HJURP

Summary

HJURP (Holliday junction recognition protein, HGNC:25444) is a protein-coding gene on chromosome 2q37.1, encoding Holliday junction recognition protein (Q8NCD3). Centromeric protein that plays a central role in the incorporation and maintenance of histone H3-like variant CENPA at centromeres. It is a selective cancer dependency (DepMap: 85.8% of cell lines).

Enables histone binding activity and identical protein binding activity. Involved in CENP-A containing chromatin assembly; chromosome segregation; and regulation of protein-containing complex assembly. Located in cytosol; kinetochore; and nuclear lumen.

Source: NCBI Gene 55355 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 148 total — 2 pathogenic
• Cancer dependency (DepMap): dependent in 85.8% of screened cell lines
• MANE Select transcript: NM_018410

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25444
Approved symbol	HJURP
Name	Holliday junction recognition protein
Location	2q37.1
Locus type	gene with protein product
Status	Approved
Aliases	DKFZp762E1312, URLC9, hFLEG1, FAKTS
Ensembl gene	ENSG00000123485
Ensembl biotype	protein_coding
OMIM	612667
Entrez	55355

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 5 protein_coding, 2 nonsense_mediated_decay, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000373395, ENST00000411486, ENST00000414924, ENST00000432087, ENST00000433484, ENST00000434039, ENST00000441687, ENST00000453122, ENST00000454020

RefSeq mRNA: 3 — MANE Select: NM_018410 NM_001282962, NM_001282963, NM_018410

CCDS: CCDS33406, CCDS63166, CCDS63167

Canonical transcript exons

ENST00000411486 — 9 exons

Exon	Start	End
ENSE00000839702	233840609	233842205
ENSE00001029874	233847397	233847461
ENSE00001132932	233849763	233849859
ENSE00001405702	233836702	233837652
ENSE00001614327	233854384	233854535
ENSE00003484757	233845728	233845820
ENSE00003542484	233853844	233853910
ENSE00003569872	233844205	233844283
ENSE00003613734	233852565	233852620

Expression profiles

Bgee: expression breadth ubiquitous, 164 present calls, max score 95.39.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 24.0897 / max 390.3192, expressed in 1408 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
34601	22.2184	1397
34600	1.0872	620
34602	0.7841	495

Top tissues by expression

279 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	95.39	gold quality
oocyte	CL:0000023	95.01	gold quality
secondary oocyte	CL:0000655	94.42	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.82	gold quality
ganglionic eminence	UBERON:0004023	90.95	gold quality
embryo	UBERON:0000922	90.25	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.54	gold quality
bone marrow	UBERON:0002371	87.32	gold quality
stromal cell of endometrium	CL:0002255	83.71	gold quality
bone marrow cell	CL:0002092	83.50	gold quality
trabecular bone tissue	UBERON:0002483	81.98	gold quality
mucosa of transverse colon	UBERON:0004991	79.72	gold quality
lower esophagus mucosa	UBERON:0035834	77.76	gold quality
testis	UBERON:0000473	77.26	gold quality
left testis	UBERON:0004533	76.99	gold quality
rectum	UBERON:0001052	76.65	gold quality
right testis	UBERON:0004534	76.49	gold quality
vermiform appendix	UBERON:0001154	76.27	gold quality
thymus	UBERON:0002370	75.86	gold quality
esophagus mucosa	UBERON:0002469	75.81	gold quality
cartilage tissue	UBERON:0002418	73.70	gold quality
adrenal tissue	UBERON:0018303	73.57	gold quality
lymph node	UBERON:0000029	73.53	gold quality
caecum	UBERON:0001153	71.85	gold quality
tongue squamous epithelium	UBERON:0006919	70.94	gold quality
endometrium	UBERON:0001295	68.47	gold quality
spleen	UBERON:0002106	67.85	gold quality
amniotic fluid	UBERON:0000173	67.33	silver quality
duodenum	UBERON:0002114	66.37	gold quality
sperm	CL:0000019	66.31	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.86

