HEXA

Summary

HEXA (hexosaminidase subunit alpha, HGNC:4878) is a protein-coding gene on chromosome 15q23, encoding Beta-hexosaminidase subunit alpha (P06865). Hydrolyzes the non-reducing end N-acetyl-D-hexosamine and/or sulfated N-acetyl-D-hexosamine of glycoconjugates, such as the oligosaccharide moieties from proteins and neutral glycolipids, or from certain mucopolysaccharides.

This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mutations in this gene lead to an accumulation of GM2 ganglioside in neurons, the underlying cause of neurodegenerative disorders termed the GM2 gangliosidoses, including Tay-Sachs disease (GM2-gangliosidosis type I). Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.

Source: NCBI Gene 3073 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Tay-Sachs disease (Definitive, ClinGen)
• Clinical variants (ClinVar): 1,367 total — 140 pathogenic, 132 likely-pathogenic
• Phenotypes (HPO): 16
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_000520

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4878
Approved symbol	HEXA
Name	hexosaminidase subunit alpha
Location	15q23
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000213614
Ensembl biotype	protein_coding
OMIM	606869
Entrez	3073

Gene structure

Transcript identifiers

Ensembl transcripts: 65 — 29 nonsense_mediated_decay, 22 protein_coding, 13 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000268097, ENST00000563762, ENST00000563908, ENST00000564677, ENST00000565873, ENST00000566304, ENST00000566672, ENST00000567027, ENST00000567159, ENST00000567213, ENST00000567411, ENST00000568260, ENST00000568777, ENST00000569116, ENST00000569410, ENST00000569509, ENST00000682061, ENST00000682064, ENST00000682177, ENST00000682235, ENST00000682461, ENST00000682653, ENST00000682657, ENST00000682721, ENST00000682843, ENST00000683003, ENST00000683133, ENST00000683228, ENST00000683243, ENST00000683463, ENST00000683548, ENST00000683579, ENST00000683587, ENST00000683681, ENST00000683735, ENST00000683742, ENST00000683853, ENST00000683860, ENST00000683884, ENST00000684041, ENST00000684125, ENST00000684203, ENST00000684231, ENST00000684263, ENST00000684305, ENST00000684415, ENST00000684520, ENST00000684602, ENST00000684667, ENST00000861840, ENST00000861841, ENST00000861842, ENST00000861843, ENST00000861844, ENST00000861845, ENST00000861846, ENST00000861847, ENST00000861848, ENST00000912240, ENST00000912241, ENST00000966314, ENST00000966315, ENST00000966316, ENST00000966317, ENST00000966318

RefSeq mRNA: 2 — MANE Select: NM_000520 NM_000520, NM_001318825

CCDS: CCDS10243, CCDS81905

Canonical transcript exons

ENST00000268097 — 14 exons

Exon	Start	End
ENSE00001826978	72340924	72344140
ENSE00001945618	72375720	72376014
ENSE00003470243	72345446	72345550
ENSE00003483570	72353068	72353178
ENSE00003508810	72351133	72351234
ENSE00003515498	72350518	72350650
ENSE00003584439	72346527	72346710
ENSE00003624488	72348048	72348134
ENSE00003626088	72356525	72356617
ENSE00003634214	72349079	72349259
ENSE00003637756	72346235	72346325
ENSE00003647001	72353691	72353737
ENSE00003678923	72355559	72355624
ENSE00003685445	72347686	72347758

Expression profiles

Bgee: expression breadth ubiquitous, 293 present calls, max score 98.17.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 62.2297 / max 548.1761, expressed in 1821 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
150829	57.8531	1821
150833	2.1472	363
150834	1.7015	643
150832	0.4077	165
150831	0.1202	51

Top tissues by expression

300 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
type B pancreatic cell	CL:0000169	98.17	gold quality
gall bladder	UBERON:0002110	98.13	gold quality
stromal cell of endometrium	CL:0002255	98.11	gold quality
right adrenal gland cortex	UBERON:0035827	97.66	gold quality
left lobe of thyroid gland	UBERON:0001120	97.60	gold quality
metanephros cortex	UBERON:0010533	97.54	gold quality
right coronary artery	UBERON:0001625	97.52	gold quality
right adrenal gland	UBERON:0001233	97.48	gold quality
granulocyte	CL:0000094	97.45	gold quality
right lobe of thyroid gland	UBERON:0001119	97.43	gold quality
left adrenal gland	UBERON:0001234	97.39	gold quality
tendon of biceps brachii	UBERON:0008188	97.29	gold quality
left adrenal gland cortex	UBERON:0035825	97.28	gold quality
descending thoracic aorta	UBERON:0002345	97.22	gold quality
right uterine tube	UBERON:0001302	97.14	gold quality
thyroid gland	UBERON:0002046	97.12	gold quality
right lung	UBERON:0002167	97.03	gold quality
rectum	UBERON:0001052	96.97	gold quality
adrenal cortex	UBERON:0001235	96.94	gold quality
spleen	UBERON:0002106	96.76	gold quality
upper lobe of left lung	UBERON:0008952	96.76	gold quality
monocyte	CL:0000576	96.74	gold quality
thoracic aorta	UBERON:0001515	96.74	gold quality
adrenal gland	UBERON:0002369	96.73	gold quality
ascending aorta	UBERON:0001496	96.71	gold quality
endocervix	UBERON:0000458	96.68	gold quality
smooth muscle tissue	UBERON:0001135	96.63	gold quality
leukocyte	CL:0000738	96.57	gold quality
mononuclear cell	CL:0000842	96.54	gold quality
left coronary artery	UBERON:0001626	96.52	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-CURD-112	yes	15.30
E-HCAD-13	yes	11.94
E-MTAB-7606	no	483.02
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

23 targeting HEXA, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-1255A	99.74	68.09	744
HSA-MIR-1255B-5P	99.74	68.16	741
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-298	99.63	67.56	1916
HSA-MIR-6134	99.63	65.68	1537
HSA-MIR-671-5P	99.52	67.11	1277
HSA-MIR-186-3P	99.51	66.24	1685
HSA-MIR-6128	99.33	67.83	1581
HSA-MIR-3925-5P	99.21	67.90	1466
HSA-MIR-7160-5P	99.11	67.17	2207
HSA-MIR-4716-5P	98.82	68.57	1168
HSA-MIR-7705	98.69	67.47	543
HSA-MIR-216B-3P	98.55	67.19	1223
HSA-MIR-1270	96.94	66.65	931
HSA-MIR-620	96.94	66.79	888
HSA-MIR-758-5P	93.99	64.46	534

Literature-anchored findings (GeneRIF, showing 39)

