	O43451	720
HES1	SI	P14410	719
HES1	NEUROG3	Q9Y4Z2	717
HES1	PTF1A	Q7RTS3	715
HES1	JAG1	P78504	685
HES1	NOTCH2	Q04721	628
HES1	RBPJ	Q06330	625
HES1	ATOH1	Q92858	625
HES1	YY1	P25490	612
HES1	DLL1	O00548	609
HES1	NOTCH3	Q9UM47	599
HES1	GAA	P10253	580
HES1	JAG2	Q9Y219	579
HES1	ASCL1	P50553	568

IntAct

27 interactions, top by confidence:

A	B	Type	Score
HES6	TLE1	psi-mi:“MI:0914”(association)	0.550
HES1	SIRT1	psi-mi:“MI:0915”(physical association)	0.540
SIRT1	HES1	psi-mi:“MI:0407”(direct interaction)	0.540
HES1	SIRT1	psi-mi:“MI:0407”(direct interaction)	0.540
HES6	TLE4	psi-mi:“MI:0914”(association)	0.530
ASGR2	HES1	psi-mi:“MI:0915”(physical association)	0.370
HES1	LTBR	psi-mi:“MI:0915”(physical association)	0.370
HES1	APH1A	psi-mi:“MI:0915”(physical association)	0.370
HES1	APCS	psi-mi:“MI:0915”(physical association)	0.370
CSNK1E	HES1	psi-mi:“MI:0915”(physical association)	0.370
HES1	FHL1	psi-mi:“MI:0915”(physical association)	0.370
GAPDH	HES1	psi-mi:“MI:0915”(physical association)	0.370
HDAC6	HES1	psi-mi:“MI:0915”(physical association)	0.370
HMGCL	HES1	psi-mi:“MI:0915”(physical association)	0.370
NR4A1	HES1	psi-mi:“MI:0915”(physical association)	0.370
NUDT3	HES1	psi-mi:“MI:0915”(physical association)	0.370
HES1	PTK2	psi-mi:“MI:0915”(physical association)	0.370
HES1	YWHAB	psi-mi:“MI:0915”(physical association)	0.370
TLE1	TBX1	psi-mi:“MI:0914”(association)	0.350
HEY1	MYCBP2	psi-mi:“MI:0914”(association)	0.350
HES6	RGPD3	psi-mi:“MI:0914”(association)	0.350
TLE1	PCBP3	psi-mi:“MI:0914”(association)	0.350
HEY1	A2ML1	psi-mi:“MI:0914”(association)	0.350
moeA2	HES1	psi-mi:“MI:0915”(physical association)	0.000
	HES1	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (104): HES1 (Affinity Capture-MS), FANCE (Affinity Capture-Western), TLE1 (Affinity Capture-Western), FANCG (Affinity Capture-Western), FANCF (Affinity Capture-Western), FANCA (Affinity Capture-Western), HES1 (Affinity Capture-Western), FANCE (Affinity Capture-Western), HES1 (Affinity Capture-Western), HES1 (Reconstituted Complex), HES1 (Reconstituted Complex), HES1 (Affinity Capture-Western), UL123 (Affinity Capture-Western), HES1 (Reconstituted Complex), UL123 (Reconstituted Complex)

ESM2 similar proteins: A5PJV0, A7YY73, F1QW76, O15525, O43150, O54790, O54791, O57337, O60675, P13096, P13097, P13098, P35428, P50538, P97496, Q01068, Q01069, Q01070, Q01071, Q01664, Q04666, Q05195, Q07291, Q07E41, Q108T9, Q14469, Q14582, Q16206, Q16520, Q3ZBG4, Q5FWS6, Q5PPM5, Q61827, Q674X7, Q6IRB2, Q6PBD4, Q76MX4, Q7Z3E5, Q8AVU4, Q8BHR2

Diamond homologs: A0MLS5, A6NFD8, O00327, O14503, O35779, O54792, O57337, O61734, O88529, P13097, P14003, P29303, P35428, P35429, P70120, Q00P32, Q01069, Q03062, Q04666, Q14469, Q26263, Q28HA8, Q2KIN4, Q2NL18, Q3ZBG4, Q5PPM5, Q5R4T2, Q5RAI7, Q5TA89, Q66KK8, Q6IRB2, Q6PBD4, Q6QB00, Q6YGZ5, Q7KM13, Q7TS99, Q8AVU4, Q8AXV5, Q8AXV6, Q8BKT2

SIGNOR signaling

46 interactions.