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

28 targeting HJURP, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-4650-5P	99.98	64.69	999
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-4799-5P	99.82	70.60	2663
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-4699-3P	99.71	70.15	3142
HSA-MIR-1827	99.63	68.57	3265
HSA-MIR-766-3P	99.47	65.24	1811
HSA-MIR-508-5P	99.41	64.25	1248
HSA-MIR-4427	99.34	70.33	1854
HSA-MIR-3191-5P	99.24	66.52	1722
HSA-MIR-518C-5P	98.53	69.20	1640
HSA-MIR-1910-3P	98.44	67.51	1695
HSA-MIR-4436B-3P	98.25	65.26	1494
HSA-MIR-6735-5P	98.24	65.36	1488
HSA-MIR-338-3P	98.14	67.38	1137
HSA-MIR-6511A-5P	98.13	67.47	1770
HSA-MIR-7843-5P	98.12	65.26	1421
HSA-MIR-4778-5P	97.96	68.06	1634
HSA-MIR-1912-5P	97.94	67.98	832
HSA-MIR-4632-5P	97.82	65.38	1470
HSA-MIR-6879-5P	97.77	65.52	1521
HSA-MIR-630	97.50	66.38	921
HSA-MIR-4486	96.96	60.61	931

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 85.8% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 40)