• Eight novel mutations (PMID:12180151)
• plasma activity of total Hex does not appear to be a reliable marker of erosion and cartilage degradation in rheumatoid arthritis patients; liver function appears to be the major determinant for the plasma Hex activity in these patients (PMID:12413610)
• second novel HEXA mutation specific to the IJ TDS carriers: a substitution of cytosine 1351 by guanosine (C1351G), resulting in the change of leucine to valine in position 451. (PMID:14648242)
• the founder effect in a rapidly expanding population arising from a bottleneck provides a robust parsimonious hypothesis explaining the spread of 1278insTATC-linked TSD in Ashkenazi Jews (PMID:14727180)
• Therefore, our bicistronic lentivector supplying both alpha- and beta-subunits of beta-hexosaminidases may provide a potential therapeutic tool for the treatment of Sandhoff disease. (PMID:15953731)
• analysis of the HEXA gene in Italian patients with infantile and late onset Tay-Sachs disease (PMID:16088929)
• The plasma membrane associated beta-hexosaminidase A is fully processed, suggesting its lysosomal origin. (PMID:16212960)
• the X-ray crystallographic structure of Hex A to 2.8 A resolution. The crystal structure of Hex A reveals an alphabeta heterodimer, with each subunit having a functional active site (PMID:16698036)
• The highest activities of exoglycosidases were observed in high-grade gliomas, and a positive correlation of enzyme activities and degree of malignancy was noted. (PMID:16710745)
• isoenzyme composition of N-acetyl-beta-D-hexosaminidase in seminal plasma from patients with secretory azoospermia is significantly different from controls, but this difference does not represent a useful marker of secretory azoospermia (PMID:16776631)
• following HIV infection, there is an increased rate of catabolism of glycoconjugates in saliva resulting from changes in the proportions of the activity of isoenzymes A and B of N-acetyl-beta-hexosaminidase, beta-galactosidase and alpha-fucosidase (PMID:18217416)
• Describe strategy for detecting HexA mutations/activity in prenatal diagnosis of Tay-Sachs disease. (PMID:18425478)
• In the infantile Tay-Sachs group, the number of atoms influenced by a mutation was larger than that in the late-onset disease group. (PMID:18490185)
• A significantly higher activity of N-acetyl-beta-D-hexosaminidase in all laryngeal cancer specimens compared with that in healthy tissue homogenates, was observed. (PMID:19298806)
• MtsD, MtsF and MtsH are fusion proteins with a methyltransferase domain and a corrinoid-binding domain. (PMID:19732345)
• Detected mutations in the HEXA gene through gene sequencing and, by combining the HEXA enzyme assay and the HEXA gene sequencing assay, were able to clarify Tay Sachs carrier status. (PMID:19858779)
• Urinary NAG (ninefold), NGAL (1.5-fold), and H-FABP (3.5-fold) were significantly elevated in normoalbuminuric diabetic patients compared with nondiabetic control subjects. (PMID:21307379)
• Down-regulation of beta-N-acetyl-D-glucosaminidase increases Akt1 activity in thyroid anaplastic cancer cells (PMID:21637923)
• Two mutations were identified c.1A>G (p.MIV), which obliterated the initiating methionine in codon 1, and c.1177C>T (p.R393X), which predicted a termination codon or nonsense mutation in infantile Tay-Sachs diseae in the Persian population. (PMID:21796138)
• We report the first Jordanian Arab Tay-Sachs disease patient diagnosed by deficient beta-hexosaminidase A activity, mutation analysis revealed homozygosity for a nonsense HEXA mutation, c.78G>A (p.W26X) (PMID:21967858)
• The silencing of the HEXA gene had a stronger immune inhibitory effect, thereby indicating a major involvement of beta-N-acetyl-hexosaminidase A isoenzyme within this mechanism. (PMID:21997228)
• Beta-hexosaminidase over-expression affects lysosomal glycohydrolases expression and glycosphingolipid metabolism in mammalian cells. (PMID:22147196)
• HEXA gene in Argentinean patients affected with Tay-Sachs disease, overall 14 different mutations were identified, 8 of them were novel and lead to premature stop codons, drastic residues changes or a splicing defect. (PMID:22441121)
• Identification of six novel missense mutations in children affected with Tay Sachs disease from India. (PMID:22723944)
• identified 27 different mutations, 14 of which were novel, in the HEXA gene and 14 different mutations, 8 of which unreported until now, in the HEXB gene, and attempted to correlate these mutations with the clinical presentation of the patients (PMID:22789865)
• GM2 gangliosidosis is caused by the gene mutation. (review) (PMID:23370522)
• Human prostate cancer cells are characterised by a significant decrease in HexA activity. (PMID:24389457)
• DNA reveals novel mutations in Iranian subjects causing Tay-Sachs disease in the alpha and beta subunits of HexA. (PMID:24518553)
• reports a new missense mutation in the HEXA gene in two German siblings with late-onset Tay-Sachs disease and prominent psychiatric symptoms (PMID:25860343)
• The alpha mutants E482K and G269S are defective in enzymatic activity, unprocessed by lysosomal proteases, and exhibit altered folding pathways compared with wild-type alpha. E482K is more severely misfolded than G269S, as observed by its aggregation and inability to associate with the HexA beta chain. Importantly, both mutants are retrotranslocated from the endoplasmic reticulum to the cytosol and are degraded by the … (PMID:27682588)
• Reported data present, for the first time, reference values for urinary activities of HEX and its isoenzymes HEX A and HEX B in children and adolescent. (PMID:28846871)
• Use of MLPA assay for detecting large copy number changes in the HEXA gene. (PMID:29973161)
• The study characterized 34 enzymatically confirmed Tay-Sachs disease (TSD) families to investigate the presence of novel as well as known variants in HEXA gene. There were detected 25 variants belonging to 31 affected TSD patients and 3 carrier couples confirmed by enzyme study. (PMID:31388111)
• Novel bicistronic lentiviral vectors correct beta-Hexosaminidase deficiency in neural and hematopoietic stem cells and progeny: implications for in vivo and ex vivo gene therapy of GM2 gangliosidosis. (PMID:31682993)
• Novel HEXA variants in Korean children with Tay-Sachs disease with regression of neurodevelopment from infancy. (PMID:33811753)
• Tay-Sachs Disease: Two Novel Rare HEXA Mutations from Pakistan and Morocco.", trans “Tay-Sachs-Syndrom: zwei neue, seltene HEXA-Mutationen aus Pakistan und Marokko. (PMID:33831955)
• In-silico screening and microsecond molecular dynamics simulations to identify single point mutations that destabilize beta-hexosaminidase A causing Tay-Sachs disease. (PMID:34288098)
• Analysis of the HEXA, HEXB, ARSA, and SMPD1 Genes in 68 Iranian Patients. (PMID:34554397)
• Biochemical and mutational analyses of HEXA in a cohort of Egyptian patients with infantile Tay-Sachs disease. Expansion of the mutation spectrum. (PMID:36907859)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	hexa	ENSDARG00000052113
mus_musculus	Hexa	ENSMUSG00000025232
rattus_norvegicus	Hexa	ENSRNOG00000010252
drosophila_melanogaster	Hexo2	FBGN0041629
drosophila_melanogaster	Hexo1	FBGN0041630
drosophila_melanogaster	fdl	FBGN0045063
caenorhabditis_elegans		WBGENE00020509

