HLTF

Summary

HLTF (helicase like transcription factor, HGNC:11099) is a protein-coding gene on chromosome 3q24, encoding DNA-dependent ATPase/E3 ubiquitin-protein ligase HLTF (Q14527). Functions as a DNA-dependent ATPase and E3 ubiquitin-protein ligase involved in chromatin regulation and DNA damage tolerance (DDT).

This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein.

Source: NCBI Gene 6596 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 179 total
• MANE Select transcript: NM_003071

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:11099
Approved symbol	HLTF
Name	helicase like transcription factor
Location	3q24
Locus type	gene with protein product
Status	Approved
Aliases	HIP116A, HLTF1, RNF80
Ensembl gene	ENSG00000071794
Ensembl biotype	protein_coding
OMIM	603257
Entrez	6596

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 6 protein_coding, 2 retained_intron, 2 protein_coding_CDS_not_defined

ENST00000310053, ENST00000392912, ENST00000465259, ENST00000467858, ENST00000472830, ENST00000481663, ENST00000493881, ENST00000494055, ENST00000497427, ENST00000911718

RefSeq mRNA: 4 — MANE Select: NM_003071 NM_001318934, NM_001318935, NM_003071, NM_139048

CCDS: CCDS33875, CCDS82856

Canonical transcript exons

ENST00000310053 — 25 exons

Exon	Start	End
ENSE00000484047	149068240	149068335
ENSE00000484054	149060779	149060858
ENSE00000779429	149040031	149040156
ENSE00000779431	149042166	149042290
ENSE00000779432	149046080	149046259
ENSE00000779433	149048028	149048163
ENSE00000779434	149048863	149049001
ENSE00000779435	149050232	149050375
ENSE00000779479	149063431	149063524
ENSE00000779486	149064791	149064866
ENSE00000779488	149071252	149071443
ENSE00000779495	149071583	149071657
ENSE00000779496	149073225	149073322
ENSE00000779497	149074215	149074348
ENSE00000779498	149075881	149076047
ENSE00001077967	149034918	149034998
ENSE00001351682	149030127	149032372
ENSE00001852120	149086317	149086533
ENSE00002242845	149041490	149041668
ENSE00003484914	149039049	149039229
ENSE00003504665	149059718	149059807
ENSE00003528131	149060643	149060687
ENSE00003558771	149039581	149039693
ENSE00003570796	149055303	149055400
ENSE00003665045	149084682	149084889

Expression profiles

Bgee: expression breadth ubiquitous, 299 present calls, max score 96.63.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 38.0572 / max 483.0079, expressed in 1790 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
44997	38.0572	1790

Top tissues by expression

300 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	96.63	gold quality
pons	UBERON:0000988	96.48	gold quality
adrenal tissue	UBERON:0018303	96.30	gold quality
lateral nuclear group of thalamus	UBERON:0002736	96.22	gold quality
substantia nigra pars compacta	UBERON:0001965	96.13	gold quality
choroid plexus epithelium	UBERON:0003911	96.11	gold quality
substantia nigra pars reticulata	UBERON:0001966	95.87	gold quality
subthalamic nucleus	UBERON:0001906	95.49	gold quality
superior vestibular nucleus	UBERON:0007227	95.44	gold quality
lateral globus pallidus	UBERON:0002476	94.96	gold quality
medulla oblongata	UBERON:0001896	94.26	gold quality
pigmented layer of retina	UBERON:0001782	93.95	gold quality
cerebellar vermis	UBERON:0004720	93.95	gold quality
retina	UBERON:0000966	93.92	gold quality
dorsal plus ventral thalamus	UBERON:0001897	93.41	gold quality
corpus callosum	UBERON:0002336	93.18	gold quality
inferior vagus X ganglion	UBERON:0005363	92.65	gold quality
calcaneal tendon	UBERON:0003701	92.52	gold quality
ventral tegmental area	UBERON:0002691	92.46	gold quality
tibia	UBERON:0000979	92.35	gold quality
trigeminal ganglion	UBERON:0001675	92.11	gold quality
inferior olivary complex	UBERON:0002127	91.74	gold quality
parotid gland	UBERON:0001831	91.67	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.64	gold quality
testis	UBERON:0000473	91.61	gold quality
postcentral gyrus	UBERON:0002581	91.58	gold quality
right testis	UBERON:0004534	91.57	gold quality
biceps brachii	UBERON:0001507	91.55	gold quality
ventricular zone	UBERON:0003053	91.53	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	91.53	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-CURD-112	yes	8.14
E-ANND-3	yes	8.13

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

8 targets.

