HSP90AA1

Summary

HSP90AA1 (heat shock protein 90 alpha family class A member 1, HGNC:5253) is a protein-coding gene on chromosome 14q32.31, encoding Heat shock protein HSP 90-alpha (P07900). Molecular chaperone that promotes the maturation, structural maintenance and proper regulation of specific target proteins involved for instance in cell cycle control and signal transduction.

The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 3320 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 91 total
• Druggable target: yes — 48 molecules with ChEMBL bioactivity
• Cancer driver (intOGen): loss-of-function (tumor-suppressor-like) across 1 cancer types
• MANE Select transcript: NM_005348

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:5253
Approved symbol	HSP90AA1
Name	heat shock protein 90 alpha family class A member 1
Location	14q32.31
Locus type	gene with protein product
Status	Approved
Aliases	Hsp89, Hsp90, FLJ31884, HSP90N
Ensembl gene	ENSG00000080824
Ensembl biotype	protein_coding
OMIM	140571
Entrez	3320

Gene structure

Transcript identifiers

Ensembl transcripts: 20 — 14 protein_coding, 4 retained_intron, 2 nonsense_mediated_decay

ENST00000216281, ENST00000334701, ENST00000553585, ENST00000554401, ENST00000555662, ENST00000556554, ENST00000557089, ENST00000557234, ENST00000558600, ENST00000560130, ENST00000877282, ENST00000877283, ENST00000877284, ENST00000877285, ENST00000877286, ENST00000922308, ENST00000922309, ENST00000922310, ENST00000922311, ENST00000922312

RefSeq mRNA: 2 — MANE Select: NM_005348 NM_001017963, NM_005348

CCDS: CCDS32160, CCDS9967

Canonical transcript exons

ENST00000216281 — 11 exons

Exon	Start	End
ENSE00000660444	102082111	102082444
ENSE00000660445	102083034	102083302
ENSE00001335380	102085758	102086124
ENSE00001784253	102080742	102081821
ENSE00003546376	102085298	102085431
ENSE00003556987	102084399	102084564
ENSE00003591532	102084681	102084998
ENSE00003681817	102083546	102083693
ENSE00003690868	102083793	102083983
ENSE00003757865	102086217	102086378
ENSE00003903654	102086986	102087044

Expression profiles

Bgee: expression breadth ubiquitous, 313 present calls, max score 99.99.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 675.5914 / max 30099.5291, expressed in 1828 samples.

FANTOM5 promoters (21 alternative TSS)

Promoter ID	TPM avg	Samples expressed
145005	634.2764	1828
144997	14.5648	1536
144991	10.7139	1406
145010	3.2584	1181
145011	2.6887	658
145000	1.7869	538
144996	1.7064	714
145001	1.2631	619
144992	1.1997	202
145006	0.8873	499

Top tissues by expression

313 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	99.99	gold quality
middle temporal gyrus	UBERON:0002771	99.99	gold quality
Brodmann (1909) area 23	UBERON:0013554	99.99	gold quality
bronchial epithelial cell	CL:0002328	99.98	gold quality
lateral nuclear group of thalamus	UBERON:0002736	99.98	gold quality
CA1 field of hippocampus	UBERON:0003881	99.98	gold quality
choroid plexus epithelium	UBERON:0003911	99.98	gold quality
mucosa of paranasal sinus	UBERON:0005030	99.98	gold quality
superior vestibular nucleus	UBERON:0007227	99.98	gold quality
pons	UBERON:0000988	99.97	gold quality
substantia nigra pars compacta	UBERON:0001965	99.97	gold quality
orbitofrontal cortex	UBERON:0004167	99.97	gold quality
amniotic fluid	UBERON:0000173	99.96	gold quality
cranial nerve II	UBERON:0000941	99.96	gold quality
medulla oblongata	UBERON:0001896	99.96	gold quality
substantia nigra pars reticulata	UBERON:0001966	99.96	gold quality
entorhinal cortex	UBERON:0002728	99.96	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	99.96	gold quality
parietal lobe	UBERON:0001872	99.95	gold quality
olfactory bulb	UBERON:0002264	99.95	gold quality
lateral globus pallidus	UBERON:0002476	99.95	gold quality
postcentral gyrus	UBERON:0002581	99.95	gold quality
dorsal root ganglion	UBERON:0000044	99.94	gold quality
trigeminal ganglion	UBERON:0001675	99.94	gold quality
dorsal plus ventral thalamus	UBERON:0001897	99.94	gold quality
epithelium of nasopharynx	UBERON:0001951	99.94	gold quality
ventral tegmental area	UBERON:0002691	99.94	gold quality
inferior vagus X ganglion	UBERON:0005363	99.94	gold quality
superior frontal gyrus	UBERON:0002661	99.93	gold quality
renal medulla	UBERON:0000362	99.92	gold quality

Single-cell (SCXA)

Detected in 51 experiment(s), a significant marker in 23.

Experiment	Marker?	Max mean expression
E-GEOD-180759	yes	17105.90
E-GEOD-84465	yes	15329.19
E-GEOD-81547	yes	13963.54
E-HCAD-36	yes	12271.39
E-GEOD-124472	yes	12028.07
E-MTAB-6678	yes	11914.83
E-CURD-95	yes	11304.06
E-CURD-88	yes	10395.66
E-GEOD-139324	yes	9686.37
E-MTAB-10283	yes	7345.96
E-CURD-85	yes	6145.60
E-CURD-122	yes	5777.36
E-GEOD-134144	yes	5033.30
E-GEOD-130148	yes	4619.55
E-CURD-10	yes	4121.09

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AR, CEBPB, ESR1, HIF1A, HSF1, HSF2, HSF4, JUN, KLF4, MYC, NFKB1, NFKB, PARP1, POU4F1, POU4F2, RELA, STAT1, STAT3, STAT5A, STAT5B, TP53

miRNA regulators (miRDB)

50 targeting HSP90AA1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-520G-5P	99.99	66.76	658
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-627-3P	99.90	71.42	3316
HSA-MIR-5003-3P	99.85	69.29	2517
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-3679-3P	99.64	69.88	1599
HSA-MIR-141-5P	99.57	67.86	897
HSA-MIR-6716-5P	99.56	68.62	1244
HSA-MIR-6081	99.48	66.07	1446
HSA-MIR-2115-3P	99.31	69.68	2026
HSA-MIR-888-5P	99.30	70.15	1855
HSA-MIR-3925-5P	99.21	67.90	1466
HSA-MIR-8077	99.17	66.67	862
HSA-MIR-3125	99.14	68.49	2269
HSA-MIR-155-3P	99.03	67.99	924
HSA-MIR-361-5P	98.95	70.16	1340
HSA-MIR-374A-3P	98.87	67.82	1531
HSA-MIR-4724-5P	98.87	67.75	1324
HSA-MIR-6889-3P	98.84	67.35	1198
HSA-MIR-4742-3P	98.73	69.82	1803

Literature-anchored findings (GeneRIF, showing 40)