• hFLEG1 is associated with the CENP-A centromeric nucleosome (PMID:16622419)
• HJURP is a possible cell-cycle-regulated CENP-A-specific histone chaperone required for centromeric chromatin assembly (PMID:19410544)
• HJURP is a key factor for CENP-A deposition and maintenance at centromeres (PMID:19410545)
• found that HJURP, a member of the complex, was required for cell cycle specific targeting of CENP-A to centromeres. (PMID:20080577)
• Data show that HJURP mRNA level is a prognostic factor for disease-free and overall survival in patients with breast cancer and is a predictive biomarker for sensitivity to radiotherapy. (PMID:20211017)
• The crystal structure of an HJURP-CENP-A-histone H4 complex shows that HJURP binds a CENP-A-H4 heterodimer (PMID:21478274)
• An amino-terminal fragment of HJURP was able to assemble CENP-A nucleosomes in vitro, demonstrating that HJURP is a chromatin assembly factor. (PMID:21768289)
• stringent regulation of HJURP and SCM3 expression are critical for genome stability. (PMID:21980305)
• And-1 together with HJURP regulates the assembly of new CENP-A onto centromeres. (PMID:23184928)
• Downregulation of HJURP in young cells led to premature senescence. p53 knockdown, but not p16 knockdown, abolished senescence phenotypes caused by HJURP reduction. (PMID:23292286)
• HJURP has an important role in the maintenance of extremely proliferative cells of high-grade gliomas (PMID:23638004)
• a mechanism whereby the CENP-A pre-nucleosomal complex achieves assembly of the octameric CENP-A nucleosome through the dimerization of the CENP-A chaperone HJURP. (PMID:23771058)
• The levels of the EDNRB, HJURP and p60/CAF-1 proteins were strongly associated with overall survival in high-grade gliomas patients (p<0.001, p<0.001 and p=0.002, respectively), whereas the one of PDLI4 was not (P=0.11). (PMID:24039914)
• Mis18beta binds with and specifies the centromere localization of HJURP. (PMID:24519934)
• Phosphorylation state of HJURP controls its centromeric recruitment. HJURP binding to DNA promotes loading of CenH3CENP-A at centromeres. (PMID:25001279)
• The study describes a novel function for human centromeric long non-coding RNAs in the recruitment of HJURP and CENP-A, implicating RNA-based chaperone targeting in histone variant assembly. (PMID:25117489)
• 3 biomarkers in 44 patients with in situ breast cancers were evaluated: TG2 (transglutaminase 2), HJURP (Holliday junction recognition protein), and HIF-1alpha (hypoxia inducible factor-1 alpha). (PMID:25243117)
• HJURP can discriminate favorable and unfavorable outcome within the luminal A subtype, outperforming the currently utilized proliferation marker Ki67, as an independent prognostic marker for luminal A patients. (PMID:25497280)
• On the basis of our findings, we propose that HJURP serves a dual chaperone function in coordinating CenH3(CENP-A) and CENP-C recruitment. (PMID:25843710)
• Authors propose that this centromere expansion activity reflects the functional properties of HJURP, which uses this activity to contribute to the plastic establishment of a centromeric chromatin structure. (PMID:26063729)
• An increased occurrence of hepatocellular carcinoma was consistently associated with A/C or C/C genotypes of the non-synonymous SNP rs3771333 compared with the A/A genotype in both the Fusui and Haimen populations. (PMID:26863619)
• during the CENP-A/H4 deposition process, the chaperone HJURP protects various substructures of the dimer, serving both as a folding and binding chaperone (PMID:27454815)
• Functional p53 elicits a cell cycle arrest response, whereas, in p53-null transformed cells, the absence of arrest enables the loss of HJURP to induce severe aneuploidy and, ultimately, apoptotic cell death (PMID:28356341)
• Increased expression of HJURP was identified as an independent negative prognostic biomarker for patients with advanced serous ovarian cancer. (PMID:29743473)
• HJURP expression was higher in HCC tissues than in para-tumor tissues. Moreover, ectopic HJURP expression facilitated the proliferation of HCC cells, whereas the depletion of HJURP resulted in decreased cell growth in vitro and in vivo. Furthermore, the effects of HJURP silencing were reversed by p21 knockdown. (PMID:30111352)
• H3.3 chaperones HIRA and DAXX promote ectopic CENP-A deposition. (PMID:30365520)
• these data define a novel molecular mechanism underlying the assembly of CENP-T onto the centromere by a temporally regulated HJURP-CENP-T interaction. (PMID:30459232)
• Knockdown of HJURP inhibits non-small cell lung cancer cell proliferation, migration, and invasion by repressing Wnt/beta-catenin signaling. (PMID:31115012)
• HJURP knockdown disrupts clonogenic capacity and increases radiation-induced cell death of glioblastoma cells. (PMID:31138900)
• Data show that the MIS18 kinetochore protein A (Mis18alpha) N-terminal region modulates Holliday junction recognition protein (HJURP) binding. (PMID:31492860)
• Holliday junctionrecognition protein modulates apoptosis, cell cycle arrest and reactive oxygen species stress in human renal cell carcinoma. (PMID:32582972)
• Prognostic Relevance of HJURP Expression in Patients with Surgically Resected Colorectal Cancer. (PMID:33114545)
• HJURP promotes proliferation in prostate cancer cells through increasing CDKN1A degradation via the GSK3beta/JNK signaling pathway. (PMID:34099634)
• Hypomethylation-driven overexpression of HJURP promotes progression of hepatocellular carcinoma and is associated with poor prognosis. (PMID:34119827)
• HJURP is a prognostic biomarker for clear cell renal cell carcinoma and is linked to immune infiltration. (PMID:34217993)
• Identification of Prognostic Genes for Colon Cancer through Gene Co-expression Network Analysis. (PMID:34542829)
• Holliday junction recognition protein as a prognostic biomarker and therapeutic target for oral cancer. (PMID:35103286)
• HJURP regulates cell proliferation and chemo-resistance via YAP1/NDRG1 transcriptional axis in triple-negative breast cancer. (PMID:35459269)
• HJURP inhibits proliferation of ovarian cancer cells by regulating CENP-A/CENP-N. (PMID:35940943)
• NFE2L1 restrains ferroptosis by transcriptionally regulating HJURP and participates in the progress of oral squamous cell carcinoma. (PMID:37848756)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Hjurp	ENSMUSG00000044783
rattus_norvegicus	Hjurp	ENSRNOG00000022911

Protein

Protein identifiers

Holliday junction recognition protein — Q8NCD3 (reviewed: Q8NCD3)