Target	Regulation
CDKN2B
CHFR
HBB	Activation
HERC2	Unknown
HLTF
OCA2	Activation
PRL
SERPINE1	Unknown

Upstream regulators (CollecTRI, top): E2F4, HLTF, PGR, SP1

miRNA regulators (miRDB)

142 targeting HLTF, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-1184	99.99	68.19	1458
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-4650-5P	99.98	64.69	999
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502
HSA-MIR-548AK	99.94	71.24	3488
HSA-MIR-548AM-5P	99.94	71.24	3488
HSA-MIR-548AP-5P	99.94	71.14	3489
HSA-MIR-548AQ-5P	99.94	71.34	3426
HSA-MIR-548AR-5P	99.94	71.28	3515

Literature-anchored findings (GeneRIF, showing 40)

• SMARCA3 is the human gene for RUSH transcription factors (U66564, U66565; Mol Endocrinol, 1996, 10:1335-1349). A binding partner has been cloned and characterized (AF236061; JBC, 2001, 276:3641-3649). (PMID:11058586)
• HLTF/SMARCA3, a member of SWI/SNF family, is a common target for methylation and epigenetic gene silencing in colon cancer and a candidate colon cancer suppressor gene. (PMID:11904375)
• These results suggest that HLTF promoter hypermethylation is frequently demonstrated in human gastric cancer, and inactivation of HLTF or the chromatin-remodeling complex may play a crucial role in gastric carcinogenesis. (PMID:12766908)
• Acetylation of histones H3 and H4 in the 5’ CpG island of the HLTF gene were inversely associated with DNA methylation status. (PMID:12901794)
• Methylation helicase-like transcription factor is associated with advanced esophageal squamous cell carcinoma (PMID:17094449)
• HLTF activation was recently linked to the initial steps of carcinogenesis in an experimental model of estrogen-induced kidney tumor. [REVIEW] (PMID:18034322)
• HLTF physically interacts with the Rad6-Rad18 and Mms2-Ubc13 ubiquitin-conjugating enzyme complexes and promotes the Lys-63-linked polyubiquitination of proliferating cell nuclear antigen at its Lys-164 residue. (PMID:18316726)
• Splice arrays and RT-PCR showed that although most splice variants in RUSH and ATP11B are conserved in human and rabbit, the RFBP isoform is specific to rabbit. (PMID:18584949)
• HLTF and SHPRH are functional homologues of yeast Rad5 that cooperatively mediate PCNA polyubiquitination and maintain genomic stability. (PMID:18719106)
• There is an association between the presence of helicase-like transcription factor and neoplastic progression of hypopharyngeal and laryngeal squamous cell carcinomas. (PMID:18825407)
• Hypopharyngeal squamous cell carcinomas presenting high levels of HLTF have a worse prognosis. (PMID:19614770)
• biochemical characterisation of cellular HLTF is described. (PMID:19723507)
• HLTF can promote error-free replication of damaged DNA and support a role for HLTF in preventing mutagenesis and carcinogenesis, providing thereby for its potential tumor suppressor role. (PMID:19948885)
• this is the first report identifying the regulatory mechanism of HLTF by CHFR, suggesting that CHFR-mediated downregulation of HLTF may help protect against cancer. (PMID:20388495)
• results suggest that HLTF is involved in DNA repair and apoptosis in cancer cells, which might represent a target for gene therapies of human cancer (PMID:20535496)
• HLTF and SHPRH suppress mutagenesis in a damage-specific manner, preventing mutations induced by UV rays and methyl methanesulfonate. (PMID:21396873)
• HLTF can displace a broad spectrum of proteins such as replication protein A (RPA), PCNA, and replication factor C (RFC), thereby providing the first example for a protein clearing activity at the stalled replication fork. (PMID:21795603)
• results delineate a previously unknown USP7-HLTF-PCNA molecular network controlling DNA damage response (PMID:21845734)
• Results demonstrate that loss of HLTF function promotes the malignant transformation of intestinal or colonic adenomas to carcinomas by inducing genomic instability. (PMID:22452792)
• We were able to provide evidence that methylation of HLTF and especially HPP1 detected in serum is strongly correlated with cell death in CRC using LDH as surrogate marker (PMID:24708595)
• Study demonstrates a correlation between HLTF expression level and thyroid neoplastic progression where three truncated forms are detected in thyroid carcinoma. (PMID:25005870)
• These results suggest that the HIRAN domain functions as a sensor to the 3’-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. (PMID:25858588)
