HSD3B1
gene geneOn this page
Also known as SDR11E1
Summary
HSD3B1 (hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1, HGNC:5217) is a protein-coding gene on chromosome 1p12, encoding 3 beta-hydroxysteroid dehydrogenase/Delta 5–>4-isomerase type 1 (P14060). A bifunctional enzyme responsible for the oxidation and isomerization of 3beta-hydroxy-Delta(5)-steroid precursors to 3-oxo-Delta(4)-steroids, an essential step in steroid hormone biosynthesis.
The protein encoded by this gene is an enzyme that catalyzes the oxidative conversion of delta-5-3-beta-hydroxysteroid precursors into delta-4-ketosteroids, which leads to the production of all classes of steroid hormones. The encoded protein also catalyzes the interconversion of 3-beta-hydroxy- and 3-keto-5-alpha-androstane steroids.
Source: NCBI Gene 3283 — RefSeq curated summary.
At a glance
- GWAS associations: 1
- Clinical variants (ClinVar): 74 total
- Druggable target: yes — 1 molecules with ChEMBL bioactivity
- MANE Select transcript:
NM_000862
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:5217 |
| Approved symbol | HSD3B1 |
| Name | hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 |
| Location | 1p12 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | SDR11E1 |
| Ensembl gene | ENSG00000203857 |
| Ensembl biotype | protein_coding |
| OMIM | 109715 |
| Entrez | 3283 |
Gene structure
Transcript identifiers
Ensembl transcripts: 5 — 3 protein_coding, 2 retained_intron
ENST00000369413, ENST00000487520, ENST00000492140, ENST00000528909, ENST00000531340
RefSeq mRNA: 2 — MANE Select: NM_000862
NM_000862, NM_001328615
CCDS: CCDS903
Canonical transcript exons
ENST00000369413 — 4 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001201506 | 119507210 | 119507262 |
| ENSE00001722296 | 119511503 | 119511667 |
| ENSE00001846945 | 119513834 | 119515054 |
| ENSE00003667298 | 119507392 | 119507621 |
Expression profiles
Bgee: expression breadth ubiquitous, 154 present calls, max score 96.87.
FANTOM5 (CAGE): breadth tissue_specific, TPM avg 2.6541 / max 1178.4454, expressed in 51 samples.
FANTOM5 promoters (2 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 4922 | 2.4369 | 48 |
| 4921 | 0.2172 | 22 |
Top tissues by expression
291 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| placenta | UBERON:0001987 | 96.87 | gold quality |
| decidua | UBERON:0002450 | 94.88 | gold quality |
| upper leg skin | UBERON:0004262 | 94.25 | gold quality |
| mammalian vulva | UBERON:0000997 | 84.75 | gold quality |
| small intestine Peyer’s patch | UBERON:0003454 | 70.74 | gold quality |
| right adrenal gland cortex | UBERON:0035827 | 68.73 | gold quality |
| right adrenal gland | UBERON:0001233 | 67.94 | gold quality |
| left adrenal gland | UBERON:0001234 | 66.65 | gold quality |
| left adrenal gland cortex | UBERON:0035825 | 66.14 | gold quality |
| mucosa of transverse colon | UBERON:0004991 | 66.08 | gold quality |
| ileal mucosa | UBERON:0000331 | 65.40 | silver quality |
| small intestine | UBERON:0002108 | 64.98 | gold quality |
| adrenal cortex | UBERON:0001235 | 64.84 | gold quality |
| islet of Langerhans | UBERON:0000006 | 63.54 | gold quality |
| adrenal gland | UBERON:0002369 | 63.14 | gold quality |
| monocyte | CL:0000576 | 61.59 | gold quality |
| mononuclear cell | CL:0000842 | 61.43 | gold quality |
| cranial nerve II | UBERON:0000941 | 59.91 | silver quality |
| right lung | UBERON:0002167 | 59.43 | gold quality |
| leukocyte | CL:0000738 | 59.38 | gold quality |
| nipple | UBERON:0002030 | 58.73 | gold quality |
| omental fat pad | UBERON:0010414 | 58.31 | gold quality |
| peritoneum | UBERON:0002358 | 58.26 | gold quality |
| adipose tissue of abdominal region | UBERON:0007808 | 57.34 | gold quality |
| buccal mucosa cell | CL:0002336 | 57.12 | silver quality |
| right coronary artery | UBERON:0001625 | 56.76 | gold quality |
| tibialis anterior | UBERON:0001385 | 55.86 | silver quality |
| skin of abdomen | UBERON:0001416 | 55.66 | gold quality |
| zone of skin | UBERON:0000014 | 55.17 | gold quality |
| smooth muscle tissue | UBERON:0001135 | 54.68 | gold quality |
Single-cell (SCXA)
Detected in 3 experiment(s), a significant marker in 2.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-MTAB-6701 | yes | 1654.38 |
| E-MTAB-6678 | yes | 6.73 |
| E-ANND-3 | no | 2.12 |
Regulation
Is transcription factor: no
Upstream regulators (CollecTRI, top): AR, DLX3, ESR1, NR0B1, NR4A2, NR5A1, SP1, STAT5A, TFAP2C, YY1
miRNA regulators (miRDB)
20 targeting HSD3B1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-4262 | 100.00 | 73.26 | 3931 |
| HSA-MIR-181A-5P | 99.99 | 72.96 | 2995 |
| HSA-MIR-181B-5P | 99.99 | 72.97 | 2996 |
| HSA-MIR-181C-5P | 99.99 | 72.95 | 2996 |
| HSA-MIR-181D-5P | 99.99 | 73.04 | 2997 |
| HSA-MIR-4729 | 99.69 | 72.18 | 4233 |
| HSA-MIR-6758-3P | 99.57 | 67.55 | 1078 |
| HSA-MIR-543 | 99.52 | 69.03 | 2595 |
| HSA-MIR-3915 | 99.45 | 68.49 | 1905 |
| HSA-MIR-5690 | 99.25 | 67.58 | 1012 |
| HSA-MIR-3124-3P | 98.87 | 68.95 | 2123 |
| HSA-MIR-3149 | 98.77 | 67.13 | 1639 |