• Cisplatin may provide a pharmacological tool to dissect C- and N-terminal nucleotide binding of Hsp90. A model is proposed on the interactions of the two nucleotide-binding domains and the charged region of Hsp90. (PMID:11751878)
• These data indicate that sequences within the last one-fourth of hsp90 regulate ATP hydrolysis (PMID:11751892)
• association of PDK1 with Hsp90 regulates its stability, solubility, and signaling (PMID:11779851)
• Two distinct regions of the immunophilin-like protein XAP2 regulate dioxin receptor function and interaction with hsp90 (PMID:11805120)
• HSP40 binding is the first step in the HSP90 chaperoning pathway for the progesterone receptor (PMID:11809754)
• we show that in mammals, the cytosolic chaperones Hsp90 and Hsp70 dock onto a specialized TPR domain in the import receptor Tom70 at the outer mitochondrial membrane. (PMID:12526792)
• TPR2 combines two TPR domains and a J domain to regulate the Hsp70/Hsp90 chaperone system. (PMID:12853476)
• Heat shock protein 90 is an endogenous protein enhancer of inducible nitric-oxide synthase (PMID:12855682)
• nuclear localization of N-WASP modulates Src kinase activity by regulating HSP90 expression (PMID:12871950)
• GRK2, GRK3, GRK5, and GRK6 are stabilized by interaction with Hsp90, revealing that GRK interaction with heat shock proteins plays an important role in regulating GRK maturation. (PMID:14557268)
• HSP90 has a role in regulation of levels of Chk1 and sensitization of tumor cells to replication stress (PMID:14570880)
• Hsp90, a molecular chaperone that is central to the cellular stress response, associates with survivin, an apoptosis inhibitor and essential regulator of mitosis. (PMID:14614132)
• heteromeric complex containing the molecular chaperones Hsp90 and Cdc37/p50 interacts with the kinase domain of LKB1 (PMID:14668798)
• by induction of HSP90A c-Myc may control the activity of multiple signal pathways involved in cellular transformation (PMID:14724288)
• Hsp90/p50cdc37 is required for mixed-lineage kinase (MLK) 3 signaling (PMID:15001580)
• Hsp90 is expressed on the surface of tumor cells and is present in advanced malignant melanomas. (PMID:15009113)
• In neurites, movement by diffusion is not possible, and we show that movement of the GFP-Glucocorticoid Receptor from neurites is blocked by geldanamycin, suggesting that the hsp90-dependent movement machinery is required for retrograde movement. (PMID:15046863)
• the role of Hsp90 in nuclear retention of GR after ligand withdrawal (PMID:15062560)
• the activation mechanism of HSP90 molecular chaperone that heat stress induces the liberation of the oligomerization/client-binding site of residues 311-350 by disrupting the intramolecular interaction between residues 289-389 and 401-546 (PMID:15182205)
• Hsp90 chaperone activity is important for the transcriptional activity of genotypically wild-type p53 (PMID:15358769)
• Hsp90 is required to maintain the folded, active state of p53 by a reversible interaction (PMID:15358771)
• upregulation with ecNOS prevents apoptosis in endothelial cells induced by high glucose (PMID:15526284)
• T cell immunity to Hsp70 and Hsp90, like Hsp60-specific immunity, can modulate arthritogenic response in adjuvant arthritis. Regulatory mechanisms induced by Hsp60, Hsp70, and Hsp90 are reinforced by an immune network that connects their reactivities. (PMID:15529360)
• cell lines that contain human tumor-derived temperature-sensitive p53 mutants show that Hsp90 is required for both stabilization and reactivation of mutated p53 at the permissive temperature (PMID:15613472)
• the Hsp90.Cdc37 molecular chaperone module has a central role in interleukin-1 receptor-associated-kinase-dependent signaling by toll-like receptors (PMID:15647277)
• Hsp90 is involved in hsp70 mRNA stabilisation and the HSF1 activation can be suppressed by high hydrostatic pressure (PMID:15777846)
• Hsp90-Akt forms a complex with ASK1 and protect vascular endothelium from stress-induced apoptosis. (PMID:15782121)
• Data suggest that HSP90 induces efficient activation of N-WASP downstream of phosphorylation signal by Src family kinases and is critical for N-WASP-dependent podosome formation and neurite extension. (PMID:15791211)
• S-nitrosylation may functionally regulate the general activities of Hsp90 and provide a feedback mechanism for limiting endothelial nitric oxide synthase activation. (PMID:15937123)
• inhibition of Hsp90 leads to ZAP-70 degradation, apoptosis, and impaired signaling (PMID:15972449)
• Component of the c-Ha-ras ARE/EpRE heterocomplex. We conclude that both internal bases and flanking sequences regulate nuclear protein recruitment and complex assembly. (PMID:16038408)
• association of Hsp90 with ClC-2 results in greater channel activity due to increased cell surface channel expression, facilitation of channel opening, and enhanced channel sensitivity to intracellular [Cl-] (PMID:16049054)
• Sp1 interacts with Hsp90alpha to recruit it to the promoter of 12(S)-lipoxygenase and then to regulate gene transcription by modulating the binding ability of Sp1 to promoters (PMID:16118214)
• Nuclear magnetic resonance study of binding to CDC37. (PMID:16132836)
• The function of Hsp90alpha is impaired by the Q488H polymorphism. (PMID:16171778)
• By applying co-immunoprecipitation with endogeneous Hsp90, there were identified 39 novel protein interaction partners of this chaperone in human embryonic kidney cells (HEK293). (PMID:16263121)
• HSF1 phosphorylation by MAPK-activated protein kinase 2 on serine 121, inhibits transcriptional activity and promotes HSP90 binding (PMID:16278218)
• JAK1/2 are client proteins of Hsp90 alpha and beta; Hsp90 and CDC37 play a critical role in types I and II interferon pathways (PMID:16280321)
• The aberrant expression of ZAP-70 in more aggressive forms of chronic lymphocytic leukemia requires the chaperoning action of activated heat-shock protein 90, which may be specifically inhibited by the therapeutic strategies discussed in this review. (PMID:16300468)
• Chk1 is post-translationally chaperoned to an active kinase. This reaction minimally requires Hsp90, Hsp70, Hsp40, Cdc37, and the protein kinase CK2. (PMID:16330544)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	hsp90aa1.1	ENSDARG00000010478
danio_rerio	hsp90aa1.2	ENSDARG00000024746
mus_musculus	Hsp90aa1	ENSMUSG00000021270
rattus_norvegicus	Hsp90aa1	ENSRNOG00000059714
drosophila_melanogaster	Hsp83	FBGN0001233
caenorhabditis_elegans		WBGENE00000915

Paralogs (3): HSP90AB1 (ENSG00000096384), TRAP1 (ENSG00000126602), HSP90B1 (ENSG00000166598)

Protein

Protein identifiers

Heat shock protein HSP 90-alpha — P07900 (reviewed: P07900)

Alternative names: Heat shock 86 kDa, Heat shock protein family C member 1, Lipopolysaccharide-associated protein 2, Renal carcinoma antigen NY-REN-38

All UniProt accessions (6): P07900, A0A0U1RR69, G3V2J8, G3V592, H0YJF5, K9JA46

UniProt curated annotations — full annotation on UniProt →

Function. Molecular chaperone that promotes the maturation, structural maintenance and proper regulation of specific target proteins involved for instance in cell cycle control and signal transduction. Undergoes a functional cycle that is linked to its ATPase activity which is essential for its chaperone activity. This cycle probably induces conformational changes in the client proteins, thereby causing their activation. Interacts dynamically with various co-chaperones that modulate its substrate recognition, ATPase cycle and chaperone function. Engages with a range of client protein classes via its interaction with various co-chaperone proteins or complexes, that act as adapters, simultaneously able to interact with the specific client and the central chaperone itself. Recruitment of ATP and co-chaperone followed by client protein forms a functional chaperone. After the completion of the chaperoning process, properly folded client protein and co-chaperone leave HSP90 in an ADP-bound partially open conformation and finally, ADP is released from HSP90 which acquires an open conformation for the next cycle. Plays a critical role in mitochondrial import, delivers preproteins to the mitochondrial import receptor TOMM70. Apart from its chaperone activity, it also plays a role in the regulation of the transcription machinery. HSP90 and its co-chaperones modulate transcription at least at three different levels. In the first place, they alter the steady-state levels of certain transcription factors in response to various physiological cues. Second, they modulate the activity of certain epigenetic modifiers, such as histone deacetylases or DNA methyl transferases, and thereby respond to the change in the environment. Third, they participate in the eviction of histones from the promoter region of certain genes and thereby turn on gene expression. Binds bacterial lipopolysaccharide (LPS) and mediates LPS-induced inflammatory response, including TNF secretion by monocytes. Antagonizes STUB1-mediated inhibition of TGF-beta signaling via inhibition of STUB1-mediated SMAD3 ubiquitination and degradation. Mediates the association of TOMM70 with IRF3 or TBK1 in mitochondrial outer membrane which promotes host antiviral response. (Microbial infection) Seems to interfere with N.meningitidis NadA-mediated invasion of human cells. Decreasing HSP90 levels increases adhesion and entry of E.coli expressing NadA into human Chang cells; increasing its levels leads to decreased adhesion and invasion.