Paralogs (1): HEXB (ENSG00000049860)

Protein

Protein identifiers

Beta-hexosaminidase subunit alpha — P06865 (reviewed: P06865)

Alternative names: Beta-N-acetylhexosaminidase subunit alpha, N-acetyl-beta-glucosaminidase subunit alpha

All UniProt accessions (22): A0A087WTY2, A0A0S2Z3M0, A0A0S2Z3U8, A0A0S2Z3W3, A0A804HIC7, A0A804HIC8, A0A804HIQ5, A0A804HIU3, A0A804HJ97, A0A804HJK0, A0A804HK32, A0A804HKX5, A0A804HLJ5, P06865, H3BP20, H3BQ04, H3BRP6, H3BS10, H3BT62, H3BTD4, H3BU85, H3BVH8

UniProt curated annotations — full annotation on UniProt →

Function. Hydrolyzes the non-reducing end N-acetyl-D-hexosamine and/or sulfated N-acetyl-D-hexosamine of glycoconjugates, such as the oligosaccharide moieties from proteins and neutral glycolipids, or from certain mucopolysaccharides. The isozyme S is as active as the isozyme A on the anionic bis-sulfated glycans, the chondroitin-6-sulfate trisaccharide (C6S-3), and the dermatan sulfate pentasaccharide, and the sulfated glycosphingolipid SM2. The isozyme B does not hydrolyze each of these substrates, however hydrolyzes efficiently neutral oligosaccharide. Only the isozyme A is responsible for the degradation of GM2 gangliosides in the presence of GM2A.

Subunit / interactions. There are 3 beta-hexosaminidase isozymes: isozyme A (hexosaminidase A) is a heterodimer composed of one subunit alpha and one subunit beta (chain A and B); isozyme B (hexosaminidase B) is a homodimer of two beta subunits (two chains A and B); isozyme S (hexosaminidase S) is a homodimer of two alpha subunits. The composition of the dimer (isozyme A versus isozyme S) has a significant effect on the substrate specificity of the alpha subunit active site.

Subcellular location. Lysosome.

Post-translational modifications. N-linked glycan at Asn-115 consists of Man(3)-GlcNAc(2). N-linked glycan at Asn-157 consists of either GlcNAc or GlcNAc(2)-Man(7-9). N-linked glycan at Asn-295 consists of either GlcNAc, GlcNAc-Fuc, or GlcNAc(2)-Man(4).

Disease relevance. GM2-gangliosidosis 1 (GM2G1) [MIM:272800] An autosomal recessive lysosomal storage disease marked by the accumulation of GM2 gangliosides in the neuronal cells. It is characterized by GM2 gangliosides accumulation in the absence of HEXA activity, leading to neurodegeneration and, in the infantile form, death in early childhood. It exists in several forms: infantile (most common and most severe), juvenile and adult (late-onset). The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Addition of GM2A stimulates the hydrolysis of sulfated glycosphingolipid SM2 and the ganglioside GM2.

Similarity. Belongs to the glycosyl hydrolase 20 family.

Isoforms (2)

UniProt ID	Names	Canonical?
P06865-1	1	yes
P06865-2	2

RefSeq proteins (2): NP_000511, NP_001305754 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR015883	GH20_cat	Domain
IPR017853	GH_hydrolase_sf	Homologous_superfamily
IPR025705	GH20	Family
IPR029018	Hex-like_dom2	Homologous_superfamily
IPR029019	HEX_eukaryotic_N	Domain

Pfam: PF00728, PF14845

Enzyme classification (BRENDA):

• EC 3.2.1.169 — protein O-GlcNAcase (BRENDA: 10 organisms, 123 substrates, 118 inhibitors, 78 Km, 29 kcat entries)

Substrate kinetics (BRENDA)

16 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
4-NITROPHENYL N-ACETYL-BETA-D-GLUCOSAMINIDE	0.016–36	38
4-METHYLUMBELLIFERYL N-ACETYL-BETA-D-GLUCOSAMINI	0.0029–1.4	12
3,4-DINITROPHENYL N-ACETYL-BETA-D-GLUCOSAMINIDE	0.21–0.56	4
3-FLUORO-4-NITROPHENYL N-ACETYL-BETA-D-GLUCOSAMI	0.3–0.73	4
4-METHYLUMBELLIFERYL-N-ACETYL-BETA-D-GLUCOSAMINI	0.0029–0.1	3
3-NITROPHENYL N-ACETYL-BETA-D-GLUCOSAMINIDE	0.47–0.95	2
4-METHYLUMBELLIFERYL 2-ACETAMIDO-2-DEOXY-BETA-D-	0.08–1	2
FLUORESCEIN DI(N-ACETYL-BETA-D-GLUCOSAMINIDE)	0.0849–2.1	2
N-ACETYL-BETA-D-GLUCOSAMINE	1.5–3.6	2
PHENYL N-ACETYL-BETA-D-GLUCOSAMINIDE	0.62–0.95	2
4-CHLOROPHENYL N-ACETYL-BETA-D-GLUCOSAMINIDE	0.56	1
4-METHYLUMBELLIFERYL N-DIFLUOROACETYL-BETA-D-GLU	0.45	1
4-METHYLUMBELLIFERYL N-FLUOROACETYL-BETA-D-GLUCO	0.49	1
4-METHYLUMBELLIFERYL N-TRIFLUOROACETYL-BETA-D-GL	0.38	1
4-NITROPHENYL N-ACETYL-BETA-D-THIOGLUCOSAMINIDE	1.4	1

Catalyzed reactions (Rhea), 5 shown:

• a ganglioside GM2 (d18:1(4E)) + H2O = a ganglioside GM3 (d18:1(4E)) + N-acetyl-beta-D-galactosamine (RHEA:47940)
• a ganglioside GM2 + H2O = a ganglioside GM3 + N-acetyl-beta-D-galactosamine (RHEA:47968)
• N-acetyl-beta-D-galactosaminyl-(1->4)-beta-D-3-sulfogalactosyl-(1->4)-beta-D-glucosyl-(1<->1’)-ceramide + H2O = a beta-D-3-sulfogalactosyl-(1->4)-beta-D-glucosyl-(1<->1’)-ceramide + N-acetyl-beta-D-galactosamine (RHEA:48276)
• beta-D-GalNAc-(1->4)-alpha-L-IdoA-(1->3)-beta-D-GalNAc-4-sulfate-(1->4)-alpha-L-IdoA-(1->3)-D-GalNAc-4-sulfate + H2O = alpha-L-IdoA-(1->3)-beta-D-GalNAc-4-sulfate-(1->4)-alpha-L-IdoA-(1->3)-D-GalNAc-4-sulfate + N-acetyl-D-galactosamine (RHEA:64372)
• N-acetyl-beta-D-6-sulfogalactosaminyl-(1->4)-alpha-L-iduronyl-(1->3)-N-acetyl-D-6-sulfogalactosamine + H2O = alpha-L-iduronyl-(1->3)-N-acetyl-D-6-sulfogalactosamine + N-acetyl-D-6-sulfogalactosamine (RHEA:64384)