| HSA-MIR-6780A-3P | 98.42 | 67.49 | 1518 |
| HSA-MIR-5681A | 97.99 | 67.17 | 1658 |
| HSA-MIR-3187-3P | 97.38 | 65.80 | 904 |
| HSA-MIR-2114-5P | 96.00 | 64.56 | 617 |
| HSA-MIR-4774-5P | 95.92 | 68.27 | 827 |
| HSA-MIR-6874-5P | 95.73 | 64.94 | 545 |
| HSA-MIR-4633-3P | 93.85 | 63.56 | 534 |
| HSA-MIR-6500-5P | 93.85 | 63.64 | 522 |
Literature-anchored findings (GeneRIF, showing 40)
- nonstop mutation in the stop codon and missense mutation in type II 3beta-hydroxysteroid dehydrogenase gene causing 3beta-HSD deficiency congenital adrenal hyperplasia. (PMID:12050213)
- Polymorphism in exon 4 of the human gene and blood presssure (PMID:12054649)
- Structure/function relationships responsible for the kinetic differences between isoforms (PMID:12205101)
- HSD3B1 was identified using a trifunctional phenyl sulfonate probe. (PMID:12438565)
- Substantially higher affinity of 3beta-HSD1 activity for substrate and inhibitor steroids relative to the 3beta-HSD2 enzyme. (PMID:12530651)
- In outer region of adrenal cortex immunoreactivity was observed for 3beta-hydroxysteroid dehydrogenase. (PMID:12530676)
- Structure/function relationships responsible for coenzyme specificity and the isomerase activity of this multienzyme complex. (PMID:12832414)
- Descending HSD3B phenotype in hyperandrogenic females is associated with a variant of insulin-resistant polycystic ovary syndrome. (PMID:14764797)
- Neither of the HSD3B1 or PTP1B variants were associated with hypertension (PMID:15097232)
- results designate YY1 as the factor responsible for the intron 1-mediated boost of the HSD3B2 gene basal promoter activity (PMID:15291746)
- further characterizes structure/function relationships of human 3beta-HSD and bring us closer to the goal of selectively inhibiting the type 1 enzyme in placenta to control the timing of labor or in hormone-sensitive breast tumors to slow their growth (PMID:15291757)
- identification of structural reasons for the substantially higher affinities of 3beta-HSD1 for substrates, coenzymes, and inhibitors (PMID:15797861)
- The Rossmann-fold domain of 3beta-HSD1 contains two Cys residues, Cys72 and Cys111, which are capable of forming an intrasubunit disulfide bond based on their proximity in our structural model. (PMID:17624763)
- Variant in the HSD3B1 gene is associated with increased mammographic density (PMID:17627014)
- There is a possible role in human disease of common genetic variation in HSD3B1 and HSD3B2. (PMID:17689071)
- results suggest that the HSD3B1 N367T and UGT2B17 null polymorphisms may modify the risk of prostate cancer, particularly among men with a family history of the disease (PMID:17826523)
- HSD3B1 is highly specific and sensitive compared with other trophoblastic markers dor differential diagnosis of trophoblastic tumors and tumorlike lesions.. (PMID:18223326)
- Structure/function of the inhibition of HSD3B1 by trilostane is reported. (PMID:18524572)
- The activity levels of 17beta-hydroxysteroid dehydrogenase (17beta-HSD), 3beta-hydroxysteroid dehydrogenase (3beta-HSD), 3alpha-hydroxysteroid dehydrogenase (3alpha-HSD/3-KSR) and estrone sulfatase in ovarian epithelial carcinomas, were assayed. (PMID:18723074)
- Anti-inflammatory effects of IL-1alpha and IL-4 on 3beta-HSD2 mRNA involve a p38 MAPK signalling pathway, whereas pro-inflammatory response of IL-1alpha to 3beta-HSD1 mRNA involves a NF-kappaB inflammatory pathway. (PMID:18778748)
- The high affinity, competitive inhibition of 3beta-HSD1 by trilostane and epostane may be related to the presence of Arg195 in 3beta-HSD1 vs. Pro195 in 3beta-HSD2. (PMID:18955108)
- The genetic polymorphisms of the HSD3B1,genes were found to be significantly different (p<0.05) between the uremic and non-uremic diabetes group (PMID:19148546)
- Among patients with essential hypertension, cholesterol side-chain cleavage & MDR1 loci are related to circulating endogenous ouabain & DBP. In contrast, variants in HSD3B1 are related with SBP probably via aldosterone (PMID:19197249)
- 3beta-HSD protein was immunodetectable in primary ascites of women who were diagnosed with epithelial ovarian cancer but mRNA transcripts of both 3beta-hydroxysteroid dehydrogenase type 1 and type 2 were diminished relative to normal cells. (PMID:19414525)
- compared (+)- and (-)-gossypols in the inhibition of 3beta-HSD and 17beta-HSD3 in human and rat testes (PMID:19429456)
- We investigated associations between single nucleotide polymorphisms in genes HSD3B1, SRD5A1/2, and AKR1C2 and prostate cancer risk (PMID:20056642)
- Data indicate that enzymes CYP17A1 and HSD3B1 showed low expression, while AKR1C3 and SRD5A1 were abundantly expressed. (PMID:20086173)
- The study identifies an amino acid in the steroid binding domain of human 3-beta-HSD I that may be exploited to produce new inhibitors that are much more highly specific for 3-beta-HSD I in breast tumors compared to adrenal 3-beta-HSD II. (PMID:20420909)
- rs6203 and rs1047303 in the HSD3B1 gene are useful genetic markers for essential hypertension, while polymorphisms of HSD3B1 are associated with the BP and aldosterone level. (PMID:20660004)