Subunit / interactions. Homodimer. Identified in NR3C1/GCR steroid receptor-chaperone complexes formed at least by NR3C1, HSP90AA1 and a variety of proteins containing TPR repeats such as FKBP4, FKBP5, PPID, PPP5C or STIP1. Forms a complex containing HSP90AA1, TSC1 and TSC2; TSC1 is required to recruit TCS2 to the complex. The closed form interacts (via the middle domain and TPR repeat-binding motif) with co-chaperone TSC1 (via C-terminus). Interacts with TOM34. Interacts with TERT; the interaction, together with PTGES3, is required for correct assembly and stabilization of the TERT holoenzyme complex. Interacts with CHORDC1 and DNAJC7. Interacts with STUB1 and UBE2N; may couple the chaperone and ubiquitination systems. Interacts (via TPR repeat-binding motif) with PPP5C (via TPR repeats); the interaction is direct and activates PPP5C phosphatase activity. Following LPS binding, may form a complex with CXCR4, GDF5 and HSPA8. Interacts with KSR1. Interacts with co-chaperone CDC37 (via C-terminus); the interaction inhibits HSP90AA1 ATPase activity. May interact with NWD1. Interacts with FNIP1 and FNIP2; the interaction inhibits HSP90AA1 ATPase activity. Interacts with co-chaperone AHSA1 (phosphorylated on ‘Tyr-223’); the interaction activates HSP90AA1 ATPase activity and results in the dissociation of TSC1 from HSP90AA1. Interacts with FLCN in the presence of FNIP1. Interacts with HSP70, STIP1 and PTGES3. Interacts with SMYD3; this interaction enhances SMYD3 histone-lysine N-methyltransferase. Interacts with SGTA (via TPR repeats). Interacts with TTC1 (via TPR repeats). Interacts with HSF1 in an ATP-dependent manner. Interacts with MET; the interaction suppresses MET kinase activity. Interacts with ERBB2 in an ATP-dependent manner; the interaction suppresses ERBB2 kinase activity. Interacts with HIF1A, KEAP1 and RHOBTB2. Interacts with HSF1; this interaction is decreased in a IER5-dependent manner, promoting HSF1 accumulation in the nucleus, homotrimerization and DNA-binding activities. Interacts with STUB1 and SMAD3. Interacts with HSP90AB1; interaction is constitutive. Interacts with HECTD1 (via N-terminus). Interacts with NR3C1 (via domain NR LBD) and NR1D1 (via domain NR LBD). Interacts with NLPR12. Interacts with PDCL3. Interacts with TOMM70; the interaction is required for preprotein mitochondrial import. Interacts with TOMM70, IRF3 and TBK1; the interactions are direct and mediate the association of TOMM70 with IRF3 and TBK1. Forms a complex with ASL, ASS1 and NOS2; the complex regulates cell-autonomous L-arginine synthesis and citrulline recycling while channeling extracellular L-arginine to nitric oxide synthesis pathway. (Microbial infection) Interacts with herpes simplex virus 1 protein US11; this interaction inhibits TBK1-induced interferon production. (Microbial infection) Interacts with N.meningitidis serogroup B adhesin A (nadA). Interaction is stabilized by ADP and 17-AAG (17-N-allylamino-17-demethoxygeldanamycin) and inhibited by ATP. Decreasing HSP90 levels increases adhesion and entry of bacterial into human Chang cells; increasing its levels leads to decreased adhseion and invasion.

Subcellular location. Nucleus. Cytoplasm. Melanosome. Cell membrane. Mitochondrion.

Post-translational modifications. ISGylated. S-nitrosylated; negatively regulates the ATPase activity and the activation of eNOS by HSP90AA1. Ubiquitinated via ‘Lys-63’-linked polyubiquitination by HECTD1. Ubiquitination promotes translocation into the cytoplasm away from the membrane and secretory pathways.

Activity regulation. In the resting state, through the dimerization of its C-terminal domain, HSP90 forms a homodimer which is defined as the open conformation. Upon ATP-binding, the N-terminal domain undergoes significant conformational changes and comes in contact to form an active closed conformation. After HSP90 finishes its chaperoning tasks of assisting the proper folding, stabilization and activation of client proteins under the active state, ATP molecule is hydrolyzed to ADP which then dissociates from HSP90 and directs the protein back to the resting state. Co-chaperone TSC1 promotes ATP binding and inhibits HSP90AA1 ATPase activity. Binding to phosphorylated AHSA1 promotes HSP90AA1 ATPase activity. Inhibited by geldanamycin, Ganetespib (STA-9090) and SNX-2112.

Domain organisation. The TPR repeat-binding motif mediates interaction with TPR repeat-containing proteins like the co-chaperone STUB1.

Similarity. Belongs to the heat shock protein 90 family.

Isoforms (2)

UniProt ID	Names	Canonical?
P07900-1	1, HSP90AA1-1, HSP90-alpha 2	yes
P07900-2	2, HSP90AA1-2

RefSeq proteins (2): NP_001017963, NP_005339* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001404	Hsp90_fam	Family
IPR003594	HATPase_dom	Domain
IPR019805	Heat_shock_protein_90_CS	Conserved_site
IPR020568	Ribosomal_Su5_D2-typ_SF	Homologous_superfamily
IPR020575	Hsp90_N	Domain
IPR036890	HATPase_C_sf	Homologous_superfamily
IPR037196	HSP90_C	Homologous_superfamily

Pfam: PF00183, PF13589

Enzyme classification (BRENDA):

• EC 3.6.4.10 — non-chaperonin molecular chaperone ATPase (BRENDA: 16 organisms, 6 substrates, 0 inhibitors, 0 Km, 0 kcat entries)

Catalyzed reactions (Rhea), 1 shown:

• ATP + H2O = ADP + phosphate + H(+) (RHEA:13065)

UniProt features (124 total): helix 32, strand 29, modified residue 17, mutagenesis site 11, region of interest 10, turn 9, binding site 5, sequence conflict 4, compositionally biased region 2, initiator methionine 1, chain 1, short sequence motif 1, sequence variant 1, splice variant 1

Structure

Experimental structures (PDB)

448 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
6TN5	X-RAY DIFFRACTION	1.17
5J80	X-RAY DIFFRACTION	1.17
3T0H	X-RAY DIFFRACTION	1.2
5J2X	X-RAY DIFFRACTION	1.22
3T10	X-RAY DIFFRACTION	1.24
6TN4	X-RAY DIFFRACTION	1.27
3WHA	X-RAY DIFFRACTION	1.3
5XRD	X-RAY DIFFRACTION	1.3
2YK9	X-RAY DIFFRACTION	1.32
5LRL	X-RAY DIFFRACTION	1.33
6GR5	X-RAY DIFFRACTION	1.34
3B28	X-RAY DIFFRACTION	1.35
5J64	X-RAY DIFFRACTION	1.38
7HBS	X-RAY DIFFRACTION	1.38
7HBT	X-RAY DIFFRACTION	1.38
3VHA	X-RAY DIFFRACTION	1.39
1UYL	X-RAY DIFFRACTION	1.4
2YI7	X-RAY DIFFRACTION	1.4
3VHC	X-RAY DIFFRACTION	1.41
7H9L	X-RAY DIFFRACTION	1.42
2YKE	X-RAY DIFFRACTION	1.43
6GQS	X-RAY DIFFRACTION	1.43
6OLX	X-RAY DIFFRACTION	1.44
5LO5	X-RAY DIFFRACTION	1.44
5LR1	X-RAY DIFFRACTION	1.44
5NYI	X-RAY DIFFRACTION	1.44
7HBU	X-RAY DIFFRACTION	1.44
7HBZ	X-RAY DIFFRACTION	1.44
7S9H	X-RAY DIFFRACTION	1.45
8X2R	X-RAY DIFFRACTION	1.45