UniProt features (123 total): sequence variant 58, strand 25, helix 16, turn 6, disulfide bond 3, splice variant 3, glycosylation site 3, mutagenesis site 3, signal peptide 1, propeptide 1, chain 1, region of interest 1, active site 1, sequence conflict 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
2GJX	X-RAY DIFFRACTION	2.8
2GK1	X-RAY DIFFRACTION	3.25

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P06865-F1	93.62	0.89

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 323 (proton donor)

Disulfide bonds (3): 505–522, 58–104, 277–328

Glycosylation sites (3): 115, 157, 295

Mutagenesis-validated functional residues (3):

Position	Phenotype
115	no change of the catalytic activity associated with the alpha-chain. no catalytic activity associated with the alpha-cha
157	no change of the catalytic activity associated with the alpha-chain. no catalytic activity associated with the alpha-cha
295	no change of the catalytic activity associated with the alpha-chain. no catalytic activity associated with the alpha-cha

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-2022857	Keratan sulfate degradation
R-HSA-2024101	CS/DS degradation
R-HSA-2160916	Hyaluronan degradation
R-HSA-3656234	Defective HEXA causes GM2G1 (Hyaluronan metabolism)
R-HSA-9840310	Glycosphingolipid catabolism

MSigDB gene sets: 375 (showing top): GOBP_CERAMIDE_CATABOLIC_PROCESS, GOBP_N_GLYCAN_PROCESSING, GOBP_BEHAVIOR, GOBP_VACUOLE_ORGANIZATION, GOBP_SKELETAL_SYSTEM_DEVELOPMENT, GOBP_SENSORY_PERCEPTION_OF_MECHANICAL_STIMULUS, GOCC_SECRETORY_GRANULE, GOBP_PROTEIN_N_LINKED_GLYCOSYLATION, GOBP_ADULT_BEHAVIOR, GOBP_HYALURONAN_CATABOLIC_PROCESS, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_CARBOHYDRATE_DERIVATIVE_CATABOLIC_PROCESS, KEGG_LYSOSOME, DARWICHE_SKIN_TUMOR_PROMOTER_DN, DARWICHE_PAPILLOMA_RISK_LOW_UP

GO Biological Process (19): skeletal system development (GO:0001501), carbohydrate metabolic process (GO:0005975), glycosaminoglycan biosynthetic process (GO:0006024), N-glycan processing (GO:0006491), ganglioside catabolic process (GO:0006689), lysosome organization (GO:0007040), sensory perception of sound (GO:0007605), adult walking behavior (GO:0007628), lipid storage (GO:0019915), glycosaminoglycan metabolic process (GO:0030203), dermatan sulfate proteoglycan catabolic process (GO:0030209), hyaluronan catabolic process (GO:0030214), myelination (GO:0042552), cell morphogenesis involved in neuron differentiation (GO:0048667), neuromuscular process controlling posture (GO:0050884), neuromuscular process controlling balance (GO:0050885), lipid metabolic process (GO:0006629), locomotory behavior (GO:0007626), carbohydrate derivative metabolic process (GO:1901135)

GO Molecular Function (7): beta-N-acetylhexosaminidase activity (GO:0004563), acetylglucosaminyltransferase activity (GO:0008375), protein heterodimerization activity (GO:0046982), hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553), protein binding (GO:0005515), hydrolase activity (GO:0016787), hydrolase activity, acting on glycosyl bonds (GO:0016798)

GO Cellular Component (8): obsolete extracellular space (GO:0005615), lysosome (GO:0005764), cytosol (GO:0005829), membrane (GO:0016020), azurophil granule (GO:0042582), lysosomal lumen (GO:0043202), extracellular exosome (GO:0070062), beta-N-acetylhexosaminidase complex (GO:1905379)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Keratan sulfate/keratin metabolism	1
Chondroitin sulfate/dermatan sulfate metabolism	1
Hyaluronan metabolism	1
Diseases associated with glycosaminoglycan metabolism	1
Glycosphingolipid metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
primary metabolic process	2
musculoskeletal movement	2
neuromuscular process	2
cellular anatomical structure	2
system development	1
aminoglycan biosynthetic process	1
glycosaminoglycan metabolic process	1
protein N-linked glycosylation	1
glycoprotein biosynthetic process	1
ganglioside metabolic process	1
glycosphingolipid catabolic process	1
ceramide catabolic process	1
lytic vacuole organization	1
sensory perception of mechanical stimulus	1
adult locomotory behavior	1
walking behavior	1
nutrient storage	1
aminoglycan metabolic process	1
proteoglycan catabolic process	1
dermatan sulfate proteoglycan metabolic process	1
glycosaminoglycan catabolic process	1
hyaluronan metabolic process	1
axon ensheathment	1
cell morphogenesis	1
neuron differentiation	1
neuron development	1
behavior	1
metabolic process	1
hexosaminidase activity	1
UDP-glycosyltransferase activity	1
hexosyltransferase activity	1
protein dimerization activity	1
hydrolase activity, acting on glycosyl bonds	1
binding	1
catalytic activity	1
hydrolase activity	1
lytic vacuole	1
cytoplasm	1
primary lysosome	1
secretory granule	1

Protein interactions and networks

STRING

858 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HEXA	NEU1	Q99519	528
HEXA	NAGA	P17050	510
HEXA	GLB1	P16278	499
HEXA	GM2A	P17900	478
HEXA	FUCA1	P04066	477
HEXA	MANBA	O00462	474
HEXA	PRDX2	P31945	417
HEXA	AGA	P20933	391
HEXA	GLA	P06280	384
HEXA	FUCA2	Q9BTY2	377
HEXA	CTBS	Q01459	377
HEXA	EBAG9	O00559	373
HEXA	HEXD	Q8WVB3	363
HEXA	B4GALNT1	Q00973	360
HEXA	MAN2B1	O00754	349

IntAct

32 interactions, top by confidence:

A	B	Type	Score
HEXB	HEXA	psi-mi:“MI:0407”(direct interaction)	0.730
HEXA	HEXB	psi-mi:“MI:0407”(direct interaction)	0.730
HEXA	HEXB	psi-mi:“MI:0914”(association)	0.730
HEXA	HEXB	psi-mi:“MI:0915”(physical association)	0.730
CMA1	MANBA	psi-mi:“MI:0914”(association)	0.530
CST6	CTSV	psi-mi:“MI:0914”(association)	0.530
ABL1	HEXA	psi-mi:“MI:0915”(physical association)	0.400
HEXA	CRK	psi-mi:“MI:0915”(physical association)	0.400
HEXA	FYN	psi-mi:“MI:0915”(physical association)	0.400
Tuba3a	CCHCR1	psi-mi:“MI:0914”(association)	0.350
Ypel5	KIF1B	psi-mi:“MI:0914”(association)	0.350
CEP170P1	PCYT1A	psi-mi:“MI:0914”(association)	0.350
FAN1		psi-mi:“MI:0914”(association)	0.350
SGTB	ARHGAP32	psi-mi:“MI:0914”(association)	0.350
HNRNPD	ARHGAP32	psi-mi:“MI:0914”(association)	0.350
SYNCRIP	ARHGAP32	psi-mi:“MI:0914”(association)	0.350
BAG6	CNOT1	psi-mi:“MI:0914”(association)	0.350
H2AX	ANXA6	psi-mi:“MI:0914”(association)	0.350
G3BP1	AGPS	psi-mi:“MI:0914”(association)	0.350
	VPS37C	psi-mi:“MI:0914”(association)	0.350
PLA2G2D	ZZEF1	psi-mi:“MI:0914”(association)	0.350
SH2D3A	A2ML1	psi-mi:“MI:0914”(association)	0.350
IGF2R	MANBA	psi-mi:“MI:0914”(association)	0.350
AURKB	VWA8	psi-mi:“MI:0914”(association)	0.350
CLGN	TMEM131L	psi-mi:“MI:0914”(association)	0.350
DNASE2B	HEXA	psi-mi:“MI:0914”(association)	0.350
FPR1	NBAS	psi-mi:“MI:0914”(association)	0.350
WNT10B	VWA8	psi-mi:“MI:0914”(association)	0.350
WNT9A	ZSWIM8	psi-mi:“MI:0914”(association)	0.350

BioGRID (109): STIM2 (Co-fractionation), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), HEXA (Affinity Capture-MS), DHRS4 (Affinity Capture-MS), TERF2 (Affinity Capture-MS), HEXB (Affinity Capture-MS), HEXA (Co-fractionation), ALDH1B1 (Co-fractionation), C1QBP (Co-fractionation)

ESM2 similar proteins: A5D6U8, O23244, O48840, O97860, P06865, P07686, P08236, P09889, P13686, P20060, P29240, P29288, P29416, P49614, P80366, Q05117, Q0V8R6, Q38924, Q53F39, Q5MAU8, Q5R5N6, Q5RC84, Q5RET5, Q5RFI5, Q641X3, Q641Z7, Q687E1, Q6AYS4, Q6TPH1, Q6ZNF0, Q8BX37, Q8H1R2, Q8S340, Q8S341, Q8VYU7, Q8VYZ2, Q93WP4, Q949Y3, Q99KR8, Q9BTY2

Diamond homologs: A7WM73, E9DFH0, P06865, P07686, P13670, P13723, P20060, P29416, P49009, P49010, P49614, Q06GJ0, Q0V8R6, Q22492, Q29548, Q54K55, Q54K56, Q54SC9, Q5RC84, Q619W7, Q641X3, Q6AXR4, Q86M34, Q8J2T0, Q8L7S6, Q8WSF3, Q9HGI3, Q9SYK0, D4AYT4, H2A0L6, P86956, B2UPR7, Q54468, P43077, B2UQG6, P96155, D4AUH6, P49007, Q04786, Q7WUL4

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
TFEB	“up-regulates quantity by expression”	HEXA	“transcriptional regulation”
TFE3	“up-regulates quantity by expression”	HEXA	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

1367 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	140
Likely pathogenic	132
Uncertain significance	440
Likely benign	491
Benign	27

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
100730	NM_000520.6(HEXA):c.718_719insT (p.Lys240fs)	Pathogenic
1070611	NC_000015.9:g.(?_72662933)_72670877del	Pathogenic
1075310	NM_000520.6(HEXA):c.289_290del (p.Val97fs)	Pathogenic
1076289	NM_000520.6(HEXA):c.1073+1G>C	Pathogenic
1076944	NM_000520.6(HEXA):c.32del (p.Leu11fs)	Pathogenic
1184915	NM_000520.6(HEXA):c.743del (p.Leu248fs)	Pathogenic
1332717	NM_000520.6(HEXA):c.1429_1445del (p.Ala477fs)	Pathogenic
1368819	NM_000520.6(HEXA):c.938del (p.Pro313fs)	Pathogenic
1390393	NM_000520.6(HEXA):c.1330+2T>C	Pathogenic
1423338	NM_000520.6(HEXA):c.672+2T>C	Pathogenic
1435017	NM_000520.6(HEXA):c.492del (p.Arg166fs)	Pathogenic
1440029	NM_000520.6(HEXA):c.51_52insAGTTTTCGCTGCTGCTGGCGGCAGCGTTCGCA (p.Gly18fs)	Pathogenic
1440906	NM_000520.6(HEXA):c.917T>G (p.Leu306Ter)	Pathogenic
1449829	NM_000520.6(HEXA):c.118del (p.Tyr40fs)	Pathogenic
1450778	NM_000520.6(HEXA):c.395_398del (p.Val132fs)	Pathogenic
1451990	NM_000520.6(HEXA):c.1455G>A (p.Trp485Ter)	Pathogenic
1453002	NM_000520.6(HEXA):c.144C>G (p.Tyr48Ter)	Pathogenic
1455050	NC_000015.9:g.(?72636408)(72636491_?)del	Pathogenic
1482615	NM_000520.6(HEXA):c.995A>T (p.Asn332Ile)	Pathogenic
1698490	NC_000015.9:g.(72648959_72668060)(72668815?)del	Pathogenic
1804161	NM_000520.6(HEXA):c.1378T>C (p.Trp460Arg)	Pathogenic
188812	NM_000520.6(HEXA):c.912CTT[1] (p.Phe305del)	Pathogenic
188855	NM_000520.6(HEXA):c.947dup (p.Tyr316Ter)	Pathogenic
188954	NM_000520.6(HEXA):c.1528C>T (p.Arg510Ter)	Pathogenic
189126	NM_000520.6(HEXA):c.2T>C (p.Met1Thr)	Pathogenic
1980491	NM_000520.6(HEXA):c.19del (p.Trp7fs)	Pathogenic
1985481	NM_000520.6(HEXA):c.1526+1G>A	Pathogenic
2002210	NM_000520.6(HEXA):c.1250_1251del (p.Ser417fs)	Pathogenic
2003511	NM_000520.6(HEXA):c.25dup (p.Ser9fs)	Pathogenic
2010517	NM_000520.6(HEXA):c.1491T>G (p.Tyr497Ter)	Pathogenic

SpliceAI

2371 predictions. Top by Δscore:

Variant	Effect	Δscore
15:72346323:TACC:T	acceptor_loss	1.0000
15:72346324:ACC:A	acceptor_loss	1.0000
15:72346325:CCT:C	acceptor_loss	1.0000
15:72346326:C:CC	acceptor_gain	1.0000
15:72346326:C:CG	acceptor_loss	1.0000
15:72346327:T:A	acceptor_loss	1.0000
15:72346492:T:TA	donor_gain	1.0000
15:72346521:TTTCA:T	donor_loss	1.0000
15:72346522:TTCA:T	donor_loss	1.0000
15:72346522:TTCAC:T	donor_loss	1.0000
15:72346523:TCACC:T	donor_loss	1.0000
15:72346524:CA:C	donor_loss	1.0000
15:72346524:CACC:C	donor_loss	1.0000
15:72346525:ACCTT:A	donor_loss	1.0000
15:72346526:C:A	donor_loss	1.0000
15:72348029:ACCCT:A	donor_gain	1.0000
15:72348030:CCCTC:C	donor_gain	1.0000
15:72348033:T:TA	donor_gain	1.0000
15:72348037:T:A	donor_gain	1.0000
15:72348041:T:A	donor_gain	1.0000
15:72348042:CCTCA:C	donor_loss	1.0000
15:72348043:CTCA:C	donor_loss	1.0000
15:72348043:CTCAC:C	donor_loss	1.0000
15:72348044:TCACG:T	donor_loss	1.0000
15:72348045:CACG:C	donor_loss	1.0000
15:72348046:A:AC	donor_gain	1.0000
15:72348046:ACGTC:A	donor_loss	1.0000
15:72348047:C:CC	donor_gain	1.0000
15:72348047:CG:C	donor_gain	1.0000
15:72348047:CGT:C	donor_gain	1.0000

AlphaMissense

3458 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:72346276:C:A	W460C	0.998
15:72346276:C:G	W460C	0.998
15:72346278:A:G	W460R	0.998
15:72346278:A:T	W460R	0.998
15:72351198:A:G	W203R	0.998
15:72351198:A:T	W203R	0.998
15:72346564:C:A	W431C	0.997
15:72346564:C:G	W431C	0.997
15:72346566:A:G	W431R	0.997
15:72346566:A:T	W431R	0.997
15:72351215:T:A	K197I	0.997
15:72353115:C:G	D175H	0.997
15:72353151:C:G	D163H	0.997
15:72345461:C:G	R504P	0.996
15:72345519:A:G	W485R	0.996
15:72345519:A:T	W485R	0.996
15:72348134:C:A	W329C	0.996
15:72348134:C:G	W329C	0.996
15:72349080:A:G	W329R	0.996
15:72349080:A:T	W329R	0.996
15:72349100:T:A	D322V	0.996
15:72353105:C:G	R178P	0.996
15:72353114:T:A	D175V	0.996
15:72353129:C:G	R170P	0.996
15:72344138:C:G	R510P	0.995
15:72346236:A:G	W474R	0.995
15:72346236:A:T	W474R	0.995
15:72346282:A:C	C458W	0.995
15:72347715:A:G	W373R	0.995
15:72347715:A:T	W373R	0.995

dbSNP variants (sampled 300 via entrez): RS1000088249 (15:72377997 G>A), RS1000278627 (15:72359480 AGGTCGGGAGTTAGTGACCAGCCT>A), RS1000313819 (15:72349014 G>A,C), RS1000398999 (15:72346951 C>A), RS1000435913 (15:72367744 T>C), RS1000493513 (15:72375659 G>A,C,T), RS1000500998 (15:72342798 A>G), RS1000590391 (15:72374045 G>A,C), RS1000695390 (15:72376444 G>A,C), RS1000740267 (15:72375449 A>G), RS1000858179 (15:72355745 A>C), RS1000880825 (15:72369257 T>A), RS1001010181 (15:72348798 C>A), RS1001067056 (15:72356151 T>C), RS1001229753 (15:72360120 T>C)

Disease associations

OMIM: gene MIM:606869 | disease phenotypes: MIM:272800, MIM:312080, MIM:272750

GenCC curated gene-disease

Disease	Classification	Inheritance
Tay-Sachs disease	Definitive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
Tay-Sachs disease	Definitive	AR

Mondo (7): Tay-Sachs disease (MONDO:0010100), hearing loss disorder (MONDO:0005365), leukodystrophy (MONDO:0019046), intellectual disability (MONDO:0001071), Tay-Sachs disease AB variant (MONDO:0010099), Tay-Sachs disease, B1 variant (MONDO:0017728), hereditary ataxia (MONDO:0100309)

Orphanet (6): Tay-Sachs disease (Orphanet:845), Leukodystrophy (Orphanet:68356), GM2 gangliosidosis, AB variant (Orphanet:309246), Hereditary ataxia (Orphanet:183518), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658), OBSOLETE: Tay-Sachs disease, B1 variant (Orphanet:309239)

HPO phenotypes

16 total (16 of 16 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000618	Blindness
HP:0000726	Dementia
HP:0000741	Apathy
HP:0000980	Pallor
HP:0001250	Seizure
HP:0001252	Hypotonia
HP:0001276	Hypertonia
HP:0001290	Generalized hypotonia
HP:0002267	Exaggerated startle response
HP:0002361	Psychomotor deterioration
HP:0002421	Poor head control
HP:0002835	Aspiration
HP:0003495	GM2-ganglioside accumulation
HP:0003593	Infantile onset
HP:0010729	Cherry red spot of the macula

GWAS associations

0 associations (top):

MeSH disease descriptors (5)

Descriptor	Name	Tree numbers
D034381	Hearing Loss	C09.218.458.341; C10.597.751.418.341; C23.888.592.763.393.341
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D013661	Tay-Sachs Disease	C10.228.140.163.100.435.825.300.300.500; C16.320.565.189.435.825.300.300.500; C16.320.565.398.641.803.350.300.850; C16.320.565.595.554.825.300.300.840; C18.452.132.100.435.825.300.300.500; C18.452.584.563.641.803.350.300.850; C18.452.648.189.435.825.300.300.500; C18.452.648.398.641.803.350.300.850; C18.452.648.595.554.825.300.300.840
D049290	Tay-Sachs Disease, AB Variant	C10.228.140.163.100.435.825.300.300.750; C16.320.565.189.435.825.300.300.750; C16.320.565.398.641.803.350.300.925; C16.320.565.595.554.825.300.300.920; C18.452.132.100.435.825.300.300.750; C18.452.584.563.641.803.350.300.925; C18.452.648.189.435.825.300.300.750; C18.452.648.398.641.803.350.300.925; C18.452.648.595.554.825.300.300.920
C531684	Hereditary spinal ataxia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL1250415 (SINGLE PROTEIN), CHEMBL3038485 (PROTEIN FAMILY)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 19,344 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL36	PYRIMETHAMINE	4	19,344