- The HSD3B1 T/C polymorphism cannot be used as genetic marker for the risk for recurrent spontaneous abortions in our Caucasian population. (PMID:21631238)
- There is expression of 3beta-Hsd1 in XX gonads during gonad differentiation period. (PMID:21932034)
- The aim of this haplotype-based case-control study was to estimate whether polymorphisms of the maternal estrogen synthesis genes (CYP19A1, HSD3B1 and HSD3B2) are associated with preeclampsia and gestational hypertension (PMID:22638611)
- Carriers of HSD3B1 GCC haplotype had lower peak early (Ea; P = 0.004) and higher peak late (Aa; P = 0.066) diastolic mitral annular velocities and therefore a lower Ea/Aa ratio (P = 0.041) as compared with noncarriers (PMID:22673022)
- elevated in placental tissue of women with polycystic ovarian syndrome (PMID:23122578)
- HSD3B1 is a highly specific trophoblast-associated marker that can be used in the distinction of trophoblastic tumorlike lesions and tumors from nontrophoblastic lesions and tumors. (PMID:23318910)
- HSD3B1 T–>C Leu338, HTR2A T102C, GNAS T393C, and RGS2 G638A polymorphisms were not associated with hypertension risk. (PMID:23859711)
- Study shows that castration-resistant prostate cancer sometimes expresses a gain-of-stability mutation that leads to a gain-of-function in 3betaHSD1, which catalyzes the initial rate-limiting step in conversion of the adrenal-derived steroid dehydroepiandrosterone to dihydrotestosterone. (PMID:23993097)
- Risk-conferring genetic variations in the HSD3beta gene influenced susceptibility of primary aldosteronism. Concomitant presence of rs6203 CC and rs12410453 GA genotypes synergistically increased aldosterone-to-renin ratio (PMID:24006038)
- The AAT haplotype of the HSD3B1 gene was significantly associated with increased risks of acne vulgaris in Han Chinese from the Southwest China. (PMID:24157973)
- Expression of the genes HSD3B1, HSD17B3, and SRD5A2 was significantly increased in BPH tissues compared to normal adjacent prostate tissues. (PMID:24810473)
Cross-species orthologs
17 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | tdh2 | ENSDARG00000001463 |
| danio_rerio | hsd3b2 | ENSDARG00000019747 |
| danio_rerio | hsd3b1 | ENSDARG00000069926 |
| mus_musculus | Hsd3b6 | ENSMUSG00000027869 |
| mus_musculus | Hsd3b1 | ENSMUSG00000027871 |
| mus_musculus | Hsd3b5 | ENSMUSG00000038092 |
| mus_musculus | Hsd3b3 | ENSMUSG00000062410 |
| mus_musculus | Hsd3b2 | ENSMUSG00000063730 |
| mus_musculus | Hsd3b9 | ENSMUSG00000090817 |
| mus_musculus | Hsd3b4 | ENSMUSG00000095143 |
| mus_musculus | Hsd3b8 | ENSMUSG00000095388 |
| rattus_norvegicus | Hsd3b5 | ENSRNOG00000019417 |
| rattus_norvegicus | Hsd3b2 | ENSRNOG00000019441 |
| rattus_norvegicus | Hsd3b5-ps1 | ENSRNOG00000070670 |
| rattus_norvegicus | Hsd3b1 | ENSRNOG00000080702 |
| caenorhabditis_elegans | WBGENE00022498 | |
| caenorhabditis_elegans | WBGENE00022616 |
Paralogs (10): TGDS (ENSG00000088451), HSD3B7 (ENSG00000099377), GFUS (ENSG00000104522), GMDS (ENSG00000112699), UXS1 (ENSG00000115652), GALE (ENSG00000117308), NSDHL (ENSG00000147383), SDR42E2 (ENSG00000183921), SDR42E1 (ENSG00000184860), HSD3B2 (ENSG00000203859)
Protein
Protein identifiers
3 beta-hydroxysteroid dehydrogenase/Delta 5–>4-isomerase type 1 — P14060 (reviewed: P14060)
Alternative names: 3 beta-hydroxysteroid dehydrogenase/Delta 5–>4-isomerase type I, 3-beta-hydroxy-5-ene steroid dehydrogenase, 3-beta-hydroxy-Delta(5)-steroid dehydrogenase, 3-beta-hydroxysteroid 3-dehydrogenase, Delta-5-3-ketosteroid isomerase, Dihydrotestosterone oxidoreductase, Steroid Delta-isomerase, Trophoblast antigen FDO161G
All UniProt accessions (2): E9PRN7, P14060
UniProt curated annotations — full annotation on UniProt →
Function. A bifunctional enzyme responsible for the oxidation and isomerization of 3beta-hydroxy-Delta(5)-steroid precursors to 3-oxo-Delta(4)-steroids, an essential step in steroid hormone biosynthesis. Specifically catalyzes the conversion of pregnenolone to progesterone, 17alpha-hydroxypregnenolone to 17alpha-hydroxyprogesterone, dehydroepiandrosterone (DHEA) to 4-androstenedione, and androstenediol to testosterone. Additionally, catalyzes the interconversion between 3beta-hydroxy and 3-oxo-5alpha-androstane steroids controlling the bioavalability of the active forms. Specifically converts dihydrotestosterone to its inactive form 5alpha-androstanediol, that does not bind androgen receptor/AR. Also converts androstanedione, a precursor of testosterone and estrone, to epiandrosterone. Expected to use NAD(+) as preferred electron donor for the 3beta-hydroxy-steroid dehydrogenase activity and NADPH for the 3-ketosteroid reductase activity.
Subcellular location. Endoplasmic reticulum membrane. Mitochondrion membrane.
Tissue specificity. Placenta and skin. Predominantly expressed in mammary gland tissue.
Pathway. Steroid hormone biosynthesis. Steroid metabolism.
Similarity. Belongs to the 3-beta-HSD family.