Alternative names: 14-3-3-associated AKT substrate, Fetal liver-expressing gene 1 protein, Up-regulated in lung cancer 9

All UniProt accessions (5): C9JWC4, F8WCV1, Q8NCD3, H7C0I6, H7C3V8

UniProt curated annotations — full annotation on UniProt →

Function. Centromeric protein that plays a central role in the incorporation and maintenance of histone H3-like variant CENPA at centromeres. Acts as a specific chaperone for CENPA and is required for the incorporation of newly synthesized CENPA molecules into nucleosomes at replicated centromeres. Prevents CENPA-H4 tetramerization and prevents premature DNA binding by the CENPA-H4 tetramer. Directly binds Holliday junctions.

Subunit / interactions. Interacts with CENPA (via CATD domain); the interaction is direct and specific for CENPA since it does not interact with H3.1- or H3.3-containing nucleosomes. Heterotrimer composed of HJURP, CENPA and histone H4, where HJURP interacts with the dimer formed by CENPA and histone H4 and prevents tetramerization of CENPA and H4. Identified in a centromere complex containing histones H2A, H2B and H4, and at least CENPA, CENPB, CENPC, CENPT, CENPN, HJURP, SUPT16H, SSRP1 and RSF1. Interacts with 14-3-3 family members in a phosphorylation-dependent manner. Interacts with MSH5 and NBN.

Subcellular location. Nucleus. Nucleolus. Chromosome. Centromere.

Tissue specificity. According to PubMed:17256767, highly expressed in the thymus with lower levels in the placenta, small intestine, liver, skeletal muscle, and colon. According to PubMed:17823411, highly expressed in testis, and at a relatively lower level in thymus and bone marrow. Significantly overexpressed in many lung cancer samples, compared with normal lung.

Isoforms (3)

UniProt ID	Names	Canonical?
Q8NCD3-1	1	yes
Q8NCD3-2	2
Q8NCD3-3	3

RefSeq proteins (3): NP_001269891, NP_001269892, NP_060880* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR018465	Scm3/HJURP	Family
IPR021052	HJURP_central_dom	Domain
IPR022102	HJURP_C	Domain

Pfam: PF10384, PF12346, PF12347

UniProt features (43 total): modified residue 12, sequence variant 9, strand 4, compositionally biased region 4, region of interest 3, cross-link 3, splice variant 2, sequence conflict 2, chain 1, mutagenesis site 1, helix 1, turn 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
3R45	X-RAY DIFFRACTION	2.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NCD3-F1	46.55	0.07

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (15): 185, 201, 211, 412, 448, 473, 486, 496, 595, 642, 354, 581, 586, 123, 140

Mutagenesis-validated functional residues (1):

Position	Phenotype
486	loss of phosphorylation by akt1 and binding to ywhag.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-606279	Deposition of new CENPA-containing nucleosomes at the centromere
R-HSA-69273	Cyclin A/B1/B2 associated events during G2/M transition

MSigDB gene sets: 264 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_DN, GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_UP, GSE45365_NK_CELL_VS_CD8_TCELL_DN, GSE18804_SPLEEN_MACROPHAGE_VS_BRAIN_TUMORAL_MACROPHAGE_UP, GOBP_CHROMOSOME_ORGANIZATION, HORIUCHI_WTAP_TARGETS_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, KANG_DOXORUBICIN_RESISTANCE_UP, GNF2_CENPF, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, MITSIADES_RESPONSE_TO_APLIDIN_DN, KONG_E2F3_TARGETS, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, PATIL_LIVER_CANCER

GO Biological Process (4): chromosome segregation (GO:0007059), CENP-A containing chromatin assembly (GO:0034080), regulation of protein-containing complex assembly (GO:0043254), regulation of DNA binding (GO:0051101)

GO Molecular Function (4): DNA binding (GO:0003677), histone binding (GO:0042393), identical protein binding (GO:0042802), protein binding (GO:0005515)