PharmGKB: 1 entry (VIP=true, CPIC=false)

Binding affinities (BindingDB)

2 measured of 9 human assays (9 total across all organisms); most potent 2 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
Iminocyclitol, 8	KI	100 nM
Iminocyclitol, 10	KI	10000 nM

ChEMBL bioactivities

23 potent at pChembl≥5 of 43 total, top 23 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.00	IC50	100	nM	CHEMBL4097052
6.57	Ki	270	nM	CHEMBL257158
6.20	Ki	630	nM	CHEMBL2385922
6.16	Ki	690	nM	CHEMBL2385089
6.03	Ki	930	nM	CHEMBL2385933
5.98	Ki	1040	nM	CHEMBL2385932
5.97	Ki	1080	nM	CHEMBL2385919
5.95	Ki	1130	nM	CHEMBL2385935
5.91	Ki	1230	nM	CHEMBL2385936
5.87	Ki	1350	nM	CHEMBL2385934
5.68	Ki	2090	nM	CHEMBL42904
5.55	Ki	2810	nM	CHEMBL20330
5.52	Ki	3000	nM	CHEMBL2385939
5.51	IC50	3100	nM	PYRIMETHAMINE
5.49	Ki	3220	nM	CHEMBL2333316
5.38	Ki	4200	nM	CHEMBL2385941
5.36	Ki	4390	nM	CHEMBL2385937
5.33	Ki	4630	nM	CHEMBL2385921
5.30	Ki	4990	nM	CHEMBL2385924
5.22	IC50	6000	nM	CHEMBL2333316
5.21	Ki	6220	nM	CHEMBL2385923
5.07	IC50	8500	nM	PYRIMETHAMINE
5.05	IC50	8900	nM	PYRIMETHAMINE

PubChem BioAssay actives

26 with measured affinity, of 156 total; 23 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
N-[(2S,3S,4R,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-(4-phenylbutoxymethyl)piperidin-3-yl]acetamide	1440009: Inhibition of alpha-hexosaminidase (unknown origin)	ic50	0.1000	uM
[(2R,3S,4R,5S)-5-acetamido-3,4-dihydroxy-1-methylpyrrolidin-2-yl] sulfate	1799473: Inhibition Assay from Article 10.1016/S1074-5521(01)00045-X: “Hexosaminidase inhibitors as new drug candidates for the therapy of osteoarthritis.”	ki	0.1000	uM
(3aR,5R,6S,7R,7aR)-5-(hydroxymethyl)-2-methyl-5,6,7,7a-tetrahydro-3aH-pyrano[3,2-d][1,3]thiazole-6,7-diol	748369: Competitive inhibition of human beta-N-acetyl-D-hexosaminidase-A using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate assessed as release of 4-Methylumbelliferyl fluorophore measured for 7 mins	ki	0.2700	uM
2-[2-(propylamino)ethyl]benzo[de]isoquinoline-1,3-dione	1799519: Enzyme Inhibition Assay from Article 10.1016/j.chembiol.2006.12.006: “High-throughput screening for human lysosomal beta-N-Acetyl hexosaminidase inhibitors acting as pharmacological chaperones.”	ic50	0.6000	uM
2-[2-[(4-methoxyphenyl)methylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	0.6300	uM
2-[2-[2-(3,4-dimethoxyphenoxy)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	0.6900	uM
2-[2-[2-(3-methoxyphenoxy)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	0.9300	uM
2-[2-[2-(4-methoxyphenoxy)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	1.0400	uM
2-[2-[2-(4-methoxyanilino)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	1.0800	uM
2-[2-[2-(4-methoxyphenyl)sulfanylethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	1.1300	uM
2-[2-[3-(4-methoxyphenoxy)propylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	1.2300	uM
2-[2-[2-(2-methoxyphenoxy)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	1.3500	uM
2-(2-aminoethyl)benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	2.0900	uM
2-[2-(dimethylamino)ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	2.8100	uM
2-[2-[2-(1,3-benzodioxol-5-yloxy)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	3.0000	uM
Pyrimethamine	1227098: Inhibition of human placental HexA using MUGS substrate incubated for 1 to 2 hrs at pH 7.0 by spectrofluorometry	ic50	3.1000	uM
2-[2-[2-(1,3-dioxobenzo[de]isoquinolin-2-yl)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	3.2200	uM
methyl 4-[2-[2-(1,3-dioxobenzo[de]isoquinolin-2-yl)ethylamino]ethoxy]benzoate	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	4.2000	uM
2-[2-[3-(3-methoxyphenoxy)propylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	4.3900	uM
2-[2-[3-(propylamino)propylamino]ethyl]benzo[de]isoquinoline-1,3-dione	1799519: Enzyme Inhibition Assay from Article 10.1016/j.chembiol.2006.12.006: “High-throughput screening for human lysosomal beta-N-Acetyl hexosaminidase inhibitors acting as pharmacological chaperones.”	ic50	4.6000	uM
2-[2-[2-(2,4-dimethoxyanilino)ethylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	4.6300	uM
2-[2-[(3,4-dimethoxyphenyl)methylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	4.9900	uM
2-[2-[(3-methoxyphenyl)methylamino]ethyl]benzo[de]isoquinoline-1,3-dione	748372: Inhibition of human beta-N-acetyl-D-hexosaminidase-A/B using 4-Methylumbelliferyl N-acetyl-beta-D-glucosaminide as substrate incubated for 10 mins prior to substrate addition by spectrofluorometric analysis	ki	6.2200	uM

CTD chemical–gene interactions

40 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects expression, affects cotreatment, decreases expression, increases abundance, increases expression	3
mercuric bromide	increases expression, affects cotreatment	2
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	2
Plant Extracts	affects cotreatment, increases expression, affects binding, decreases reaction, increases secretion	2
Smoke	decreases expression	2
bisphenol F	affects cotreatment, affects expression	1
bisphenol A	affects cotreatment, increases expression	1
beta-lapachone	decreases expression	1
manganese chloride	decreases expression, increases abundance, affects cotreatment	1
ochratoxin A	increases expression	1
yessotoxin	increases expression	1
azoxystrobin	decreases expression	1
CGP 52608	affects binding, increases reaction	1
deguelin	decreases expression	1
pyrimidifen	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
LDN 193189	affects cotreatment, increases expression	1
PP242	increases expression	1
bisphenol AF	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Amiodarone	increases activity, increases secretion, increases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Benzo(a)pyrene	affects methylation	1
p-Methoxy-N-methylphenethylamine	decreases reaction, increases secretion	1
Dexamethasone	affects cotreatment, increases expression, affects expression	1
Diethylhexyl Phthalate	affects binding, increases secretion, decreases reaction	1
Dinitrochlorobenzene	affects binding	1
Diuron	decreases expression	1
Indomethacin	increases expression, affects expression, affects cotreatment	1
Ivermectin	decreases expression	1