RefSeq proteins (2): NP_000853, NP_001315544 (=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR002225 | 3Beta_OHSteriod_DH/Estase | Domain |
| IPR036291 | NAD(P)-bd_dom_sf | Homologous_superfamily |
| IPR050177 | Lipid_A_modif_metabolic_enz | Family |
Pfam: PF01073
Enzyme classification (BRENDA):
- EC 1.1.1.145 — 3beta-hydroxy-DELTA5-steroid dehydrogenase (BRENDA: 24 organisms, 157 substrates, 162 inhibitors, 249 Km, 139 kcat entries)
- EC 5.3.3.1 — steroid DELTA-isomerase (BRENDA: 15 organisms, 48 substrates, 67 inhibitors, 98 Km, 86 kcat entries)
Substrate kinetics (BRENDA)
96 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.
| Substrate | Km (mM) | Measurements |
|---|---|---|
| DEHYDROEPIANDROSTERONE | 0.0001–0.2419 | 66 |
| 5-ANDROSTENE-3,17-DIONE | 0.0001–0.548 | 65 |
| NAD+ | — | 43 |
| PREGNENOLONE | — | 21 |
| NADH | 0.0025–0.106 | 8 |
| ANDROSTENE-3,17-DIONE | 0.023–0.0735 | 6 |
| DEHYDROEPIANDROSTERONE | 0.0175–0.0884 | 6 |
| 5(10)-ESTRENE-3,17-DIONE | 0.0328–0.256 | 5 |
| 5-PREGNENE-3,20-DIONE | 0.0093–0.068 | 5 |
| 16ALPHA-HYDROXY-DEHYDROEPIANDROSTERONE | 0.004–0.0196 | 4 |
| 16BETA-HYDROXY-DEHYDROEPIANDROSTERONE | 0.0014–0.0184 | 4 |
| 5BETA-PREGNANE-3,20-DIONE | 0.0029–1.725 | 3 |
| NADP+ | 0.0003–13 | 3 |
| 17ALPHA-HYDROXYPREGNENOLONE | 0.0035–0.018 | 2 |
| 4-NITROBENZALDEHYDE | 1.966–13 | 2 |
Catalyzed reactions (Rhea), 12 shown:
- a 3-oxo-Delta(5)-steroid = a 3-oxo-Delta(4)-steroid (RHEA:14709)
- 5alpha-androstane-3beta,17beta-diol + NADP(+) = 17beta-hydroxy-5alpha-androstan-3-one + NADPH + H(+) (RHEA:16297)
- a 3beta-hydroxy-Delta(5)-steroid + NAD(+) = a 3-oxo-Delta(5)-steroid + NADH + H(+) (RHEA:24076)
- a 3beta-hydroxysteroid + NADP(+) = a 3-oxosteroid + NADPH + H(+) (RHEA:34787)
- 5alpha-androstane-3beta,17beta-diol + NAD(+) = 17beta-hydroxy-5alpha-androstan-3-one + NADH + H(+) (RHEA:42184)
- pregnenolone + NAD(+) = pregn-5-ene-3,20-dione + NADH + H(+) (RHEA:43924)
- pregn-5-ene-3,20-dione = progesterone (RHEA:43928)
- 3beta-hydroxyandrost-5-en-17-one + NAD(+) = androst-5-ene-3,17-dione + NADH + H(+) (RHEA:43932)
- androst-5-ene-3,17-dione = androst-4-ene-3,17-dione (RHEA:43936)
- 3beta-hydroxy-5alpha-androstan-17-one + NADP(+) = 5alpha-androstan-3,17-dione + NADPH + H(+) (RHEA:56916)
- androst-5-en-3beta,17beta-diol + NAD(+) = 17beta-hydroxy-androst-5-en-3-one + NADH + H(+) (RHEA:56932)
- 17beta-hydroxy-androst-5-en-3-one = testosterone (RHEA:56936)
UniProt features (13 total): sequence variant 6, binding site 3, initiator methionine 1, chain 1, transmembrane region 1, active site 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-P14060-F1 | 94.03 | 0.86 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Catalytic / active sites (1): 159 (proton donor)
Ligand- & substrate-binding residues (3): 10–15; 155; 159
Function
Pathways and Gene Ontology
Reactome pathways
7 pathways
| ID | Pathway |
|---|---|
| R-HSA-193048 | Androgen biosynthesis |
| R-HSA-193993 | Mineralocorticoid biosynthesis |
| R-HSA-194002 | Glucocorticoid biosynthesis |
| R-HSA-1430728 | Metabolism |
| R-HSA-196071 | Metabolism of steroid hormones |
| R-HSA-556833 | Metabolism of lipids |
| R-HSA-8957322 | Metabolism of steroids |
MSigDB gene sets: 136 (showing top):
GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_UP, SHEPARD_BMYB_MORPHOLINO_UP, GOBP_C21_STEROID_HORMONE_METABOLIC_PROCESS, GOBP_REGULATION_OF_HORMONE_LEVELS, RIZKI_TUMOR_INVASIVENESS_3D_DN, GOBP_KETONE_METABOLIC_PROCESS, KORKOLA_CHORIOCARCINOMA, GOMF_STEROID_DEHYDROGENASE_ACTIVITY_ACTING_ON_THE_CH_OH_GROUP_OF_DONORS_NAD_OR_NADP_AS_ACCEPTOR, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, GOBP_ANDROGEN_BIOSYNTHETIC_PROCESS, UEDA_PERIFERAL_CLOCK, GOBP_HORMONE_BIOSYNTHETIC_PROCESS, ICHIBA_GRAFT_VERSUS_HOST_DISEASE_35D_DN, FUJIWARA_PARK2_HEPATOCYTE_PROLIFERATION_UP, GOBP_STEROID_BIOSYNTHETIC_PROCESS
GO Biological Process (7): steroid biosynthetic process (GO:0006694), progesterone biosynthetic process (GO:0006701), androgen biosynthetic process (GO:0006702), estrogen biosynthetic process (GO:0006703), C21-steroid hormone metabolic process (GO:0008207), lipid metabolic process (GO:0006629), steroid metabolic process (GO:0008202)
GO Molecular Function (9): 3-beta-hydroxysteroid 3-dehydrogenase (NADP+) activity (GO:0000253), 3-beta-hydroxy-Delta5-steroid dehydrogenase (NAD+) activity (GO:0003854), steroid Delta-isomerase activity (GO:0004769), oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616), 5-alpha-androstane-3-beta,17-beta-diol dehydrogenase (NADP+) activity (GO:0047024), catalytic activity (GO:0003824), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), isomerase activity (GO:0016853)