A	Effect	B	Mechanism
CCNC	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
CCNT1	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
CDK8	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
CDK9	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
HES1	down-regulates	RBPJ	binding
HES1	“down-regulates quantity by repression”	DTX1	“transcriptional regulation”
NOTCH3	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
NOTCH1	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
HES1	“down-regulates quantity by repression”	E2F1	“transcriptional regulation”
RBPJ/NOTCH	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
HES1	“down-regulates quantity by repression”	NR3C1	“transcriptional regulation”
NfKb-p65/p50	“up-regulates quantity”	HES1	“transcriptional regulation”
HES1	“down-regulates activity”	NR3C1
GATA6	“up-regulates quantity by expression”	HES1
HES1	“down-regulates quantity by repression”	PPARG	“transcriptional regulation”
IKBKB	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
IKK-complex	“up-regulates quantity by expression”	HES1
TNF	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
HES1	“down-regulates quantity by repression”	ASCL1	“transcriptional regulation”
LMO3	“down-regulates quantity by repression”	HES1	“transcriptional regulation”
NHLH2	“down-regulates quantity by repression”	HES1	“transcriptional regulation”
HES1	“down-regulates quantity by repression”	PTGDS	“transcriptional regulation”
NOTCH	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
GNAO1	down-regulates	HES1
ALK	“up-regulates activity”	HES1	phosphorylation
RBPJ	“up-regulates quantity by expression”	HES1	binding
MAML2	“up-regulates quantity by expression”	HES1	“transcriptional regulation”
HES1	“down-regulates activity”	RBPJ/NOTCH	binding
HES1	“down-regulates quantity by repression”	MYOD1	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

33 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	28
Likely benign	1
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

1810 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:194136623:A:G	K39E	1.000
3:194136624:A:T	K39M	1.000
3:194136625:G:C	K39N	1.000
3:194136625:G:T	K39N	1.000
3:194136635:G:A	E43K	1.000
3:194136636:A:T	E43V	1.000
3:194136637:G:C	E43D	1.000
3:194136637:G:T	E43D	1.000
3:194136638:A:G	K44E	1.000
3:194136639:A:T	K44I	1.000
3:194136640:A:C	K44N	1.000
3:194136640:A:T	K44N	1.000
3:194136643:A:C	R45S	1.000
3:194136643:A:T	R45S	1.000
3:194136644:C:G	R46G	1.000
3:194136645:G:C	R46P	1.000
3:194136647:A:G	R47G	1.000
3:194136648:G:C	R47T	1.000
3:194136648:G:T	R47I	1.000
3:194136649:A:C	R47S	1.000
3:194136649:A:T	R47S	1.000
3:194136650:G:C	A48P	1.000
3:194136654:G:C	R49T	1.000
3:194136654:G:T	R49I	1.000
3:194136655:A:C	R49S	1.000
3:194136655:A:T	R49S	1.000
3:194136657:T:A	I50K	1.000
3:194136657:T:C	I50T	1.000
3:194136659:A:G	N51D	1.000
3:194136661:T:A	N51K	1.000

dbSNP variants (sampled 300 via entrez): RS1001457073 (3:194135022 G>A,C,T), RS1001888324 (3:194134901 C>A,T), RS1002143313 (3:194138897 C>G,T), RS1002257985 (3:194139102 A>G), RS1002483272 (3:194134283 CCGGCGG>C,CCGG,CCGGCGGCGG,CCGGCGGCGGCGG), RS1002695833 (3:194135033 G>A), RS1003531879 (3:194136220 G>A,C), RS1003904946 (3:194137156 T>A,C), RS1004770100 (3:194134997 G>C), RS1004822562 (3:194134854 C>G,T), RS1005959024 (3:194139051 G>A,T), RS1006823683 (3:194137087 C>G,T), RS1007042618 (3:194138620 G>A,C,T), RS1007627360 (3:194137969 CGCGGCGCCCCCTCCCG>C,CGCGGCGCCCCCTCCCGGCGGCGCCCCCTCCCG), RS1008447423 (3:194138588 TAAAAG>T)