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P07900-F1	85.55	0.61

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (5): 51; 93; 112; 138; 400

Post-translational modifications (17): 5, 7, 58, 84, 231, 252, 263, 313, 443, 453, 458, 476, 489, 492, 585, 598, 641

Mutagenesis-validated functional residues (11):

Position	Phenotype
47	strong atp-binding. strong interaction with hsf1, hif1a, erbb2, met, keap1 and rhobtb2. no effect on interaction with ts
93	impaired atp-binding. strong interaction with hif1a, met, keap1 and rhobtb2. loss of interaction with hsf1 and erbb2. lo
97	abolishes atpase activity.
313	loss of interaction with tsc1 and increases interaction with ahsa1.
313	no deffect on the interaction with tsc1.
598	reduces atpase activity and client protein activation.
598	loss of s-nitrosylation.
728–732	loss of interaction with tomm70. no effect on interaction with irf3.
728–732	loss of interaction with tsc1.
729–732	loss of interaction with tomm70.
731–732	loss of interaction with tomm70. no effect on interaction with irf3.

Function

Pathways and Gene Ontology

Reactome pathways

55 pathways

ID	Pathway
R-HSA-1227986	Signaling by ERBB2
R-HSA-1236382	Constitutive Signaling by Ligand-Responsive EGFR Cancer Variants
R-HSA-1474151	Tetrahydrobiopterin (BH4) synthesis, recycling, salvage and regulation
R-HSA-168928	DDX58/IFIH1-mediated induction of interferon-alpha/beta
R-HSA-192905	vRNP Assembly
R-HSA-2029482	Regulation of actin dynamics for phagocytic cup formation
R-HSA-203615	eNOS activation
R-HSA-2565942	Regulation of PLK1 Activity at G2/M Transition
R-HSA-3000484	Scavenging by Class F Receptors
R-HSA-3371497	HSP90 chaperone cycle for steroid hormone receptors (SHR) in the presence of ligand
R-HSA-3371511	HSF1 activation
R-HSA-3371568	Attenuation phase
R-HSA-3371571	HSF1-dependent transactivation
R-HSA-380259	Loss of Nlp from mitotic centrosomes
R-HSA-380270	Recruitment of mitotic centrosome proteins and complexes
R-HSA-380284	Loss of proteins required for interphase microtubule organization from the centrosome
R-HSA-380320	Recruitment of NuMA to mitotic centrosomes
R-HSA-399954	Sema3A PAK dependent Axon repulsion
R-HSA-4420097	VEGFA-VEGFR2 Pathway
R-HSA-5218920	VEGFR2 mediated vascular permeability
R-HSA-5336415	Uptake and function of diphtheria toxin
R-HSA-5601884	PIWI-interacting RNA (piRNA) biogenesis
R-HSA-5620912	Anchoring of the basal body to the plasma membrane
R-HSA-5637810	Constitutive Signaling by EGFRvIII
R-HSA-5675482	Regulation of necroptotic cell death
R-HSA-6785807	Interleukin-4 and Interleukin-13 signaling
R-HSA-6798695	Neutrophil degranulation
R-HSA-8852276	The role of GTSE1 in G2/M progression after G2 checkpoint
R-HSA-8854518	AURKA Activation by TPX2
R-HSA-8863795	Downregulation of ERBB2 signaling

MSigDB gene sets: 669 (showing top): REACTOME_DDX58_IFIH1_MEDIATED_INDUCTION_OF_INTERFERON_ALPHA_BETA, GSE45365_NK_CELL_VS_BCELL_UP, BIOCARTA_GCR_PATHWAY, GOBP_RNA_TEMPLATED_DNA_BIOSYNTHETIC_PROCESS, GOBP_CHROMOSOME_ORGANIZATION, SHEPARD_BMYB_MORPHOLINO_UP, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, MULLIGHAN_NPM1_SIGNATURE_3_UP, HORIUCHI_WTAP_TARGETS_DN, GOBP_REGULATION_OF_PROTEIN_POLYMERIZATION, GOBP_CELLULAR_RESPONSE_TO_VIRUS, REACTOME_INNATE_IMMUNE_SYSTEM, SHIPP_DLBCL_VS_FOLLICULAR_LYMPHOMA_UP, BIOCARTA_TEL_PATHWAY

GO Biological Process (41): neuron migration (GO:0001764), activation of innate immune response (GO:0002218), positive regulation of defense response to virus by host (GO:0002230), skeletal muscle contraction (GO:0003009), protein folding (GO:0006457), mitochondrial transport (GO:0006839), response to unfolded protein (GO:0006986), telomere maintenance via telomerase (GO:0007004), response to heat (GO:0009408), response to cold (GO:0009409), response to xenobiotic stimulus (GO:0009410), response to salt stress (GO:0009651), positive regulation of lamellipodium assembly (GO:0010592), cardiac muscle cell apoptotic process (GO:0010659), protein import into mitochondrial matrix (GO:0030150), regulation of protein ubiquitination (GO:0031396), positive regulation of telomere maintenance via telomerase (GO:0032212), positive regulation of protein polymerization (GO:0032273), positive regulation of interferon-beta production (GO:0032728), regulation of protein localization (GO:0032880), cellular response to heat (GO:0034605), protein refolding (GO:0042026), response to cocaine (GO:0042220), positive regulation of protein import into nucleus (GO:0042307), regulation of apoptotic process (GO:0042981), regulation of protein-containing complex assembly (GO:0043254), protein unfolding (GO:0043335), response to estrogen (GO:0043627), positive regulation of nitric oxide biosynthetic process (GO:0045429), positive regulation of protein catabolic process (GO:0045732), positive regulation of cell size (GO:0045793), nitric oxide metabolic process (GO:0046209), response to antibiotic (GO:0046677), protein stabilization (GO:0050821), chaperone-mediated protein complex assembly (GO:0051131), positive regulation of cardiac muscle contraction (GO:0060452), chaperone-mediated autophagy (GO:0061684), cellular response to virus (GO:0098586), regulation of postsynaptic membrane neurotransmitter receptor levels (GO:0099072), neurofibrillary tangle assembly (GO:1902988)

GO Molecular Function (32): UTP binding (GO:0002134), CTP binding (GO:0002135), RNA binding (GO:0003723), mRNA binding (GO:0003729), ATP binding (GO:0005524), GTP binding (GO:0005525), ATP hydrolysis activity (GO:0016887), sulfonylurea receptor binding (GO:0017098), protein phosphatase binding (GO:0019903), MHC class II protein complex binding (GO:0023026), nitric-oxide synthase regulator activity (GO:0030235), TPR domain binding (GO:0030911), ubiquitin protein ligase binding (GO:0031625), dATP binding (GO:0032564), identical protein binding (GO:0042802), protein homodimerization activity (GO:0042803), histone deacetylase binding (GO:0042826), transmembrane transporter binding (GO:0044325), tau protein binding (GO:0048156), GTPase binding (GO:0051020), Rho GDP-dissociation inhibitor binding (GO:0051022), obsolete unfolded protein binding (GO:0051082), DNA polymerase binding (GO:0070182), scaffold protein binding (GO:0097110), disordered domain specific binding (GO:0097718), ATP-dependent protein folding chaperone (GO:0140662), enzyme-substrate adaptor activity (GO:0140767), protein tyrosine kinase binding (GO:1990782), nucleotide binding (GO:0000166), protein binding (GO:0005515), hydrolase activity (GO:0016787), protein folding chaperone (GO:0044183)