GO Cellular Component (14): nucleolus (GO:0005730), cytoplasm (GO:0005737), mitochondrial inner membrane (GO:0005743), mitochondrial intermembrane space (GO:0005758), endoplasmic reticulum (GO:0005783), endoplasmic reticulum membrane (GO:0005789), cilium (GO:0005929), microtubule cytoskeleton (GO:0015630), smooth endoplasmic reticulum membrane (GO:0030868), ciliary transition zone (GO:0035869), intercellular bridge (GO:0045171), mitochondrion (GO:0005739), membrane (GO:0016020), mitochondrial membrane (GO:0031966)
Reactome top-level categories
Rollup of top-4 pathways:
| Category | Pathways |
|---|---|
| Metabolism of steroid hormones | 3 |
| Metabolism of steroids | 1 |
| Metabolism | 1 |
| Metabolism of lipids | 1 |
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular anatomical structure | 4 |
| steroid dehydrogenase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor | 3 |
| steroid metabolic process | 2 |
| hormone biosynthetic process | 2 |
| steroid hormone biosynthetic process | 2 |
| catalytic activity | 2 |
| mitochondrial envelope | 2 |
| cytoplasm | 2 |
| intracellular membrane-bounded organelle | 2 |
| organelle membrane | 2 |
| lipid biosynthetic process | 1 |
| C21-steroid hormone biosynthetic process | 1 |
| ketone biosynthetic process | 1 |
| progesterone metabolic process | 1 |
| olefinic compound biosynthetic process | 1 |
| androgen metabolic process | 1 |
| estrogen metabolic process | 1 |
| hormone metabolic process | 1 |
| primary metabolic process | 1 |
| lipid metabolic process | 1 |
| intramolecular oxidoreductase activity, transposing C=C bonds | 1 |
| oxidoreductase activity, acting on CH-OH group of donors | 1 |
| molecular_function | 1 |
| binding | 1 |
| nuclear lumen | 1 |
| intracellular membraneless organelle | 1 |
| intracellular anatomical structure | 1 |
| organelle inner membrane | 1 |
| mitochondrial membrane | 1 |
| organelle envelope lumen | 1 |
| endomembrane system | 1 |
| nuclear outer membrane-endoplasmic reticulum membrane network | 1 |
| endoplasmic reticulum subcompartment | 1 |
| intraciliary transport particle | 1 |
| membrane-bounded organelle | 1 |
| plasma membrane bounded cell projection | 1 |
| cytoskeleton | 1 |
| endoplasmic reticulum membrane | 1 |
| smooth endoplasmic reticulum | 1 |
| bounding membrane of organelle | 1 |
Protein interactions and networks
STRING
3241 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| HSD3B1 | CYP11A1 | P05108 | 972 |
| HSD3B1 | CYP17A1 | P05093 | 949 |
| HSD3B1 | STAR | P49675 | 896 |
| HSD3B1 | DHRS11 | Q6UWP2 | 882 |
| HSD3B1 | HSD17B1 | P14061 | 876 |
| HSD3B1 | CYP19A1 | P11511 | 861 |
| HSD3B1 | HSD17B3 | P37058 | 839 |
| HSD3B1 | LHCGR | P22888 | 809 |
| HSD3B1 | CYP11B1 | P15538 | 793 |
| HSD3B1 | CYP21A2 | P04033 | 742 |
| HSD3B1 | CYP11B2 | P19099 | 735 |
| HSD3B1 | FSHR | P23945 | 734 |
| HSD3B1 | SRD5A1 | P18405 | 731 |
| HSD3B1 | INSL3 | P51460 | 728 |
| HSD3B1 | SULT2A1 | Q06520 | 717 |
IntAct
31 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| HSD3B1 | AQP6 | psi-mi:“MI:0915”(physical association) | 0.560 |
| HSD3B1 | TMEM14B | psi-mi:“MI:0915”(physical association) | 0.560 |
| HSD3B1 | SLC16A13 | psi-mi:“MI:0915”(physical association) | 0.560 |
| CALR | HSD3B1 | psi-mi:“MI:0915”(physical association) | 0.560 |
| DLST | HSD3B1 | psi-mi:“MI:0915”(physical association) | 0.560 |
| HSD3B1 | FGFR3 | psi-mi:“MI:0915”(physical association) | 0.560 |
| HSD3B1 | GSN | psi-mi:“MI:0915”(physical association) | 0.560 |
| HSD3B1 | NEK7 | psi-mi:“MI:0915”(physical association) | 0.560 |
| HSD3B2 | NARS1 | psi-mi:“MI:0914”(association) | 0.530 |
| HSD3B1 | UGGT1 | psi-mi:“MI:0915”(physical association) | 0.400 |
| HSD3B1 | H2BC9 | psi-mi:“MI:0915”(physical association) | 0.400 |
| HSD3B1 | EGFR | psi-mi:“MI:2364”(proximity) | 0.270 |
| HSD3B1 | PTEN | psi-mi:“MI:2364”(proximity) | 0.270 |
| HSD3B1 | AQP6 | psi-mi:“MI:0915”(physical association) | 0.000 |
| HSD3B1 | TMEM14B | psi-mi:“MI:0915”(physical association) | 0.000 |
| HSD3B1 | SLC16A13 | psi-mi:“MI:0915”(physical association) | 0.000 |
BioGRID (9): HSD3B1 (Affinity Capture-MS), HSD3B1 (Two-hybrid), HSD3B1 (Two-hybrid), HSD3B1 (Two-hybrid), UGGT1 (Proximity Label-MS), HIST1H2BH (Proximity Label-MS), HSD3B1 (Affinity Capture-MS), HSD3B1 (Affinity Capture-MS), HSD3B1 (Affinity Capture-MS)
ESM2 similar proteins: A3R052, A8DZE7, A8E5C5, O35296, O35469, O46516, O88736, P0CB81, P0CB82, P14060, P14893, P22071, P22072, P24815, P26149, P26150, P26439, P27364, P27365, P56937, Q0IH28, Q0IH73, Q0MQB3, Q0MQB4, Q0VFE7, Q15738, Q16795, Q32L94, Q3ZBE9, Q4R7R1, Q566S6, Q5IFP1, Q5PPL3, Q5R6U1, Q5RJY4, Q60555, Q61694, Q61767, Q62878, Q62904
Diamond homologs: A0A7H0DNE2, A4TSC8, A6NKP2, A7FCU3, A9R683, B1JQW4, B2FI29, B2JYP2, C0Q1V2, C0QZ84, C4K8I6, O35048, O35296, O35469, O46516, O57245, P14060, P14893, P21097, P22071, P22072, P24815, P26149, P26150, P26439, P26670, P27364, P27365, P33794, P9WQP6, P9WQP7, Q1C276, Q1CD11, Q31FG4, Q57IC3, Q5IFP1, Q60555, Q61694, Q61767, Q62878
SIGNOR signaling
5 interactions.