• Findings indicate a mechanism of helicase-like transcription factor HLTF-mediated fork reversal and suggest the requirement for distinct fork remodeling activities in the cell. (PMID:26051180)
• HLTF promotes the filling-in of gaps left opposite damaged DNA during replication, and this postreplication repair function depends on its HIRAN domain. (PMID:26350214)
• HLTF expression is altered in various cancers via two mechanisms: gene silencing through promoter hypermethylation or alternative mRNA splicing, which leads to the expression of truncated proteins that lack DNA repair domains. [review] (PMID:26472339)
• HLTF is degraded in lymphocytic cells and macrophages infected with Vpr-expressing HIV-1. Our results reveal a previously unidentified strategy for HIV-1 to antagonize DNA repair in host cells. (PMID:27114546)
• HIV-1 vpr reprograms CRL4(DCAF1) E3 to direct HLTF for proteasome-dependent degradation independent from previously reported Vpr interactions with base excision repair enzyme uracil DNA glycosylase (UNG2) and crossover junction endonuclease MUS81, which Vpr also directs for degradation via CRL4(DCAF1) E3. (PMID:27335459)
• Fasudil reduced LPS-mediated TF and PAI-1 expression and activity in PBMCs. These effects may partially be relevant to the clinical benefits of fasudil in the treatment of CAPD patients. (PMID:27756191)
• the present study does not provide any strong evidence that PAI-1 gene variants are implicated in the risk of DR or the development of DR during T2DM course. (PMID:28632032)
• A large number of SNF2 family, DNA and ATP-dependent motor proteins are needed during transcription, DNA replication, and DNA repair to manipulate protein-DNA interactions and change DNA structure. SMARCAL1, ZRANB3, and HLTF are three related members of this family with specialized functions that maintain genome stability during DNA replication. [review] (PMID:28954549)
• ALDH1A1 overexpression was found to enhance Lysosomal autophagy inhibitors (LAI) cell entry and cytotoxicity without directly affecting lysosome function or autophagic flux. Expression of HLTF allows repair of DNA damage caused by LAI-induced reactive oxygen species, leading to hydroxychloroquine resistance. (PMID:28981387)
• depletion of SMARCAL1, a SNF2-family DNA translocase that remodels stalled forks, restores replication fork stability and reduces the formation of replication stress-induced DNA breaks and chromosomal aberrations in BRCA1/2-deficient cells. In addition to SMARCAL1, other SNF2-family fork remodelers, including ZRANB3 and HLTF, cause nascent DNA degradation and genomic instability (PMID:29053959)
• Data suggest that HIV-1 vpr mediates polyubiquitination of HLTF by directly loading it onto C-terminal WD40 domain of DCAF1 in complex the CRL4, an E3 ubiquitin ligase. (vpr = vpr gene product of Human immunodeficiency virus 1; HLTF = human helicase like transcription factor; DCAF1 = human Vpr (HIV-1) binding protein; CRL4 = human E3 ubiquitin ligase CRL4) (PMID:29079575)
• A low WT HLTF expression with a high I21R HLTF expression is associated with a poor disease-free survival (PMID:29661164)
• HLTF depletion suppresses fork degradation in FANCJ-deficient cells. Combined loss of HLTF and FANCJ causes severe replication stress. (PMID:30232006)
• Study suggest that HLTF functions as a tumor suppressor gene in colorectal cancer (CRC). HLTF downregulation promotes the migration and invasion of CRC cells in vitro. Furthermore, HLTF expression is negatively associated with overall survival in patients with CRC. HLTF may suppress the migration and invasion of CRC cells by targeting TGFbeta/SMAD signaling. (PMID:30320371)
• Regulation of HLTF-mediated PCNA polyubiquitination by RFC and PCNA monoubiquitination levels determines choice of damage tolerance pathway. (PMID:30335157)
• HLTF E259K germline mutation induces accumulation of DNA double-strand breaks, possibly through impaired PCNA polyubiquitination and is associated with myelodysplastic syndromes. (PMID:30696947)
• HIV-1 Vpr counteracts HLTF-mediated restriction of HIV-1 infection in T cells. (PMID:31019079)
• The direct effect of Rad5 on replication forks in vivo, increased recombination, and cisplatin sensitivity predicts similar consequences for dysregulated HLTF in cancer. (PMID:31350889)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	hltf	ENSDARG00000026053
mus_musculus	Hltf	ENSMUSG00000002428
rattus_norvegicus	Hltf	ENSRNOG00000000082