GO Cellular Component (29): extracellular region (GO:0005576), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), mitochondrion (GO:0005739), cytosol (GO:0005829), plasma membrane (GO:0005886), cell surface (GO:0009986), membrane (GO:0016020), basolateral plasma membrane (GO:0016323), extracellular matrix (GO:0031012), brush border membrane (GO:0031526), protein-containing complex (GO:0032991), secretory granule lumen (GO:0034774), melanosome (GO:0042470), neuronal cell body (GO:0043025), lysosomal lumen (GO:0043202), myelin sheath (GO:0043209), dendritic growth cone (GO:0044294), axonal growth cone (GO:0044295), perinuclear region of cytoplasm (GO:0048471), extracellular exosome (GO:0070062), endocytic vesicle lumen (GO:0071682), sperm mitochondrial sheath (GO:0097226), sperm plasma membrane (GO:0097524), protein folding chaperone complex (GO:0101031), ficolin-1-rich granule lumen (GO:1904813), apical plasma membrane (GO:0016324), sperm flagellum (GO:0036126)

Reactome top-level categories

Rollup of top-18 pathways:

Category	Pathways
Cellular response to heat stress	2
Centrosome maturation	2
Signaling by Receptor Tyrosine Kinases	1
Signaling by Ligand-Responsive EGFR Variants in Cancer	1
Metabolism of cofactors	1
Innate Immune System	1
Influenza Viral RNA Transcription and Replication	1
Fcgamma receptor (FCGR) dependent phagocytosis	1
Metabolism of nitric oxide: NOS3 activation and regulation	1
G2/M Transition	1
Binding and Uptake of Ligands by Scavenger Receptors	1
Cellular responses to stress	1
HSF1-dependent transactivation	1
Loss of proteins required for interphase microtubule organization from the centrosome	1
Mitotic Prometaphase	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	7
anion binding	3
response to stress	2
response to temperature stimulus	2
pyrimidine ribonucleotide binding	2
purine ribonucleoside triphosphate binding	2
protein binding	2
enzyme binding	2
intracellular membrane-bounded organelle	2
cytoplasm	2
growth cone	2
cell migration	1
generation of neurons	1
activation of immune response	1
positive regulation of innate immune response	1
regulation of defense response to virus by host	1
striated muscle contraction	1
musculoskeletal movement	1
cellular process	1
protein maturation	1
intracellular transport	1
response to topologically incorrect protein	1
telomerase activity	1
RNA-templated DNA biosynthetic process	1
telomere maintenance via telomere lengthening	1
telomere-telomerase complex assembly	1
response to chemical	1
response to osmotic stress	1
regulation of lamellipodium assembly	1
lamellipodium assembly	1
positive regulation of plasma membrane bounded cell projection assembly	1
positive regulation of lamellipodium organization	1
striated muscle cell apoptotic process	1
protein transmembrane import into intracellular organelle	1
protein localization to mitochondrion	1
import into the mitochondrion	1
mitochondrial protein import pathway	1
protein ubiquitination	1
regulation of protein modification by small protein conjugation or removal	1
telomere maintenance via telomerase	1

Protein interactions and networks

STRING

10270 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HSP90AA1	CDC37	Q16543	999
HSP90AA1	DNAJB1	P25685	999
HSP90AA1	HSPA4	P34932	999
HSP90AA1	HSPA8	P11142	999
HSP90AA1	STIP1	P31948	999
HSP90AA1	FKBP4	Q02790	998
HSP90AA1	AHSA1	O95433	998
HSP90AA1	STUB1	Q9UNE7	997
HSP90AA1	PPID	Q08752	997
HSP90AA1	NR3C1	P04150	996
HSP90AA1	AKT1	P31749	996
HSP90AA1	FKBP5	Q13451	996
HSP90AA1	TP53	P04637	995
HSP90AA1	AIP	O00170	995
HSP90AA1	TOMM70	O94826	995

IntAct

775 interactions, top by confidence:

A	B	Type	Score
PRKAA1	PRKAB2	psi-mi:“MI:0914”(association)	0.950
MAP3K14	CHUK	psi-mi:“MI:0914”(association)	0.950
MAPK14	RPS6KA4	psi-mi:“MI:0914”(association)	0.870
ERBB2	HSP90AA1	psi-mi:“MI:0915”(physical association)	0.860
HSP90AA1	HSP90AA1	psi-mi:“MI:0407”(direct interaction)	0.850
RPAP3	HSP90AA1	psi-mi:“MI:0407”(direct interaction)	0.850
HSP90AA1	STUB1	psi-mi:“MI:0915”(physical association)	0.830
STUB1	HSP90AA1	psi-mi:“MI:0915”(physical association)	0.830
EGFR	HSP90AA1	psi-mi:“MI:0915”(physical association)	0.820
EGFR	HSP90AA1	psi-mi:“MI:0914”(association)	0.820
FKBP5	HSP90AA1	psi-mi:“MI:0407”(direct interaction)	0.800
HSP90AA1	FYN	psi-mi:“MI:0915”(physical association)	0.800
NR3C1	HSP90AA1	psi-mi:“MI:0915”(physical association)	0.770
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
HLA-A	TAPBP	psi-mi:“MI:0915”(physical association)	0.690
BRAF	KRAS	psi-mi:“MI:0914”(association)	0.680
HSP90AA1	SRC	psi-mi:“MI:0915”(physical association)	0.670
HSP90AA1	CAMK2A	psi-mi:“MI:0915”(physical association)	0.670
HSP90AA1	PRKACA	psi-mi:“MI:0915”(physical association)	0.670
APP	HSP90AA1	psi-mi:“MI:0915”(physical association)	0.670

BioGRID (2668): HSP90AA1 (Affinity Capture-Western), HSP90AA1 (Affinity Capture-Western), HSP90AA1 (Affinity Capture-Western), HSP90AA1 (Affinity Capture-Western), HSF1 (Affinity Capture-Western), HSP90AA1 (Affinity Capture-Western), PTGDS (Affinity Capture-Western), PTGDS (Reconstituted Complex), HSP90AA1 (Affinity Capture-Western), HSP90AA1 (Affinity Capture-Western), HSP90AA1 (Affinity Capture-MS), HSP90AA1 (Affinity Capture-MS), HSP90AA1 (PCA), PTGES3 (Affinity Capture-Western), HSP90AA1 (Reconstituted Complex)

ESM2 similar proteins: A2YWQ1, A5A6K9, O02192, O02705, O03986, O43109, O44001, O57521, O61998, P02828, P02829, P04809, P07900, P07901, P08238, P11499, P11501, P15108, P24724, P27323, P30946, P30947, P34058, P36181, P40292, P41887, P51818, P51819, P54651, P55737, P82995, Q04619, Q07078, Q08277, Q0J4P2, Q18688, Q4R4P1, Q4R4T5, Q4UDU8, Q5R710

Diamond homologs: A0KL53, A1ANS1, A1WXE4, A2YWQ1, A3QF50, A4SLY0, A5A6K9, A5GER7, B0TP05, F4JFN3, O02192, O02705, O03986, O18750, O43109, O44001, O57521, O61998, P02828, P02829, P04809, P04810, P04811, P06660, P07900, P07901, P08110, P08113, P08238, P11499, P11501, P12861, P14625, P15108, P24724, P27323, P27741, P27890, P30946, P30947

SIGNOR signaling

28 interactions.