| A | Effect | B | Mechanism |
|---|---|---|---|
| HSD3B1 | “up-regulates quantity” | progesterone | “chemical modification” |
| HSD3B1 | “up-regulates quantity” | 17alpha-hydroxyprogesterone | “chemical modification” |
| HSD3B1 | “up-regulates quantity” | androst-4-ene-3,17-dione | “chemical modification” |
| Corticotropin | “up-regulates quantity” | HSD3B1 | |
| HSD3B1 | “up-regulates quantity” | testosterone | “chemical modification” |
Disease & clinical
Clinical variants and AI predictions
ClinVar
74 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 60 |
| Likely benign | 10 |
| Benign | 1 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
533 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 1:119507617:TTCTA:T | donor_gain | 1.0000 |
| 1:119507619:CTA:C | donor_gain | 1.0000 |
| 1:119507620:TA:T | donor_gain | 1.0000 |
| 1:119507621:AGT:A | donor_loss | 1.0000 |
| 1:119507622:G:GG | donor_gain | 1.0000 |
| 1:119507622:G:T | donor_loss | 1.0000 |
| 1:119507623:T:A | donor_loss | 1.0000 |
| 1:119511664:AAAG:A | donor_gain | 1.0000 |
| 1:119511665:AAGG:A | donor_loss | 1.0000 |
| 1:119511666:AG:A | donor_loss | 1.0000 |
| 1:119511667:GG:G | donor_loss | 1.0000 |
| 1:119511668:G:T | donor_loss | 1.0000 |
| 1:119507612:G:GT | donor_gain | 0.9900 |
| 1:119507618:TCTA:T | donor_gain | 0.9900 |
| 1:119507625:A:AG | donor_gain | 0.9900 |
| 1:119507626:G:GG | donor_gain | 0.9900 |
| 1:119511501:A:AG | acceptor_gain | 0.9900 |
| 1:119511502:G:GA | acceptor_gain | 0.9900 |
| 1:119511502:GA:G | acceptor_gain | 0.9900 |
| 1:119511502:GAA:G | acceptor_gain | 0.9900 |
| 1:119513826:ATG:A | acceptor_gain | 0.9900 |
| 1:119513828:G:A | acceptor_gain | 0.9900 |
| 1:119507624:AA:A | donor_loss | 0.9800 |
| 1:119511498:CACA:C | acceptor_loss | 0.9800 |
| 1:119511499:ACAG:A | acceptor_loss | 0.9800 |
| 1:119511500:CA:C | acceptor_loss | 0.9800 |
| 1:119511501:A:AC | acceptor_loss | 0.9800 |
| 1:119511580:G:GT | donor_gain | 0.9800 |
| 1:119513827:T:TA | acceptor_gain | 0.9800 |
| 1:119513831:CAG:C | acceptor_loss | 0.9800 |
AlphaMissense
2433 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 1:119513893:A:C | S124R | 0.993 |
| 1:119513895:T:A | S124R | 0.993 |
| 1:119513895:T:G | S124R | 0.993 |
| 1:119514000:A:C | K159N | 0.991 |
| 1:119514000:A:T | K159N | 0.991 |
| 1:119513995:A:C | S158R | 0.989 |
| 1:119513997:C:A | S158R | 0.989 |
| 1:119513997:C:G | S158R | 0.989 |
| 1:119513894:G:T | S124I | 0.986 |
| 1:119513896:A:C | S125R | 0.986 |
| 1:119513898:C:A | S125R | 0.986 |
| 1:119513898:C:G | S125R | 0.986 |
| 1:119514207:T:A | N228K | 0.985 |
| 1:119514207:T:G | N228K | 0.985 |
| 1:119513897:G:T | S125I | 0.982 |
| 1:119511660:T:A | N101K | 0.981 |
| 1:119511660:T:G | N101K | 0.981 |
| 1:119513999:A:T | K159I | 0.981 |
| 1:119514080:G:C | R186P | 0.981 |
| 1:119514295:G:C | D258H | 0.978 |
| 1:119507516:T:C | F14L | 0.977 |
| 1:119507518:T:A | F14L | 0.977 |
| 1:119507518:T:G | F14L | 0.977 |
| 1:119514098:G:T | G192V | 0.974 |
| 1:119514568:G:C | A349P | 0.972 |
| 1:119513859:T:G | C112W | 0.970 |
| 1:119513986:T:C | Y155H | 0.970 |
| 1:119514482:T:A | V320D | 0.969 |
| 1:119514079:C:G | R186G | 0.968 |
| 1:119514296:A:T | D258V | 0.968 |
dbSNP variants (sampled 300 via entrez): RS1000301714 (1:119509878 A>C), RS1000327493 (1:119510236 G>T), RS1000381321 (1:119510563 C>T), RS1000577488 (1:119511571 G>T), RS1001237880 (1:119510793 GCAGAGGTGTGATCTTGGCTCACTGC>G), RS1001361958 (1:119510937 G>C,T), RS1001493847 (1:119505252 T>G), RS1001527675 (1:119509481 C>T), RS1001647666 (1:119514810 G>A,T), RS1001659066 (1:119515155 G>A,T), RS1001809473 (1:119506938 A>T), RS1001830779 (1:119506624 C>A), RS1001912217 (1:119508634 T>C), RS1001984557 (1:119513827 T>G), RS1003081618 (1:119511772 G>A,T)
Disease associations
OMIM: gene MIM:109715 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
1 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST002875_155 | Diisocyanate-induced asthma | 1.000000e-06 |
EFO canonical traits (1, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0006995 | response to diisocyanate |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: yes
ChEMBL targets (1): CHEMBL1958 (SINGLE PROTEIN)
Molecules with ChEMBL bioactivity
1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 51,247 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).