Disease associations

OMIM: gene MIM:139605 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST004860_110	Alcoholic chronic pancreatitis	5.000000e-06
GCST006899_10	Thyroid stimulating hormone levels	4.000000e-15
GCST009267_23	Dental caries (decayed, missing and filled teeth)	2.000000e-07
GCST009268_8	Dental caries (decayed, missing and filled tooth surfaces)	2.000000e-06
GCST010653_17	Thyroid stimulating hormone levels	9.000000e-26

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL3734643 (SINGLE PROTEIN), CHEMBL3885567 (PROTEIN-PROTEIN INTERACTION)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

132 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
MRK 003	decreases expression, increases response to substance, affects binding, decreases reaction	8
sodium arsenite	increases abundance, increases expression, affects expression, decreases expression, affects cotreatment	6
Benzo(a)pyrene	decreases methylation, increases expression	6
Tetrachlorodibenzodioxin	affects expression, increases expression	6
Valproic Acid	affects cotreatment, increases expression, decreases expression, decreases reaction, increases methylation	6
N-(N-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester	decreases reaction, increases expression, decreases expression	4
Arsenic Trioxide	decreases reaction, increases expression, decreases expression	4
Cisplatin	increases expression, affects reaction, decreases expression, increases reaction	4
Estradiol	affects cotreatment, decreases expression	4
Hydrogen Peroxide	decreases reaction, increases expression, affects expression	4
Tretinoin	decreases expression, increases expression	4
Cadmium Chloride	increases abundance, increases expression	4
Resveratrol	decreases expression	3
Formaldehyde	increases expression	3
N-((3,5-difluorophenyl)acetyl)alanyl-2-phenylglycine-1,1-dimethylethyl ester	affects expression, decreases reaction, decreases expression	2
methylmercuric chloride	increases expression	2
hydroxyhydroquinone	increases expression	2
arsenite	decreases expression, decreases reaction, affects binding, increases reaction	2
diallyl trisulfide	decreases expression	2
polyhexamethyleneguanidine	increases expression	2
Acetaminophen	decreases expression, increases expression	2
Glyphosate	increases expression	2
Arsenic	affects expression, affects cotreatment, decreases expression, increases abundance	2
Cadmium	increases abundance, increases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Quercetin	increases expression, decreases reaction	2
Testosterone	affects cotreatment, increases expression, decreases expression	2
Cyclosporine	decreases expression, increases expression	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
Vitamin K 3	decreases reaction, increases expression, affects expression	2

ChEMBL screening assays

3 unique, capped per target: 3 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3739210	Binding	Inhibition of Cy3-tagged human recombinant full length HES1 (1 to 280 amino acid residues)/Cy3-GST-tagged human recombinant full length HES1 (1 to 280 amino acid residues) dimer formation expressed in Escherichia coli JM109 after 1 hr by mi	Naturally occurring FANCFHes1 complex inhibitors from Wrightia religiosa — Medchemcomm

Cellosaurus cell lines

11 cell lines: 6 cancer cell line, 4 embryonic stem cell, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A2N4	SEES3-1V human HES1, clone1	Embryonic stem cell	Male
CVCL_A2N5	SEES3-1V human HES1, clone2	Embryonic stem cell	Male
CVCL_A2N6	SEES3-1V human HES1, clone3	Embryonic stem cell	Male
CVCL_B0ZX	Abcam MCF-7 HES1 KO	Cancer cell line	Female
CVCL_B1TK	Abcam HeLa HES1 KO	Cancer cell line	Female
CVCL_D0JW	NERCe003-A-5	Embryonic stem cell	Male
CVCL_D7R7	Ubigene A-549 HES1 KO	Cancer cell line	Male
CVCL_D8MC	Ubigene HCT 116 HES1 KO	Cancer cell line	Male
CVCL_D9G5	Ubigene HEK293 HES1 KO	Transformed cell line	Female
CVCL_E0E8	Ubigene HeLa HES1 KO	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.