ChEMBL screening assays

58 unique, capped per target: 58 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1251514	Binding	Inhibition of human placental lysosomal hexosaminidase A at 5 uM	OGA inhibition by GlcNAc-selenazoline. — Bioorg Med Chem

Cellosaurus cell lines

47 cell lines: 16 finite cell line, 14 induced pluripotent stem cell, 10 transformed cell line, 6 cancer cell line, 1 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0P14	GM00059	Finite cell line	Female
CVCL_1V04	GM01108	Finite cell line	Female
CVCL_1V05	GM01109	Finite cell line	Male
CVCL_4N36	GM03051	Finite cell line	Male
CVCL_4N37	GM03052	Finite cell line	Female
CVCL_4N45	GM04863	Finite cell line	Male
CVCL_9S11	ESi042-A	Induced pluripotent stem cell	Male
CVCL_A4NQ	TSD-01-hiPSC	Induced pluripotent stem cell	Male
CVCL_A5RK	CD#59 ipsC	Induced pluripotent stem cell	Female
CVCL_AA73	GM09295	Transformed cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02030015	PHASE4	TERMINATED	Synergistic Enteral Regimen for Treatment of the Gangliosidoses
NCT00205881	PHASE4	COMPLETED	Bilateral Benefit in Adult Users of the HiRes 90K Bionic Ear System
NCT00331539	PHASE4	UNKNOWN	Relationship Between Auto NRT and Behavioural T & C Levels With the Nucleus Freedom Cochlear Implant
NCT00424307	PHASE4	UNKNOWN	Bilateral Cochlear Implant Benefit in Young Children
NCT00765635	PHASE4	COMPLETED	Chlorobutanol, Potassium Carbonate, and Irrigation in Cerumen Removal
NCT03321006	PHASE4	COMPLETED	Treating Hearing Loss to Improve Mood and Cognition in Older Adults
NCT04221451	PHASE3	TERMINATED	A Multinational, Randomized, Double-blind, Placebo-controlled Study to Assess the Efficacy, Pharmacodynamics, Pharmacokinetics, and Safety of Venglustat in Late-onset GM2
NCT01499901	PHASE3	WITHDRAWN	Comparison of the Bilateral Sequential and Simultaneous Cochlear Implantation in the Deaf Children
NCT02561091	PHASE3	COMPLETED	AM-111 in the Treatment of Acute Inner Ear Hearing Loss
NCT03331627	PHASE3	COMPLETED	Safety and Efficacy of STR001-IT and STR001-ER in Patients With SSHL
NCT05532657	PHASE3	ACTIVE_NOT_RECRUITING	ACHIEVE Brain Health Follow-Up Study
NCT00383448	PHASE2	COMPLETED	HSCT for High Risk Inherited Inborn Errors
NCT03759665	PHASE2	COMPLETED	N-Acetyl-L-Leucine for GM2 Gangliosidosis (Tay-Sachs and Sandhoff Disease)
NCT00013455	PHASE2	COMPLETED	Quantifying Auditory Perceptual Learning Following Hearing Aid Fitting
NCT00323427	PHASE2	COMPLETED	Clinical Trial of the Living Well With Hearing Loss Workshop
NCT00552786	PHASE2	COMPLETED	Antioxidation Medication for Noise-induced Hearing Loss
NCT00802425	PHASE2	COMPLETED	Efficacy of AM-111 in Patients With Acute Sensorineural Hearing Loss
NCT01139281	PHASE2	COMPLETED	The Protective Effect of Ginkgo Biloba Extract on Cisplatin-induced Ototoxicity in Humans
NCT01451853	PHASE2	UNKNOWN	SPI-1005 for Prevention and Treatment of Chemotherapy Induced Hearing Loss
NCT01588925	PHASE2	COMPLETED	Hearing Preservation Using Dexamethasone and Hyaluronic Acid for Cochlear Implantation
NCT01773278	PHASE2	RECRUITING	Cholesterol and Antioxidant Treatment in Patients With Smith-Lemli-Opitz Syndrome (SLOS)
NCT02832128	PHASE2	COMPLETED	Evaluating Possible Improvement in Speech and Hearing Tests After 28 Days of Dosing of the Study Drug AUT00063 Compared to Placebo (QuicKfire)
NCT04915183	PHASE2	RECRUITING	Atorvastatin to Reduce Cisplatin-Induced Hearing Loss Among Individuals With Head and Neck Cancer
NCT05258773	PHASE2	COMPLETED	Evaluation of the Presence of SENS-401 in the Perilymph
NCT06340633	PHASE2	RECRUITING	SPI-1005 in Adults Receiving Cochlear Implant
NCT02254863	PHASE1	RECRUITING	UCB Transplant of Inherited Metabolic Diseases With Administration of Intrathecal UCB Derived Oligodendrocyte-Like Cells
NCT04669535	PHASE1	TERMINATED	A Dose-escalation and Safety & Efficacy Study of AXO-AAV-GM2 in Tay-Sachs or Sandhoff Disease
NCT00582946	PHASE1	COMPLETED	Wide-Bandwidth Open Canal Hearing Aid For Better Multitalker Speech Understanding
NCT00584155	PHASE1	WITHDRAWN	Protection From Cisplatin Ototoxicity by Lactated Ringers
NCT01206829	PHASE1	UNKNOWN	Hearing Impairment, Cognitive Therapy and Coping
NCT01256229	PHASE1	COMPLETED	Outcomes In Children With Developmental Delay And Deafness
NCT01343394	PHASE1	WITHDRAWN	Safety of Autologous Human Umbilical Cord Blood Mononuclear Fraction to Treat Acquired Hearing Loss in Children
NCT01452607	PHASE1	COMPLETED	Study to Evaluate the Safety and Pharmacokinetics of SPI-1005
NCT02259595	PHASE1	COMPLETED	Study to Determine the Safety, Tolerability, and Pharmacokinetic Profile of HPN-07 and HPN-07 Plus NAC
NCT04041440	PHASE1	COMPLETED	Speech Recognition Training in Children With Hearing Loss
NCT07218913	PHASE1	RECRUITING	Testing the Addition of Pedmark to Cisplatin Chemotherapy for Reducing Drug-Induced Ear Damage in Men With Stage II-III Metastatic Testicular Germ Cell Tumors
NCT00176904	PHASE2/PHASE3	COMPLETED	Stem Cell Transplant for Inborn Errors of Metabolism
NCT01102686	PHASE1/PHASE2	COMPLETED	Pyrimethamine as a Treatment for Late-Onset GM2-gangliosidosis (Tay-Sachs and Sandhoff Disease)
NCT01372228	PHASE1/PHASE2	TERMINATED	Phase I/II Pilot Study of Mixed Chimerism to Treat Inherited Metabolic Disorders
NCT00006057	Not specified	COMPLETED	Diagnostic and Screening Study of Genetic Disorders