| Molecule | Name | Phase | Patents |
|---|---|---|---|
| CHEMBL710 | FINASTERIDE | 4 | 51,247 |
PharmGKB: 1 entry (VIP=true, CPIC=false)
PharmGKB clinical annotations
1 annotations.
| Variant | Type | Level | Drugs | Phenotypes |
|---|---|---|---|---|
| rs1047303 | Efficacy | 3 | glucocorticoids | Asthma |
PharmGKB variants
1 variants.
| Variant | Genes | Level | Score | #Clin annots | Drugs |
|---|---|---|---|---|---|
| rs1047303 | HSD3B1 | 3 | 3.25 | 1 | glucocorticoids |
Binding affinities (BindingDB)
94 measured of 95 human assays (95 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.
| Ligand | Measure | Value | Patent |
|---|---|---|---|
| (6S)-2-(3,5-difluoro-4-hydroxyphenyl)-6-ethyl-6-methyl-7,8-dihydroquinolin-5-one | IC50 | 0.7 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(2,5-difluoro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 1 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 1.4 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6,6-diethyl-7,8-dihydroquinolin-5-one | IC50 | 3.8 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)spiro[7,8-dihydroquinoline-6,1’-cyclopropane]-5-one | IC50 | 4.8 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 6-benzyl-2-(3,5-difluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 10 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3-fluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 14 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| (6S)-6-benzyl-2-(3,5-difluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 19 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-(5-methoxy-5-pyridin-3-yl-7,8-dihydro-6H-quinolin-2-yl)phenol | IC50 | 25 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3-chloro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 26 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-(5-methoxy-5-methyl-7,8-dihydro-6H-quinolin-2-yl)phenol | IC50 | 38 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-fluoro-6-methyl-7,8-dihydroquinolin-5-one | IC50 | 42 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-(5-methoxy-5-propan-2-yl-7,8-dihydro-6H-quinolin-2-yl)phenol | IC50 | 45 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3-chloro-5-fluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 49 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3-fluoro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 51 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-(5-phenyl-5-propoxy-7,8-dihydro-6H-quinolin-2-yl)phenol | IC50 | 52 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| (6S)-6-benzyl-2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-7,8-dihydroquinolin-5-one | IC50 | 55 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-6-(trifluoromethyl)-7,8-dihydroquinolin-5-one | IC50 | 59 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 62 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-7,8-dihydro-6H-quinolin-5-one | IC50 | 64 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3-fluoro-4-hydroxy-5-methylphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 67 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6,6-difluoro-7,8-dihydroquinolin-5-one | IC50 | 68 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-5-pyridin-3-yl-7,8-dihydro-6H-quinolin-5-ol | IC50 | 68 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| (6S)-6-benzyl-2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-7,8-dihydroquinolin-5-one | IC50 | 78 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-6-(1,1,2,2,2-pentafluoroethyl)-7,8-dihydroquinolin-5-one | IC50 | 78 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-phenyl-7,8-dihydro-6H-quinolin-5-one | IC50 | 79 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(2,5-difluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 83 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6,7,8,9-tetrahydrocyclohepta[b]pyridin-5-one | IC50 | 90 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-5-oxo-7,8-dihydroquinoline-6-carbonitrile | IC50 | 92 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-[5-methoxy-5-(1,3-oxazol-2-yl)-7,8-dihydro-6H-quinolin-2-yl]phenol | IC50 | 100 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-ethyl-7,8-dihydro-6H-quinolin-5-one | IC50 | 105 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 107 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| (6R)-2-(3,5-difluoro-4-hydroxyphenyl)-6-ethyl-6-methyl-7,8-dihydroquinolin-5-one | IC50 | 110 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(2,3-difluoro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-one | IC50 | 122 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(2,5-difluoro-4-hydroxyphenyl)spiro[7,8-dihydroquinoline-6,1’-cyclopropane]-5-one | IC50 | 127 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 6-(cyclopropylmethyl)-2-(3,5-difluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 130 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-(5-methoxy-5-pyridin-2-yl-7,8-dihydro-6H-quinolin-2-yl)phenol | IC50 | 131 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-fluoro-7,8-dihydro-6H-quinolin-5-one | IC50 | 149 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 6,6-dimethyl-2-(2,3,5-trifluoro-4-hydroxyphenyl)-7,8-dihydroquinolin-5-one | IC50 | 152 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| (6R)-6-benzyl-2-(3,5-difluoro-4-hydroxyphenyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 177 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-methyl-6-(2,2,2-trifluoroethyl)-7,8-dihydroquinolin-5-one | IC50 | 188 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2,6-difluoro-4-(5-methoxy-5,6,7,8-tetrahydroquinolin-2-yl)phenol | IC50 | 204 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-(pyridin-4-ylmethyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 212 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 7-(3,5-difluoro-4-hydroxyphenyl)-2,3-dihydro-1H-1,8-naphthyridin-4-one | IC50 | 218 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6,6-dimethyl-7H-cyclopenta[b]pyridin-5-one | IC50 | 221 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-(hydroxymethyl)-6-methyl-7,8-dihydroquinolin-5-one | IC50 | 222 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 5-benzyl-2-(3,5-difluoro-4-hydroxyphenyl)-6,6-dimethyl-7,8-dihydroquinolin-5-ol | IC50 | 227 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-5-pyridin-2-yl-7,8-dihydro-6H-quinolin-5-ol | IC50 | 238 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-(pyridin-3-ylmethyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 249 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
| 2-(3,5-difluoro-4-hydroxyphenyl)-6-(pyridin-2-ylmethyl)-7,8-dihydro-6H-quinolin-5-one | IC50 | 272 nM | US-20250241905: 3-BETA-HSD1 INHIBITORS AND COMPOSITIONS AND USES THEREOF |
ChEMBL bioactivities
14 potent at pChembl≥5 of 15 total, top 14 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).