Paralogs (30): SMARCA2 (ENSG00000080503), SRCAP (ENSG00000080603), ATRX (ENSG00000085224), RAD54L (ENSG00000085999), BTAF1 (ENSG00000095564), CHD8 (ENSG00000100888), SMARCA1 (ENSG00000102038), CHD4 (ENSG00000111642), CHD5 (ENSG00000116254), TTF2 (ENSG00000116830), HELLS (ENSG00000119969), ZRANB3 (ENSG00000121988), CHD6 (ENSG00000124177), SMARCA4 (ENSG00000127616), INO80 (ENSG00000128908), CHD1L (ENSG00000131778), SMARCAL1 (ENSG00000138375), SHPRH (ENSG00000146414), SMARCA5 (ENSG00000153147), CHD1 (ENSG00000153922), SMARCAD1 (ENSG00000163104), RAD54L2 (ENSG00000164080), CHD3 (ENSG00000170004), CHD7 (ENSG00000171316), CHD2 (ENSG00000173575), CHD9 (ENSG00000177200), EP400 (ENSG00000183495), ERCC6L (ENSG00000186871), RAD54B (ENSG00000197275), ERCC6 (ENSG00000225830)

Protein

Protein identifiers

DNA-dependent ATPase/E3 ubiquitin-protein ligase HLTF — Q14527 (reviewed: Q14527)

Alternative names: DNA-binding protein/plasminogen activator inhibitor 1 regulator, HIP116, Helicase-like transcription factor, RING finger protein 80, RING-type E3 ubiquitin transferase HLTF, SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3, Sucrose nonfermenting protein 2-like 3

All UniProt accessions (3): Q14527, A0A0C4DGA6, H7C5K0

UniProt curated annotations — full annotation on UniProt →

Function. Functions as a DNA-dependent ATPase and E3 ubiquitin-protein ligase involved in chromatin regulation and DNA damage tolerance (DDT). Catalyzes ‘Lys-63’-linked polyubiquitination of monoubiquitinated PCNA at ‘Lys-164’ in response to genotoxic stress, promoting error-free postreplication repair via template switching. Acts as an epigenetic regulator by promoting recruitment of DNMT1, thereby ensuring DNA methylation inheritance: specifically binds histone H3 trimethylated at ‘Lys-9’ (H3K9me3) and mediates histone H3 ‘Lys-23’ polyubiquitination (H3K23ub), a docking site for DNMT1, leading to DNMT1 recruitment and replication-coupled DNA methylation maintenance. Catalyzes formation of H3K23ub in two steps: first mediates monoubiquitination together with UBE2E1 and UBE2D2, and then extends ubiquitin chains via ‘Lys-63’-linked ubiquitination together with UBE2N and UBE2V2. Also acts as a chromatin redodeling factor, thereby regulating transcription. Exhibits ATP-dependent double-stranded DNA (dsDNA) translocase activity but lacks classical helicase activity; mediates replication fork reversal by concertedly unwinding and annealing nascent and parental strands, thereby suppressing DNA synthesis and maintaining genomic stability. Resolves G-quadruplex (G4) DNA structures in cooperation with MSH2, limiting replication stress and G4 accumulation across the cell cycle. Contributes to nucleotide excision repair by evicting lesion-containing oligonucleotides using its HIRAN and ATPase domains. Can displace single-stranded DNA from triplex structures through ATP-dependent dsDNA translocation. Also has protein clearing activity at the stalled replication fork, facilitating restart of DNA replication.

Subunit / interactions. Interacts with SP1 and SP3 independently of DNA; the interaction with these transcriptional factors may be required for basal transcription of target genes. Interacts with EGR1; the interaction requires prior binding to DNA and represses c-Rel via a DNA looping mechanism. Interacts with GATA4. Interacts with PCNA; the interaction promotes polyubiquitination of PCNA through association with the UBE2B-RAD18 and UBE2V2-UBE2N ubiquitin ligase complexes. Interacts with RAD18, SHPRH, UBE2V2 and UBE2N.

Subcellular location. Nucleus. Chromosome.

Tissue specificity. Expressed in brain, heart, kidney, liver, lung, pancreas, placenta and skeletal muscle.