A	Effect	B	Mechanism
HSP90AA1	up-regulates	PPP5C	binding
PRKACA	unknown	HSP90AA1	phosphorylation
HSP90AA1	up-regulates	TGFBR1	binding
HSP90AA1	up-regulates	TGFBR2	binding
luminespib	down-regulates	HSP90AA1	“chemical inhibition”
PRKCG	down-regulates	HSP90AA1	phosphorylation
PRKDC	unknown	HSP90AA1	phosphorylation
CSNK2A1	unknown	HSP90AA1	phosphorylation
HSP90AA1	“up-regulates activity”	AR	binding
HSP90AA1	down-regulates	NR3C1	binding
HSP90AA1	“up-regulates quantity by stabilization”	PAFAH1B1	binding
AHSA1	“up-regulates activity”	HSP90AA1	binding
HSP90AA1	“up-regulates quantity by stabilization”	NOD2	binding
HSP90AA1	“up-regulates quantity by stabilization”	FLCN	binding
HECTD1	“down-regulates quantity”	HSP90AA1	ubiquitination
STIP1	“down-regulates activity”	HSP90AA1	binding
FNIP1	“down-regulates activity”	HSP90AA1	binding
FNIP2	“down-regulates activity”	HSP90AA1	binding
HSP90AA1	“up-regulates quantity”	CBLL1	binding
HSP90AA1	“up-regulates quantity by stabilization”	LGMN	binding
HSP90AA1	“down-regulates activity”	FER	phosphorylation
HSP90AA1	up-regulates	NOS3	binding
TOMM70	“up-regulates activity”	HSP90AA1	binding
PTGES3	“up-regulates activity”	HSP90AA1	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 183 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Regulation of KIT signaling	6	25.4×	3e-06
Signaling by RAS mutants	8	23.8×	6e-08
Signaling by high-kinase activity BRAF mutants	10	22.3×	2e-09
Co-inhibition by CTLA4	6	21.9×	6e-06
Signaling by phosphorylated juxtamembrane, extracellular and kinase domain KIT mutants	6	21.9×	6e-06
Signaling by RAF1 mutants	11	21.6×	1e-09
MAP2K and MAPK activation	10	20.1×	5e-09
Signaling by moderate kinase activity BRAF mutants	11	19.7×	1e-09

GO biological processes:

GO term	Partners	Fold	FDR
Fc-gamma receptor signaling pathway involved in phagocytosis	7	29.8×	9e-07
positive regulation of peptidyl-serine phosphorylation	6	27.9×	7e-06
negative regulation of inflammatory response to antigenic stimulus	7	25.5×	2e-06
lipopolysaccharide-mediated signaling pathway	7	22.3×	3e-06
regulation of microtubule cytoskeleton organization	6	19.8×	5e-05
leukocyte migration	5	18.9×	4e-04
T cell costimulation	8	18.2×	2e-06
insulin-like growth factor receptor signaling pathway	6	18.0×	9e-05

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: loss-of-function (tumor-suppressor-like) across 1 cancer types — BRCA.

Clinical variants and AI predictions

ClinVar

91 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	56
Likely benign	2
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

1252 predictions. Top by Δscore:

Variant	Effect	Δscore
14:102081819:TAC:T	acceptor_gain	1.0000
14:102081819:TACCT:T	acceptor_loss	1.0000
14:102081820:ACC:A	acceptor_loss	1.0000
14:102081822:C:CC	acceptor_gain	1.0000
14:102081822:C:G	acceptor_loss	1.0000
14:102081823:T:A	acceptor_loss	1.0000
14:102081829:C:CT	acceptor_gain	1.0000
14:102081829:C:T	acceptor_gain	1.0000
14:102082441:CCAC:C	acceptor_gain	1.0000
14:102082442:CACC:C	acceptor_gain	1.0000
14:102082445:C:A	acceptor_loss	1.0000
14:102082446:T:G	acceptor_loss	1.0000
14:102083540:TCTTA:T	donor_loss	1.0000
14:102083541:CTTAC:C	donor_loss	1.0000
14:102083542:TTA:T	donor_loss	1.0000
14:102083543:TACCT:T	donor_loss	1.0000
14:102083544:A:AC	donor_gain	1.0000
14:102083544:A:C	donor_loss	1.0000
14:102083545:C:CC	donor_gain	1.0000
14:102083545:C:CG	donor_loss	1.0000
14:102083545:CCT:C	donor_gain	1.0000
14:102083689:CCAAG:C	acceptor_gain	1.0000
14:102083690:CAAG:C	acceptor_gain	1.0000
14:102083690:CAAGC:C	acceptor_gain	1.0000
14:102083691:AAGCT:A	acceptor_loss	1.0000
14:102083692:AG:A	acceptor_gain	1.0000
14:102083693:GC:G	acceptor_loss	1.0000
14:102083694:C:A	acceptor_loss	1.0000
14:102083694:C:CC	acceptor_gain	1.0000
14:102083695:TGAAA:T	acceptor_loss	1.0000

AlphaMissense

4898 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
14:102082117:C:G	G695R	1.000
14:102082140:C:A	R687M	1.000
14:102082172:G:C	F676L	1.000
14:102082172:G:T	F676L	1.000
14:102082173:A:G	F676S	1.000
14:102082174:A:G	F676L	1.000
14:102082188:A:G	L671P	1.000
14:102082192:C:G	A670P	1.000
14:102082215:A:G	L662P	1.000
14:102082293:A:T	I636K	1.000
14:102082299:A:G	L634P	1.000
14:102082339:C:G	D621H	1.000
14:102082344:A:G	L619P	1.000
14:102082344:A:T	L619Q	1.000
14:102082347:G:T	A618D	1.000
14:102082354:C:G	A616P	1.000
14:102082359:A:G	M614T	1.000
14:102082359:A:T	M614K	1.000
14:102082362:A:C	I613S	1.000
14:102082362:A:G	I613T	1.000
14:102082362:A:T	I613N	1.000
14:102082370:C:A	M610I	1.000
14:102082370:C:G	M610I	1.000
14:102082370:C:T	M610I	1.000
14:102082380:G:A	T607I	1.000
14:102082382:C:A	W606C	1.000
14:102082382:C:G	W606C	1.000
14:102082384:A:G	W606R	1.000
14:102082384:A:T	W606R	1.000
14:102082386:C:A	G605V	1.000

dbSNP variants (sampled 300 via entrez): RS1000055689 (14:102139847 G>A), RS1000062529 (14:102110873 G>A), RS1000100990 (14:102116518 G>A), RS1000151696 (14:102096101 T>C), RS1000176361 (14:102108647 T>C), RS1000265835 (14:102104901 A>G), RS1000278117 (14:102111750 T>C), RS1000308373 (14:102108964 ATTTTTATTGGACAGCTGAAT>A), RS1000314767 (14:102114017 A>T), RS1000366122 (14:102139645 G>A,C), RS1000366860 (14:102098217 A>C), RS1000395601 (14:102141481 G>A,C), RS1000417918 (14:102098436 A>G), RS1000475226 (14:102119875 A>G), RS1000518661 (14:102130291 C>T)

Disease associations

OMIM: gene MIM:140571 | disease phenotypes: MIM:145600

GenCC curated gene-disease

Mondo (1): malignant hyperthermia, susceptibility to, 1 (MONDO:0007783)

Orphanet (1): Malignant hyperthermia of anesthesia (Orphanet:423)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST007656_14	Chronic obstructive pulmonary disease or resting heart rate (pleiotropy)	1.000000e-11

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C535694	Malignant hyperthermia susceptibility type 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (7): CHEMBL2095165 (PROTEIN FAMILY), CHEMBL3880 (SINGLE PROTEIN), CHEMBL4296080 (PROTEIN COMPLEX), CHEMBL6066046 (PROTEIN-PROTEIN INTERACTION), CHEMBL6193786 (PROTEIN-PROTEIN INTERACTION), CHEMBL6193787 (PROTEIN-PROTEIN INTERACTION), CHEMBL6193809 (PROTEIN-PROTEIN INTERACTION)