GO Cellular Component (7): chromosome, centromeric region (GO:0000775), kinetochore (GO:0000776), nucleoplasm (GO:0005654), nucleolus (GO:0005730), cytosol (GO:0005829), nucleus (GO:0005634), chromosome (GO:0005694)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Nucleosome assembly	1
G2/M Transition	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intracellular membraneless organelle	3
protein binding	2
nuclear lumen	2
cellular anatomical structure	2
cell cycle process	1
chromatin organization	1
kinetochore assembly	1
protein localization to CENP-A containing chromatin	1
regulation of cellular component biogenesis	1
regulation of cellular component organization	1
protein-containing complex assembly	1
DNA binding	1
regulation of binding	1
nucleic acid binding	1
binding	1
chromosomal region	1
condensed chromosome, centromeric region	1
supramolecular complex	1
cytoplasm	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1358 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HJURP	H4C16	P02304	973
HJURP	H4C7	Q99525	973
HJURP	CENPA	P49450	970
HJURP	MSH5	O43196	930
HJURP	NPM1	P06748	852
HJURP	MIS18BP1	Q6P0N0	771
HJURP	RBBP4	P31149	730
HJURP	MIS18A	Q9NYP9	720
HJURP	CENPC	Q03188	714
HJURP	CENPH	Q9H3R5	706
HJURP	CENPT	Q96BT3	694
HJURP	DLGAP5	Q15398	678
HJURP	OIP5	O43482	663
HJURP	TTK	P33981	660
HJURP	CENPN	Q96H22	656

IntAct

98 interactions, top by confidence:

A	B	Type	Score
HJURP	CENPA	psi-mi:“MI:0914”(association)	0.930
HJURP	CENPA	psi-mi:“MI:0915”(physical association)	0.930
CENPA	HJURP	psi-mi:“MI:0915”(physical association)	0.930
HJURP	CENPA	psi-mi:“MI:0403”(colocalization)	0.930
CENPA	HJURP	psi-mi:“MI:0914”(association)	0.930
RBBP4	CDK2AP1	psi-mi:“MI:0914”(association)	0.790
CENPA	H4C16	psi-mi:“MI:0915”(physical association)	0.790
YWHAG	BLTP3B	psi-mi:“MI:2364”(proximity)	0.640
LRRC46	TFPT	psi-mi:“MI:0914”(association)	0.640
LIN28A	IGF2BP3	psi-mi:“MI:0914”(association)	0.640
HJURP	HJURP	psi-mi:“MI:0915”(physical association)	0.640
HJURP	HJURP	psi-mi:“MI:0407”(direct interaction)	0.640
YWHAB	BLTP3B	psi-mi:“MI:2364”(proximity)	0.610
NPM1	NVL	psi-mi:“MI:0914”(association)	0.610
NPM1	MPHOSPH10	psi-mi:“MI:0914”(association)	0.610
CENPA	NPM1	psi-mi:“MI:0914”(association)	0.600
CENPA	NPM1	psi-mi:“MI:0403”(colocalization)	0.600
YWHAH	BLTP3B	psi-mi:“MI:2364”(proximity)	0.570
WASHC3	WASH3P	psi-mi:“MI:0914”(association)	0.530
RBBP4	TNRC18	psi-mi:“MI:0914”(association)	0.530

BioGRID (160): HJURP (Affinity Capture-RNA), HJURP (Affinity Capture-RNA), HJURP (Affinity Capture-RNA), HJURP (Affinity Capture-MS), HJURP (Affinity Capture-MS), TUBA3C (Affinity Capture-MS), MIS18A (Affinity Capture-MS), DUS1L (Affinity Capture-MS), HJURP (Affinity Capture-MS), HJURP (Affinity Capture-Western), CENPA (Reconstituted Complex), HJURP (Affinity Capture-MS), HJURP (Affinity Capture-MS), DUS1L (Affinity Capture-MS), TUBA3C (Affinity Capture-MS)