Domain organisation. HLTF contains several specialized domains that coordinate its roles in DNA repair and chromatin remodeling. The HIRAN domain recognizes 3’-hydroxyl groups at replication forks, enabling precise binding to the nascent leading strand through interactions with purine bases in syn conformation. This domain initiates replication fork regression by unwinding three nucleobases via Phe-142-mediated strand separation, positioning the ATPase motor for subsequent DNA remodeling. The RING domain confers E3 ubiquitin ligase activity, facilitating ‘Lys-63’-linked polyubiquitination of PCNA to activate error-free DNA damage tolerance pathways. The SWI/SNF ATPase domain drives double-stranded DNA translocation, enabling replication fork reversal through coordinated unwinding/annealing of parental and nascent strands. This domain also displaces DNA-bound proteins during fork remodeling and resolves G-quadruplex structures to prevent replication stress.

Induction. Subject to frequent epigenetic gene silencing by promoter methylation in colon cancer.

Pathway. Protein modification; protein ubiquitination.

Similarity. Belongs to the SNF2/RAD54 helicase family. RAD16 subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
Q14527-1	1	yes
Q14527-2	2

RefSeq proteins (4): NP_001305863, NP_001305864, NP_003062, NP_620636 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000330	SNF2_N	Domain
IPR001650	Helicase_C-like	Domain
IPR001841	Znf_RING	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR014001	Helicase_ATP-bd	Domain
IPR014905	HIRAN	Domain
IPR017907	Znf_RING_CS	Conserved_site
IPR027417	P-loop_NTPase	Homologous_superfamily
IPR038718	SNF2-like_sf	Homologous_superfamily
IPR049730	SNF2/RAD54-like_C	Domain
IPR050628

Pfam: PF00176, PF00271, PF08797, PF13923

Catalyzed reactions (Rhea), 1 shown:

• ATP + H2O = ADP + phosphate + H(+) (RHEA:13065)

UniProt features (54 total): mutagenesis site 11, modified residue 6, sequence conflict 6, strand 6, binding site 5, helix 5, sequence variant 3, region of interest 3, domain 2, cross-link 2, chain 1, splice variant 1, zinc finger region 1, short sequence motif 1, compositionally biased region 1

Structure

Experimental structures (PDB)

9 structures.

PDB	Method	Resolution (Å)
4XZF	X-RAY DIFFRACTION	1.38
4S0N	X-RAY DIFFRACTION	1.5
5BNH	X-RAY DIFFRACTION	1.7
6KCS	X-RAY DIFFRACTION	2.1
4XZG	X-RAY DIFFRACTION	2.4
4HRE	X-RAY DIFFRACTION	2.79
4HRH	X-RAY DIFFRACTION	3
2MZN	SOLUTION NMR
5K5F	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q14527-F1	68.74	0.18

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (5): 90; 99; 142; 448–455; 88

Post-translational modifications (8): 27, 195, 397, 398, 400, 736, 112, 211

Mutagenesis-validated functional residues (11):

Position	Phenotype
71	no effect on suppression of g4 accumulation. loss of ssdna-binding. no effect on atpase activity. decreases dna fork reg
72	decreases ssdna-binding, no effect on atpase activity and decreases dna fork regression activity.; when associated with
91	strongly decreases ssdna-binding.
93	decreases ssdna-binding, no effect on atpase activity and decreases dna fork regression activity; when associated with a
94	strongly decreases ssdna-binding. no effect on atpase activity. decreases dna fork regression activity.
110	strongly decreases ssdna-binding. no effect on atpase activity. decreases dna fork regression activity.
113	strongly decreases ssdna-binding.
142	loss of dsdna-binding. decreases ssdna-binding.
557–558	loss of atpase activity. loss of dna fork regression activity. impairs replication fork restart after dna damage. abolis
760	abolished e3 ubiquitin-protein ligase activity. impairs replication fork restart after dna damage. no effect on suppress
890	no effect on chromatin-binding. loss of suppression of g4 accumulation.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-8866654	E3 ubiquitin ligases ubiquitinate target proteins

MSigDB gene sets: 280 (showing top): GOBP_DNA_TEMPLATED_DNA_REPLICATION_MAINTENANCE_OF_FIDELITY, chr3q24, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, GOBP_NEUROGENESIS, BROWNE_HCMV_INFECTION_16HR_UP, GOBP_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, PATIL_LIVER_CANCER, GOCC_NUCLEAR_REPLICATION_FORK, BROWNE_HCMV_INFECTION_24HR_UP, GOBP_PROTEIN_LOCALIZATION_TO_CHROMATIN, GOBP_PROTEIN_LOCALIZATION_TO_CHROMOSOME, PETRETTO_HEART_MASS_QTL_CIS_DN, AAAGACA_MIR511, GOBP_DNA_DAMAGE_RESPONSE, PYEON_CANCER_HEAD_AND_NECK_VS_CERVICAL_UP