Molecules with ChEMBL bioactivity

48 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 840,929 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1440	TETRACYCLINE	4	324,384
CHEMBL1563	DAUNORUBICIN HYDROCHLORIDE	4	28,670
CHEMBL359744	DOXORUBICIN HYDROCHLORIDE	4	141,917
CHEMBL36506	NOVOBIOCIN	4	11,401
CHEMBL932	DIPYRIDAMOLE	4	51,743
CHEMBL106	FLUCONAZOLE	4	58,942
CHEMBL1086440	TRICLABENDAZOLE	4	4,136
CHEMBL1200348	SULCONAZOLE NITRATE	4	3,129
CHEMBL1200596	CHLOROXINE	4	1,792
CHEMBL1200725	SERTACONAZOLE NITRATE	4	1,396
CHEMBL1200883	THONZONIUM BROMIDE	4	1,098
CHEMBL1200901	HALOFANTRINE HYDROCHLORIDE	4	822
CHEMBL1201049	ECONAZOLE NITRATE	4	3,918
CHEMBL1356238	PYRITHIONE	4	15,582
CHEMBL1454910	NITROXOLINE	4	1,860
CHEMBL1547	THIAMINE ION	4	101,389
CHEMBL157101	KETOCONAZOLE	4	75,361
CHEMBL1714574	TERCONAZOLE	4	21
CHEMBL223448	BROXYQUINOLINE	4	855
CHEMBL277535	BIFONAZOLE	4	12,513
CHEMBL496	HEXACHLOROPHENE	4
CHEMBL497	CLIOQUINOL	4
CHEMBL849	TRICLOSAN	4
CHEMBL964	DISULFIRAM	4
CHEMBL109480	TANESPIMYCIN	3
CHEMBL1972860	ELESCLOMOL	3
CHEMBL2103879	GANETESPIB	3
CHEMBL377559	RETASPIMYCIN HYDROCHLORIDE	3
CHEMBL41286	DIACEREIN	3
CHEMBL508338	THIMEROSAL	3

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: other protein — Heat shock proteins

Most potent curated ligand interactions (5 total), top 5:

Ligand	Action	Affinity	Parameter
BIIB021	Inhibition	8.7	pIC50
SNX0723	Inhibition	8.52	pIC50
alvespimycin	Inhibition	8.35	pIC50
ganetespib	Inhibition	8.3	pIC50
retaspimycin hydrochloride	Inhibition	6.92	pEC50

Binding affinities (BindingDB)

873 measured of 1146 human assays (1168 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
2-[(2,5-dimethoxybenzylidene)amino]-4,5-bis(2-furyl)-3-furonitrile	EC50	0.00197 nM
BX-2819	IC50	0.04 nM
US8993556, 3-{2-[4-(Dimethylamino)phenoxy]-4,6-dihydroxyphenyl}-N-[1-(1,4-dioxaspiro[4.5]dec-8-yl)piperidin-4-yl]isoxazole-5-carboxamide	KD	0.043 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, N-[1-(4,4-Difluorocyclohexyl)piperidin-4-yl]-5-{2-[4-(dimethylamino)phenoxy]-4,6-dihydroxyphenyl}isoxazole-3-carboxamide	KD	0.057 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
CHEMBL2443026	KD	0.057 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, 3-{2-[4-(Dimethylamino)phenoxy]-4,6-dihydroxyphenyl}-N-(1-methylpiperidin-4-yl)isoxazole-5-carboxamide	KD	0.066 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, 5-{2-[4-(Dimethylamino)phenoxy]-4,6-dihydroxyphenyl}-N-[1-(1,5-dioxaspiro[5.5]undec-9-yl)piperidin-4-yl]isoxazole-3-carboxamide	KD	0.079 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, 5-{2-[4-(Dimethylamino)phenoxy]-4,6-dihydroxyphenyl}-N-[1-(3,3-dimethyl-1,5-dioxaspiro[5.5]undec-9-yl)piperidin-4-yl]isoxazole-3-carboxamide	KD	0.08 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, N-(1-Cyclohexylpiperidin-4-yl)-5-{2-[4-(dimethylamino)phenoxy]-4,6-dihydroxyphenyl}isoxazole-3-carboxamide	KD	0.09 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
Ethyl carbamate analog, 3	IC50	0.1 nM
lspropyl analog, 5	IC50	0.1 nM
CHEMBL2443138	KD	0.12 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, N-[1-(Cyclohexylmethyl)piperidin-4-yl]-5-{2-[4-(dimethylamino)phenoxy]-4,6-dihydroxyphenyl}isoxazole-3-carboxamide	KD	0.188 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
Ethyl analog, 4	IC50	0.2 nM
CHEMBL2443139	KD	0.218 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, 3-[2,4-Dihydroxy-6-(4-nitrophenoxy)phenyl]-N-(1-methylpiperidin-4-yl)isoxazole-5-carboxamide	KD	0.24 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, N-(1-Cyclohexylpiperidin-4-yl)-5-[2,4-dihydroxy-6-(4-nitrophenoxy)phenyl]isoxazole-3-carboxamide	KD	0.3 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
CHEMBL2443044	KD	0.35 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, 5-{2-[4-(Dimethylamino)phenoxy]-4,6-dihydroxyphenyl}-N-[1-(7,12-dioxaspiro[5.6]dodec-3-yl)piperidin-4-yl]isoxazole-3-carboxamide	KD	0.423 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
Unsubstituted phenyl ring analog, 2	IC50	0.5 nM
US8993556, 5-[2,4-Dihydroxy-6-(4-nitrophenoxy)phenyl]-N-ethylisoxazole-3-carboxamide	KD	0.8 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
US8993556, N-[1-(4,4-Difluorocyclohexyl)piperidin-4-yl]-5-[2,4-dihydroxy-6-(4-nitrophenoxy)phenyl]isoxazole-3-carboxamide	KD	0.8 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
N-[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]hydroxylamine	IC50	3 nM	US-8618290: HSP90 inhibitors
US8993556, 5-[2,4-Dihydroxy-6-(4-nitrophenoxy)phenyl]-N-[1-(propan-2-yl)piperidin-4-yl]isoxazole-3-carboxamide	KD	3.2 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
(2R)-2-amino-3-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxypropan-1-ol	IC50	4 nM	US-8618290: HSP90 inhibitors
3-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxypropan-1-ol	IC50	4 nM	US-8618290: HSP90 inhibitors
2-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxy-1-[(3R)-3-fluoropyrrolidin-1-yl]ethanone	IC50	4 nM	US-8618290: HSP90 inhibitors
2-[3-(2-methoxy-4-methyl-phenoxy)propoxy]benzoic acid methyl ester	IC50	4.05 nM
cis-(1R,2S)-4-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxycyclopentane-1,2-diol	IC50	5 nM	US-8618290: HSP90 inhibitors
(2S)-4-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxy-2-methylbutan-1-ol	IC50	6 nM	US-8618290: HSP90 inhibitors
4-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxybutan-1-ol	IC50	6 nM	US-8618290: HSP90 inhibitors
PA1	KD	6 nM
cis-(1S,2R)-4-[[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxymethyl]cyclopentane-1,2-diol	IC50	8 nM	US-8618290: HSP90 inhibitors
2-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxy-N,N-dimethylacetamide	IC50	8 nM	US-8618290: HSP90 inhibitors
(2S)-2-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxy-4-hydroxy-N,N-dimethylbutanamide	IC50	8 nM	US-8618290: HSP90 inhibitors
2-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxy-N-(2-hydroxyethyl)-N-methylacetamide	IC50	8 nM	US-8618290: HSP90 inhibitors
Dipyridamine	KI	8.18 nM
US8993556, 5-[2-(4-Chlorophenoxy)-4,6-dihydroxyphenyl]-N-ethylisoxazole-3-carboxamide	KD	9.2 nM	US-8993556: Resorcinol derivatives as HSP90 inhibitors
(7R)-5-N-[[(2R)-1,4-dioxan-2-yl]methoxy]-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidine-2,5-diamine	IC50	10 nM	US-8618290: HSP90 inhibitors
(3S,4R,5R)-2-[[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxymethyl]-5-methoxyoxolane-3,4-diol	IC50	10 nM	US-8618290: HSP90 inhibitors
4-[[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxymethyl]cyclohexan-1-ol	IC50	10 nM	US-8618290: HSP90 inhibitors
(2S)-5-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxypentane-1,2-diol	IC50	10 nM	US-8618290: HSP90 inhibitors
8-[(3-iodo-7-oxabicyclo[4.1.0]hepta-1(6),2,4-trien-2-yl)sulfanyl]-9-pent-4-ynyl-7,8-dihydropurine	EC50	10 nM	US-10167285: Small-molecule HSP90 inhibitors
2-[[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxymethyl]propane-1,3-diol	IC50	13 nM	US-8618290: HSP90 inhibitors
2-[[(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydropyrido[4,3-d]pyrimidin-5-yl]amino]oxy-N-[(2S)-2,3-dihydroxypropyl]-N-methylacetamide	IC50	13 nM	US-8618290: HSP90 inhibitors
3-[8-[(3-iodo-7-oxabicyclo[4.1.0]hepta-1(6),2,4-trien-2-yl)sulfanyl]-7,8-dihydropurin-9-yl]-N-propan-2-ylpropan-1-amine	EC50	16.1 nM	US-10167285: Small-molecule HSP90 inhibitors
CHEMBL4850751	KD	18 nM
geldanomycin	IC50	20 nM
2-fluoro-8-[(3-iodo-7-oxabicyclo[4.1.0]hepta-1(6),2,4-trien-2-yl)methyl]-9-pent-4-ynyl-7,8-dihydropurine	EC50	22.3 nM	US-10167285: Small-molecule HSP90 inhibitors
DC23	KD	25 nM