| pChembl | Type | Value | Unit | Molecule |
|---|---|---|---|---|
| 8.11 | Ki | 7.8 | nM | CHEMBL25516 |
| 8.08 | IC50 | 8.3 | nM | CHEMBL24033 |
| 8.00 | Ki | 10 | nM | CHEMBL280155 |
| 7.92 | Ki | 12 | nM | CHEMBL297524 |
| 7.72 | Ki | 19 | nM | CHEMBL25183 |
| 6.82 | IC50 | 150 | nM | CHEMBL24729 |
| 6.82 | Ki | 150 | nM | CHEMBL24088 |
| 6.80 | Ki | 160 | nM | CHEMBL283123 |
| 6.75 | Ki | 180 | nM | CHEMBL3085538 |
| 6.72 | Ki | 190 | nM | CHEMBL24291 |
| 6.72 | Ki | 190 | nM | CHEMBL282037 |
| 6.31 | Ki | 490 | nM | CHEMBL283430 |
| 6.29 | Ki | 510 | nM | CHEMBL412425 |
| 5.80 | Ki | 1600 | nM | CHEMBL277224 |
PubChem BioAssay actives
14 with measured affinity, of 15 total; 14 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.
| Compound | Assay | Type | Value | Unit |
|---|---|---|---|---|
| (1S,9aR,11aS)-N-(3,5-ditert-butylphenyl)-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.0078 | uM |
| (1S,9aR,11aS)-N-(3,3-dimethylbutyl)-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3227: Binding affinity on 3 beta-hydroxysteroid dehydrogenase | ic50 | 0.0083 | uM |
| (1S,9aR,11aS)-9a,11a-dimethyl-7-oxo-N-phenyl-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.0100 | uM |
| methyl (1S,9aR,11aS)-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxylate | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.0120 | uM |
| (1S,9aR,11aS)-N-[2,5-bis(trifluoromethyl)phenyl]-6,9a,11a-trimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.0190 | uM |
| (1S,9aR,11aS)-9a,11a-dimethyl-7-oxo-N-(2,4,4-trimethylpentan-2-yl)-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3227: Binding affinity on 3 beta-hydroxysteroid dehydrogenase | ic50 | 0.1500 | uM |
| (1S,9aR,11aS)-N-benzhydryl-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.1500 | uM |
| (1S,9aR,11aS)-N-(4-chlorophenyl)-N-cyclopentyl-6,9a,11a-trimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.1600 | uM |
| 2-adamantyl (1S,3aS,3bS,9aR,9bS,11aS)-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxylate | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.1800 | uM |
| (1S,9aR,11aS)-N-[2,5-bis(trifluoromethyl)phenyl]-6-chloro-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.1900 | uM |
| (1S,9aR,11aS)-9a,11a-dimethyl-1-(morpholine-4-carbonyl)-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridin-7-one | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.1900 | uM |
| (1S,9aR,11aS)-6-chloro-N-(4-chlorophenyl)-N-cyclopentyl-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.4900 | uM |
| (1S,9aR,11aS)-N-[bis(4-chlorophenyl)methyl]-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 0.5100 | uM |
| (1S,9aR,11aS)-N-[2-tert-butyl-5-(trifluoromethyl)phenyl]-9a,11a-dimethyl-7-oxo-1,2,3,3a,3b,4,5,8,9,9b,10,11-dodecahydrocyclopenta[i]phenanthridine-1-carboxamide | 3228: Binding affinity for 3-beta-hydroxysteroid dehydrogenase | ki | 1.6000 | uM |
CTD chemical–gene interactions
118 total (human), top 30 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| bisphenol A | decreases activity, increases expression, decreases reaction | 3 |
| Estradiol | decreases activity, increases expression | 3 |
| Testosterone | affects cotreatment, increases expression, increases chemical synthesis, decreases expression | 3 |
| Aflatoxin B1 | decreases expression, increases expression, decreases reaction | 3 |
| triphenyl phosphate | increases expression, affects reaction, decreases reaction | 2 |
| perfluoro-n-nonanoic acid | decreases activity, decreases expression | 2 |
| 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | increases expression, affects cotreatment | 2 |
| Fulvestrant | decreases reaction, increases expression, increases methylation | 2 |
| Ascorbic Acid | affects cotreatment, increases expression, affects binding | 2 |
| Benzo(a)pyrene | increases methylation, increases mutagenesis | 2 |
| Diethylstilbestrol | decreases activity, decreases expression | 2 |
| Dithiothreitol | increases activity, decreases activity, decreases reaction | 2 |
| Pentachlorophenol | increases abundance, increases activity, decreases expression, decreases activity | 2 |
| Progesterone | increases chemical synthesis, increases expression | 2 |
| Tetrachlorodibenzodioxin | affects cotreatment, decreases expression | 2 |
| 8-Bromo Cyclic Adenosine Monophosphate | decreases expression | 2 |
| Vitamin K 3 | affects expression, affects binding, affects cotreatment | 2 |
| cyclopiazonic acid | decreases activity | 1 |
| STF-31 | affects cotreatment, decreases reaction, increases expression | 1 |
| fluorene-9-bisphenol | decreases activity | 1 |
| perfluorotetradecanoic acid | decreases activity | 1 |
| perfluorotridecanoic acid | decreases activity | 1 |
| 3,3’-dimethylbisphenol A | decreases activity | 1 |
| dioxybenzone | decreases activity | 1 |
| deoxynivalenol | decreases activity | 1 |
| dichlone | decreases activity | 1 |
| 2,4,5,2’,5’-pentachlorobiphenyl | increases expression | 1 |
| isoamyl salicylate | decreases activity | 1 |
| ferbam | decreases activity | 1 |
| ascorbate-2-phosphate | affects cotreatment, increases expression, affects binding | 1 |
ChEMBL screening assays
2 unique, capped per target: 2 binding
Representative assays (with source publication via chembl_document):
| Assay ID | Type | Description | Source paper |
|---|---|---|---|
| CHEMBL615301 | Binding | Binding affinity on 3 beta-hydroxysteroid dehydrogenase | Pharmacological options in the treatment of benign prostatic hyperplasia. — J Med Chem |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.