ESM2 similar proteins: A0A0A6YY25, A6NGG8, A6X8Z5, B2RQL2, B2RXH4, D3ZMK9, D3ZUE1, E9Q7F2, O08696, O14513, P59598, P97691, Q05860, Q05AH6, Q08050, Q0GGX2, Q0VET5, Q13029, Q2M1Z3, Q3U0P1, Q571I4, Q5PSV9, Q5SSG4, Q5U2M8, Q5VV67, Q63755, Q66H04, Q68DA7, Q69ZL1, Q6DIA7, Q6JPI3, Q6P1D7, Q6PAC4, Q6PG16, Q71F56, Q76N32, Q811R2, Q86YN6, Q86YV5, Q8BJS7

Diamond homologs: Q6PG16, Q8NCD3

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
HJURP	“up-regulates activity”	CENPA	binding
“CENP-A recruiting complex”	“up-regulates activity”	HJURP	binding
AKT	“up-regulates activity”	HJURP	phosphorylation
14-3-3	“up-regulates activity”	HJURP	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 104 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Activation of BAD and translocation to mitochondria	7	80.8×	2e-10
Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex	7	71.2×	3e-10
SARS-CoV-1 targets host intracellular signalling and regulatory pathways	7	71.2×	3e-10
Activation of BH3-only proteins	7	52.7×	2e-09
RHO GTPases activate PKNs	7	33.6×	5e-08
Intrinsic Pathway for Apoptosis	7	31.1×	8e-08
SARS-CoV-1-host interactions	10	26.6×	3e-10
FOXO-mediated transcription	5	25.4×	2e-05

GO biological processes:

GO term	Partners	Fold	FDR
protein targeting	5	20.6×	1e-03
negative regulation of translation	6	13.2×	1e-03
cytoplasmic translation	5	10.4×	8e-03
intracellular protein localization	8	9.4×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

148 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	108
Likely benign	22
Benign	0

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
2671587	Single allele	Pathogenic
3247462	NC_000002.11:g.(?234665659)(234978657_?)del	Pathogenic

SpliceAI

1385 predictions. Top by Δscore:

Variant	Effect	Δscore
2:233847395:A:AC	donor_gain	1.0000
2:233847396:C:CC	donor_gain	1.0000
2:233853842:AC:A	donor_gain	1.0000
2:233853843:CC:C	donor_gain	1.0000
2:233853906:TTGTA:T	acceptor_gain	1.0000
2:233853907:TGTA:T	acceptor_gain	1.0000
2:233853909:TA:T	acceptor_gain	1.0000
2:233853911:C:CC	acceptor_gain	1.0000
2:233853911:CTG:C	acceptor_loss	1.0000
2:233854382:A:AC	donor_gain	1.0000
2:233854383:C:CC	donor_gain	1.0000
2:233854383:C:G	donor_loss	1.0000
2:233854383:CCTT:C	donor_gain	1.0000
2:233837648:CTCCT:C	acceptor_gain	0.9900
2:233837651:CT:C	acceptor_gain	0.9900
2:233837653:C:CC	acceptor_gain	0.9900
2:233840605:CTA:C	donor_loss	0.9900
2:233840606:TA:T	donor_loss	0.9900
2:233840608:CCTCT:C	donor_gain	0.9900
2:233842205:CCTG:C	acceptor_loss	0.9900
2:233842206:C:CC	acceptor_gain	0.9900
2:233842206:C:CG	acceptor_loss	0.9900
2:233845821:C:CC	acceptor_gain	0.9900
2:233845826:C:CT	acceptor_gain	0.9900
2:233845827:A:T	acceptor_gain	0.9900
2:233847396:CTG:C	donor_gain	0.9900
2:233849862:CCAAG:C	acceptor_gain	0.9900
2:233849863:CAAG:C	acceptor_gain	0.9900
2:233849866:G:GC	acceptor_gain	0.9900
2:233849869:C:CT	acceptor_gain	0.9900