GO Biological Process (12): protein polyubiquitination (GO:0000209), DNA repair (GO:0006281), DNA damage response (GO:0006974), protein ubiquitination (GO:0016567), mRNA transcription by RNA polymerase II (GO:0042789), positive regulation of transcription by RNA polymerase II (GO:0045944), regulation of neurogenesis (GO:0050767), protein K63-linked ubiquitination (GO:0070534), protein localization to chromatin (GO:0071168), replication fork reversal (GO:0071932), chromosomal DNA methylation maintenance following DNA replication (GO:0141119), chromatin organization (GO:0006325)

GO Molecular Function (22): single-stranded DNA binding (GO:0003697), RNA binding (GO:0003723), helicase activity (GO:0004386), ATP binding (GO:0005524), ATP-dependent activity, acting on DNA (GO:0008094), zinc ion binding (GO:0008270), DNA translocase activity (GO:0015616), hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides (GO:0016818), ubiquitin protein ligase binding (GO:0031625), ubiquitin protein ligase activity (GO:0061630), histone H3K9me2/3 reader activity (GO:0062072), histone H3K23 ubiquitin ligase activity (GO:0140234), ATP-dependent chromatin remodeler activity (GO:0140658), G-quadruplex unwinding activity (GO:0160225), nucleotide binding (GO:0000166), nucleic acid binding (GO:0003676), DNA binding (GO:0003677), catalytic activity (GO:0003824), protein binding (GO:0005515), transferase activity (GO:0016740), hydrolase activity (GO:0016787), metal ion binding (GO:0046872)

GO Cellular Component (10): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), nucleolus (GO:0005730), cytoplasm (GO:0005737), plasma membrane (GO:0005886), membrane (GO:0016020), nuclear matrix (GO:0016363), nuclear replication fork (GO:0043596), RNA polymerase II transcription regulator complex (GO:0090575)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Protein ubiquitination	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
DNA binding	3
nuclear lumen	3
transcription by RNA polymerase II	2
nucleic acid binding	2
catalytic activity, acting on a nucleic acid	2
ATP-dependent activity	2
ATP-dependent activity, acting on DNA	2
binding	2
protein ubiquitination	1
DNA metabolic process	1
DNA damage response	1
cellular response to stress	1
protein modification by small protein conjugation	1
mRNA transcription	1
regulation of transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
neurogenesis	1
regulation of nervous system development	1
regulation of cell development	1
protein polyubiquitination	1
protein localization to chromosome	1
replication fork processing	1
chromatin organization	1
cellular component organization	1
nucleic acid conformation isomerase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
ATP hydrolysis activity	1
catalytic activity, acting on DNA	1
transition metal ion binding	1
hydrolase activity, acting on acid anhydrides	1
ubiquitin-like protein ligase binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein ligase activity	1
histone H3 reader activity	1
histone H3 ubiquitin ligase activity	1
chromatin remodeling	1
nucleoside phosphate binding	1
heterocyclic compound binding	1

Protein interactions and networks

STRING

3048 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HLTF	UBE2N	P61088	953
HLTF	RAD18	Q9NS91	952
HLTF	UBE2V2	Q15819	913
HLTF	HERC2	O95714	811
HLTF	FANCM	Q8IYD8	783
HLTF	RABGGTA	Q92696	761
HLTF	ANXA2	P07355	744
HLTF	MUS81	Q96NY9	725
HLTF	PRIMPOL	Q96LW4	688
HLTF	RAD51	Q06609	666
HLTF	OCA2	Q04671	662
HLTF	FBH1	Q8NFZ0	649
HLTF	RAD52	P43351	647
HLTF	DNA2	P51530	642
HLTF	ZRANB3	Q5FWF4	620

IntAct

108 interactions, top by confidence:

A	B	Type	Score
XRCC6	XRCC5	psi-mi:“MI:0914”(association)	0.970
DLD	PDHX	psi-mi:“MI:0914”(association)	0.880
RNF146	TNKS	psi-mi:“MI:0914”(association)	0.790
H2AX	PPM1G	psi-mi:“MI:0914”(association)	0.730
HLTF	UBE2N	psi-mi:“MI:0914”(association)	0.680
UBE2N	HLTF	psi-mi:“MI:0915”(physical association)	0.680
HLTF	UBE2N	psi-mi:“MI:0915”(physical association)	0.680
H2AC4	PPM1G	psi-mi:“MI:0914”(association)	0.670
CSNK2B	NMT2	psi-mi:“MI:0914”(association)	0.660
NCBP2	KPNA3	psi-mi:“MI:0914”(association)	0.640
H2BC1	PPM1G	psi-mi:“MI:0914”(association)	0.640
RAD18	HLTF	psi-mi:“MI:0915”(physical association)	0.620
HLTF	PCNA	psi-mi:“MI:0914”(association)	0.560
PCNA	HLTF	psi-mi:“MI:0915”(physical association)	0.560
SMC1A	PDS5B	psi-mi:“MI:0914”(association)	0.530
TUBB3	POTEF	psi-mi:“MI:0914”(association)	0.530
PDCD1	RTL8C	psi-mi:“MI:0914”(association)	0.530
PMPCA	CLUH	psi-mi:“MI:0914”(association)	0.530
RNF166	MPDZ	psi-mi:“MI:0914”(association)	0.530
FAM174A	BLTP3B	psi-mi:“MI:0914”(association)	0.530
IMPDH1	BCAT2	psi-mi:“MI:0914”(association)	0.530
SLCO4C1	CLGN	psi-mi:“MI:0914”(association)	0.530
HLTF		psi-mi:“MI:0915”(physical association)	0.500
S100A10	HLTF	psi-mi:“MI:0407”(direct interaction)	0.440
HLTF	S100A10	psi-mi:“MI:0407”(direct interaction)	0.440

BioGRID (209): HLTF (Affinity Capture-MS), UBC (Biochemical Activity), UBE2V2 (Reconstituted Complex), UBE2N (Reconstituted Complex), PCNA (Biochemical Activity), UBE2A (Biochemical Activity), UBE2N (Biochemical Activity), HLTF (Reconstituted Complex), HLTF (Affinity Capture-MS), HLTF (Affinity Capture-MS), HLTF (Affinity Capture-MS), HLTF (Affinity Capture-MS), HLTF (Affinity Capture-MS), HLTF (Affinity Capture-MS), HLTF (Affinity Capture-MS)

ESM2 similar proteins: A0A023PXF5, A6QSQ0, A6SBT4, A7EY76, F1RCY6, O13559, O18475, O48534, P18708, P40105, P40434, P40889, P43538, P46063, P46459, P46460, P46461, P54351, Q14527, Q1EB85, Q2TBP1, Q2U587, Q3B7N1, Q3E7Y4, Q5R410, Q5RF63, Q6AYJ1, Q6PCN7, Q7ZU90, Q86WJ1, Q8NHQ9, Q8R5F7, Q95216, Q96C10, Q99J87, Q9BYX4, Q9CXF7, Q9DGP9, Q9EPU0, Q9FF61

Diamond homologs: A0JN86, B3DK16, P23798, P25916, P35226, P35227, Q07G17, Q0WX00, Q14527, Q1JPS1, Q28H21, Q2KJ29, Q2YDF9, Q32KX7, Q3KNV8, Q3UK78, Q4QR06, Q5R8L2, Q5SDR3, Q5XI70, Q640D5, Q6CJM4, Q6DLV9, Q7T3E6, Q7ZYZ7, Q86SE9, Q8BTQ0, Q8JIR0, Q8R023, Q91648, Q94AY3, Q99NA9, Q9BSM1, Q9BYE7, Q9FKW0, Q9LS86, Q9M9Y4, Q9TST0, A0A0P0WGX7, A1C9W6

SIGNOR signaling

5 interactions.

A	Effect	B	Mechanism
HLTF	“up-regulates quantity by expression”	HBB	“transcriptional regulation”
HLTF	“up-regulates quantity by expression”	OCA2	“transcriptional regulation”
Ub:E2	“up-regulates activity”	HLTF	ubiquitination
CHFR	“down-regulates quantity by destabilization”	HLTF	polyubiquitination
HLTF	“up-regulates activity”	PCNA	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 137 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Dual Incision in GG-NER	5	13.8×	4e-03
Nonhomologous End-Joining (NHEJ)	6	10.7×	3e-03
E3 ubiquitin ligases ubiquitinate target proteins	5	10.3×	9e-03
Pre-NOTCH Transcription and Translation	7	9.1×	2e-03
Transcriptional regulation of granulopoiesis	6	8.0×	9e-03
mRNA Splicing	6	7.0×	1e-02
Regulation of PD-L1(CD274) transcription	6	6.9×	1e-02
CHD1 and CHD2 subfamily	6	6.9×	1e-02

GO biological processes:

GO term	Partners	Fold	FDR
DNA repair	11	6.0×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

179 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	124
Likely benign	21
Benign	8

Top pathogenic / likely-pathogenic (0)

SpliceAI

3350 predictions. Top by Δscore:

Variant	Effect	Δscore
3:149032369:TGAA:T	acceptor_gain	1.0000
3:149032371:AAC:A	acceptor_loss	1.0000
3:149032372:ACTTT:A	acceptor_loss	1.0000
3:149032373:C:CC	acceptor_gain	1.0000
3:149032374:T:C	acceptor_gain	1.0000
3:149032375:T:C	acceptor_gain	1.0000
3:149032375:T:TC	acceptor_gain	1.0000
3:149034916:A:AC	donor_gain	1.0000
3:149034917:C:CA	donor_gain	1.0000
3:149039041:CTACT:C	donor_loss	1.0000
3:149039042:TACTT:T	donor_loss	1.0000
3:149039043:ACTTA:A	donor_loss	1.0000
3:149039045:TT:T	donor_loss	1.0000
3:149039046:TA:T	donor_loss	1.0000
3:149039047:A:AC	donor_gain	1.0000
3:149039048:C:A	donor_loss	1.0000
3:149039048:C:CA	donor_gain	1.0000
3:149039048:CTGG:C	donor_gain	1.0000
3:149039048:CTGGA:C	donor_gain	1.0000
3:149039097:TC:T	donor_gain	1.0000
3:149039098:CC:C	donor_gain	1.0000
3:149039225:AGGCT:A	acceptor_gain	1.0000
3:149039226:GGCT:G	acceptor_gain	1.0000
3:149039228:CT:C	acceptor_gain	1.0000
3:149039230:C:CC	acceptor_gain	1.0000
3:149039230:C:CG	acceptor_loss	1.0000
3:149039231:T:A	acceptor_loss	1.0000
3:149039574:AACTT:A	donor_loss	1.0000
3:149039575:ACTTA:A	donor_loss	1.0000
3:149039576:CTTAC:C	donor_loss	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000068981 (3:149050055 A>C), RS1000128086 (3:149057545 C>T), RS1000188918 (3:149037100 A>T), RS1000231412 (3:149035815 G>A), RS1000279234 (3:149082286 G>A), RS1000313368 (3:149075309 G>A), RS1000368673 (3:149082105 A>C,G), RS1000371528 (3:149084006 GAGATTTTATTACAA>G,GAGATTTTATTACAAAGATTTTATTACAA), RS1000425379 (3:149030745 C>T), RS1000472620 (3:149038618 C>T), RS1000496840 (3:149084515 C>A), RS1000509323 (3:149029686 T>A,C), RS1000522651 (3:149085006 T>C), RS1000546324 (3:149052552 T>C), RS1000607448 (3:149083687 A>T)

Disease associations

OMIM: gene MIM:603257 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

52 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, increases expression	4
Benzo(a)pyrene	increases expression, affects methylation, decreases expression	3
Particulate Matter	decreases expression, increases abundance, increases expression	3
Cyclosporine	decreases expression	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
TAK-243	increases sumoylation	1
dicrotophos	decreases expression	1
lasiocarpine	increases metabolic processing, decreases expression	1
oxybenzone	increases expression	1
triphenyl phosphate	affects expression	1
arsenite	decreases reaction, affects binding	1
sodium arsenite	affects cotreatment, decreases expression, increases abundance	1
perfluorooctanoic acid	decreases expression	1
manganese chloride	decreases expression, increases abundance, affects cotreatment	1
potassium chromate(VI)	decreases expression, affects cotreatment	1
beta-methylcholine	affects expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
antimonite	increases abundance, increases expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	decreases expression	1
2,3,5-(triglutathion-S-yl)hydroquinone	decreases ADP-ribosylation	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
motexafin gadolinium	decreases expression, affects cotreatment	1
abrine	decreases expression	1
jinfukang	decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Decitabine	affects methylation	1
Acetaminophen	decreases expression	1

Cellosaurus cell lines

5 cell lines: 5 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_DX46	HAP1 HLTF (-) SHPRH (-) 1	Cancer cell line	Male
CVCL_DX47	HAP1 HLTF (-) SHPRH (-) 2	Cancer cell line	Male
CVCL_SR50	HAP1 HLTF (-) 1	Cancer cell line	Male
CVCL_SR51	HAP1 HLTF (-) 2	Cancer cell line	Male
CVCL_SR52	HAP1 HLTF (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.