HNRNPCL4

Summary

HNRNPCL4 (heterogeneous nuclear ribonucleoprotein C like 4, HGNC:51333) is a protein-coding gene on chromosome 1p36.21, encoding Heterogeneous nuclear ribonucleoprotein C-like 4 (P0DMR1).

Predicted to enable RNA binding activity. Predicted to be active in nucleus.

Source: NCBI Gene 101060301 — RefSeq curated summary.

At a glance

• MANE Select transcript: NM_001302551

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:51333
Approved symbol	HNRNPCL4
Name	heterogeneous nuclear ribonucleoprotein C like 4
Location	1p36.21
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000179412
Ensembl biotype	protein_coding
Entrez	101060301

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000323770

RefSeq mRNA: 1 — MANE Select: NM_001302551 NM_001302551

CCDS: CCDS76107

Canonical transcript exons

ENST00000323770 — 1 exons

Exon	Start	End
ENSE00001226412	13163914	13165631

Expression profiles

Bgee: expression breadth tissue_specific, 3 present calls, max score 83.02.

Top tissues by expression

116 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	83.02	gold quality
ventricular zone	UBERON:0003053	47.70	silver quality
stromal cell of endometrium	CL:0002255	40.17	gold quality
ganglionic eminence	UBERON:0004023	39.42	silver quality
colonic epithelium	UBERON:0000397	37.20	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
sural nerve	UBERON:0015488	36.32	gold quality
bone marrow cell	CL:0002092	36.16	gold quality
granulocyte	CL:0000094	35.54	gold quality
skeletal muscle tissue	UBERON:0001134	34.79	gold quality
muscle tissue	UBERON:0002385	33.34	gold quality
mucosa of stomach	UBERON:0001199	32.53	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
bone marrow	UBERON:0002371	31.74	gold quality
prefrontal cortex	UBERON:0000451	29.68	gold quality
liver	UBERON:0002107	29.52	gold quality
blood	UBERON:0000178	29.42	gold quality
leukocyte	CL:0000738	29.35	gold quality
lymph node	UBERON:0000029	28.68	gold quality
monocyte	CL:0000576	28.42	gold quality
duodenum	UBERON:0002114	28.14	gold quality
urinary bladder	UBERON:0001255	27.69	gold quality
islet of Langerhans	UBERON:0000006	27.32	gold quality
tonsil	UBERON:0002372	27.05	gold quality
superior frontal gyrus	UBERON:0002661	26.95	gold quality
muscle of leg	UBERON:0001383	26.79	gold quality
kidney	UBERON:0002113	26.65	gold quality
vermiform appendix	UBERON:0001154	26.42	gold quality
adult mammalian kidney	UBERON:0000082	26.20	gold quality
gastrocnemius	UBERON:0001388	26.00	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.08

Regulation

Is transcription factor: no

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Hnrnpc	ENSMUSG00000060373
rattus_norvegicus	LOC100911576	ENSRNOG00000011621

Paralogs (6): HNRNPC (ENSG00000092199), RALY (ENSG00000125970), HNRNPCL1 (ENSG00000179172), RALYL (ENSG00000184672), HNRNPCL2 (ENSG00000275774), HNRNPCL3 (ENSG00000277058)

Protein

Protein identifiers

Heterogeneous nuclear ribonucleoprotein C-like 4 — P0DMR1 (reviewed: P0DMR1)

All UniProt accessions (1): P0DMR1

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Nucleus.

Similarity. Belongs to the RRM HNRPC family. RALY subfamily.

RefSeq proteins (1): NP_001289480* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000504	RRM_dom	Domain
IPR012677	Nucleotide-bd_a/b_plait_sf	Homologous_superfamily
IPR017347	hnRNP_C	Family
IPR035979	RBD_domain_sf	Homologous_superfamily
IPR051186	RRM_HNRPC/RALY_subfam	Family

Pfam: PF00076

UniProt features (9 total): compositionally biased region 4, region of interest 2, chain 1, domain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P0DMR1-F1	70.77	0.33

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 1 (showing top): chr1p36

GO Biological Process (0):

GO Molecular Function (2): RNA binding (GO:0003723), nucleic acid binding (GO:0003676)

GO Cellular Component (1): nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
nucleic acid binding	1
binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

2 interactions, top by confidence:

A	B	Type	Score
DYRK2	HNRNPCL2	psi-mi:“MI:2364”(proximity)	0.270

ESM2 similar proteins: B2RXH8, B7ZW38, C0SUW7, F4JP52, F4JQZ3, F4JTI1, F4KIA8, G3V9R8, O48802, O60812, O77768, P07910, P0DMR1, P19600, P93831, Q08BJ2, Q08DJ0, Q0VFL3, Q0VFL7, Q0WNR6, Q0WUR5, Q10MI4, Q149C2, Q3ED78, Q41583, Q5DU00, Q5RA82, Q5VN06, Q5XIN3, Q64012, Q6K641, Q84PB3, Q84UI6, Q86SE5, Q86XZ4, Q8BTF8, Q8K1N4, Q8RWQ4, Q8S4P4, Q8S4P6

Diamond homologs: B2RXH8, B7ZW38, G3V9R8, O60812, O77768, P07910, P0DMR1, P19600, Q08DJ0, Q0VFL7, Q5RA82, Q64012, Q86SE5, Q8BTF8, Q9UKM9, Q9V3V0, Q9Z204, Q16629, Q3T106, Q8BL97, Q9W4D2, P38996, Q13247, Q29RT0, Q3B7L6, Q9WX39, F4JHI7, O22315, P84103, P84104, Q10145, Q3SZR8, Q74ZS6, Q94901, Q9FYB7, Q9LIS2, Q9XFR5, G3V6S8, Q3TWW8, Q6IQ97

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

1942 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:13165306:G:C	F54L	0.999
1:13165306:G:T	F54L	0.999
1:13165308:A:G	F54L	0.999
1:13165312:A:C	F52L	0.999
1:13165312:A:T	F52L	0.999
1:13165314:A:G	F52L	0.999
1:13165411:G:C	F19L	0.998
1:13165411:G:T	F19L	0.998
1:13165413:A:G	F19L	0.998
1:13165346:C:A	G41V	0.996
1:13165357:A:C	F37L	0.995
1:13165357:A:T	F37L	0.995
1:13165359:A:G	F37L	0.995
1:13165304:A:T	V55D	0.993
1:13165307:A:G	F54S	0.993
1:13165358:A:G	F37S	0.993
1:13165412:A:G	F19S	0.991
1:13165307:A:C	F54C	0.990
1:13165310:G:T	A53D	0.990
1:13165400:A:G	L23P	0.990
1:13165400:A:T	L23H	0.990
1:13165271:G:T	A66D	0.989
1:13165406:C:T	G21E	0.989
1:13165298:T:G	Y57S	0.988
1:13165313:A:G	F52S	0.988
1:13164908:A:G	L187S	0.987
1:13165325:A:T	V48D	0.987
1:13165346:C:T	G41D	0.986
1:13165419:G:T	R17S	0.986
1:13165299:A:G	Y57H	0.984

dbSNP variants (sampled 300 via entrez): RS1157975378 (1:13165034 C>A), RS1159387201 (1:13167604 TTG>T), RS1160276584 (1:13165852 A>G), RS1161230734 (1:13165352 T>G), RS1161559832 (1:13166360 T>C), RS1163674977 (1:13165939 T>A), RS1165842038 (1:13166022 C>T), RS1165880850 (1:13165597 G>A), RS1167799530 (1:13166489 TCAACAACAACAACAA>T,TCAACAA,TCAACAACAA,TCAACAACAACAA,TCAACAACAACAACAACAA,TCAACAACAACAACAACAACAA,TCAACAACAACAACAACAACAACAA,TCAACAACAACAACAACAACAACAACAA,TCAACAACAACAACAACAACAACAACAACAA), RS1169926726 (1:13166167 A>G), RS1170067745 (1:13165718 A>AAAAG), RS1170339112 (1:13166031 A>G), RS1171831172 (1:13165772 C>T), RS1173698046 (1:13164905 G>A), RS1174243181 (1:13166171 A>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

6 total (human), top 6 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
perfluorooctanoic acid	affects cotreatment, increases expression	1
perfluorooctane sulfonic acid	increases expression, affects cotreatment	1
2-palmitoylglycerol	increases expression	1
perfluorohexanesulfonic acid	affects cotreatment, increases expression	1
Cadmium	increases abundance, increases expression	1
Cadmium Chloride	increases abundance, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.