AlphaMissense

4881 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:233852607:C:A	W66C	0.992
2:233852607:C:G	W66C	0.992
2:233852609:A:G	W66R	0.992
2:233852609:A:T	W66R	0.992
2:233854414:G:C	F29L	0.991
2:233854414:G:T	F29L	0.991
2:233854416:A:G	F29L	0.991
2:233841028:A:C	F584L	0.984
2:233841028:A:T	F584L	0.984
2:233841030:A:G	F584L	0.984
2:233841466:A:C	F438L	0.984
2:233841466:A:T	F438L	0.984
2:233841468:A:G	F438L	0.984
2:233853896:G:C	F44L	0.982
2:233853896:G:T	F44L	0.982
2:233853898:A:G	F44L	0.982
2:233854415:A:G	F29S	0.982
2:233854394:A:G	L36P	0.978
2:233841997:A:C	S261R	0.976
2:233841997:A:T	S261R	0.976
2:233841999:T:G	S261R	0.976
2:233841992:A:G	L263P	0.974
2:233845775:A:G	Y150H	0.973
2:233852608:C:G	W66S	0.972
2:233853864:A:G	L55P	0.972
2:233841979:C:A	M267I	0.969
2:233841979:C:G	M267I	0.969
2:233841979:C:T	M267I	0.969
2:233841964:G:C	S272R	0.968
2:233841964:G:T	S272R	0.968

dbSNP variants (sampled 300 via entrez): RS1000058633 (2:233851874 C>T), RS1000369947 (2:233844632 G>A), RS1000495596 (2:233838301 C>G,T), RS1000624423 (2:233845265 C>A,T), RS1000656854 (2:233845619 G>A), RS1000728824 (2:233850208 T>C), RS1000764120 (2:233848869 G>A), RS1000771644 (2:233845991 T>C), RS1000816813 (2:233849100 C>T), RS1000887980 (2:233840329 G>GA,GAA), RS1001013483 (2:233851215 G>A), RS1001544094 (2:233844747 C>T), RS1001607898 (2:233849171 T>A), RS1001734197 (2:233854832 C>G,T), RS1001737933 (2:233849174 GGTGGTAAAGGGAACTGGGCAAAGGGAT>G)

Disease associations

OMIM: gene MIM:612667 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST002745_1	Total bilirubin levels in HIV-1 infection	3.000000e-06
GCST003478_1	Hair greying	7.000000e-06
GCST003720_15	Migraine	3.000000e-09
GCST003720_24	Migraine	1.000000e-23
GCST003721_2	Migraine without aura	1.000000e-09
GCST005337_3	Headache	6.000000e-16
GCST009391_650	Metabolite levels	3.000000e-06

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004570	bilirubin measurement
EFO:0010505	isocitrate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

62 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases expression, affects expression	3
Aflatoxin B1	increases methylation, affects expression, decreases expression	3
bisphenol A	decreases expression	2
sodium arsenite	affects methylation, increases expression	2
cobaltous chloride	decreases expression	2
Acetaminophen	increases expression, decreases expression	2
Benzo(a)pyrene	increases methylation, decreases expression	2
Tretinoin	decreases expression	2
Cyclosporine	decreases expression	2
Cadmium Chloride	decreases expression, increases expression	2
aristolochic acid I	decreases expression	1
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
FR900359	affects phosphorylation	1
TAK-243	increases sumoylation	1
propionaldehyde	decreases expression	1
perfluorooctanoic acid	decreases expression	1
zinc chromate	decreases expression, increases abundance	1
ferrous chloride	increases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, increases expression	1
cupric chloride	increases expression	1
coumarin	increases phosphorylation	1
hydroquinone	decreases expression	1
diallyl trisulfide	decreases expression	1
beta-methylcholine	affects expression	1
chromium hexavalent ion	decreases expression, increases abundance	1
2-palmitoylglycerol	increases expression	1
erucylphospho-N,N,N-trimethylpropylammonium	decreases expression	1
ICG 001	decreases expression	1
palbociclib	decreases expression	1
(4-amino-1,4-dihydro-3-(2-pyridyl)-5-thioxo-1,2,4-triazole)copper(II)	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.