ChEMBL bioactivities

4170 potent at pChembl≥5 of 4688 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.37	Kd	0.043	nM	CHEMBL3696216
10.24	Kd	0.057	nM	CHEMBL2443026
10.24	Kd	0.057	nM	CHEMBL3696222
10.18	Kd	0.066	nM	CHEMBL3696217
10.10	Kd	0.08	nM	CHEMBL3696218
10.10	Kd	0.079	nM	CHEMBL3696220
10.05	Kd	0.09	nM	CHEMBL2443025
9.92	Kd	0.12	nM	CHEMBL2443138
9.89	IC50	0.13	nM	CHEMBL6168361
9.89	IC50	0.13	nM	ONALESPIB
9.80	IC50	0.16	nM	CHEMBL6165710
9.73	Kd	0.188	nM	CHEMBL3696221
9.70	Ki	0.2	nM	CHEMBL1230584
9.66	Kd	0.22	nM	CHEMBL2443139
9.66	Kd	0.218	nM	CHEMBL2443139
9.62	Kd	0.24	nM	CHEMBL3696223
9.60	Kd	0.25	nM	CHEMBL1939381
9.52	Kd	0.3	nM	CHEMBL2443131
9.52	IC50	0.3	nM	CHEMBL6172500
9.51	IC50	0.31	nM	CHEMBL6176585
9.49	IC50	0.32	nM	CHEMBL6167852
9.49	IC50	0.32	nM	CHEMBL6175808
9.48	Kd	0.33	nM	CHEMBL3104281
9.46	Kd	0.346	nM	CHEMBL2443044
9.46	Kd	0.35	nM	CHEMBL2443044
9.42	Kd	0.38	nM	CHEMBL1939380
9.38	Kd	0.418	nM	CHEMBL3892221
9.37	Kd	0.43	nM	CHEMBL3104273
9.37	Kd	0.423	nM	CHEMBL3696219
9.35	IC50	0.45	nM	CHEMBL6164902
9.34	Kd	0.46	nM	CHEMBL3104277
9.34	IC50	0.46	nM	CHEMBL6167303
9.34	IC50	0.46	nM	CHEMBL6175551
9.32	Kd	0.48	nM	CHEMBL3104289
9.32	Kd	0.48	nM	CHEMBL5574581
9.30	IC50	0.5	nM	CHEMBL6170870
9.28	IC50	0.53	nM	CHEMBL6170534
9.28	IC50	0.53	nM	CHEMBL6170473
9.28	IC50	0.53	nM	CHEMBL6177673
9.28	Kd	0.52	nM	CHEMBL1939379
9.27	Kd	0.54	nM	CHEMBL3104276
9.27	Kd	0.54	nM	CHEMBL1215539
9.27	IC50	0.54	nM	CHEMBL6092104
9.27	Kd	0.54	nM	CHEMBL1215467
9.22	Kd	0.6	nM	CHEMBL3104280
9.21	Kd	0.61	nM	CHEMBL1939382
9.20	IC50	0.63	nM	CHEMBL6174734
9.19	IC50	0.64	nM	CHEMBL6176915
9.19	IC50	0.64	nM	CHEMBL6171794
9.19	Kd	0.65	nM	CHEMBL1939383

PubChem BioAssay actives

2196 with measured affinity, of 5795 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
1,3-dihydroisoindol-2-yl-(2,4-dihydroxy-5-propan-2-ylphenyl)methanone	1324615: Inhibition of HSP90 (unknown origin)	kd	<0.0001	uM
ethyl N-[[4-[3-(2,4-dihydroxy-5-propan-2-ylphenyl)-5-sulfanylidene-1H-1,2,4-triazol-4-yl]phenyl]methyl]carbamate	1799585: Competition Assay from Article 10.1111/j.1747-0285.2009.00833.x: “Potent triazolothione inhibitor of heat-shock protein-90.”	ic50	<0.0001	uM
5-[2-[4-(dimethylamino)phenoxy]-4,6-dihydroxyphenyl]-N-(1-methylpiperidin-4-yl)-1,2-oxazole-3-carboxamide	780857: Displacement of FITC-Geldanamycin from Hsp90 (unknown origin) after 18 hrs by fluorescence polarization assay	kd	0.0001	uM
ethyl N-[[4-[3-(2,4-dihydroxyphenyl)-5-sulfanylidene-1H-1,2,4-triazol-4-yl]phenyl]methyl]carbamate	1799585: Competition Assay from Article 10.1111/j.1747-0285.2009.00833.x: “Potent triazolothione inhibitor of heat-shock protein-90.”	ic50	0.0001	uM
3-(2,4-dihydroxy-5-propan-2-ylphenyl)-4-naphthalen-1-yl-1H-1,2,4-triazole-5-thione	1799585: Competition Assay from Article 10.1111/j.1747-0285.2009.00833.x: “Potent triazolothione inhibitor of heat-shock protein-90.”	ic50	0.0001	uM
5-[2-[4-(dimethylamino)phenoxy]-4,6-dihydroxyphenyl]-N-[1-(1,4-dioxaspiro[4.5]decan-8-yl)piperidin-4-yl]-1,2-oxazole-3-carboxamide	780857: Displacement of FITC-Geldanamycin from Hsp90 (unknown origin) after 18 hrs by fluorescence polarization assay	kd	0.0001	uM
5-[2-amino-4-chloro-7-[(4-methoxy-3,5-dimethyl-2-pyridinyl)methyl]pyrrolo[2,3-d]pyrimidin-5-yl]-2-methylpent-4-yn-2-ol	716075: Binding affinity at recombinant Hsp90alpha incubated for 16 hrs by fluorescence polarization competition assay	ki	0.0002	uM
3-(5-ethyl-2,4-dihydroxyphenyl)-4-naphthalen-1-yl-1H-1,2,4-triazole-5-thione	1799585: Competition Assay from Article 10.1111/j.1747-0285.2009.00833.x: “Potent triazolothione inhibitor of heat-shock protein-90.”	ic50	0.0002	uM
5-[2,4-dihydroxy-6-[4-(propan-2-ylamino)phenoxy]phenyl]-N-(1-methylpiperidin-4-yl)-1,2-oxazole-3-carboxamide	780857: Displacement of FITC-Geldanamycin from Hsp90 (unknown origin) after 18 hrs by fluorescence polarization assay	kd	0.0002	uM
5-[2,4-dihydroxy-6-(4-nitrophenoxy)phenyl]-N-(1-methylpiperidin-4-yl)-1,2-oxazole-3-carboxamide	780857: Displacement of FITC-Geldanamycin from Hsp90 (unknown origin) after 18 hrs by fluorescence polarization assay	kd	0.0003	uM
3-(2,4-dihydroxyphenyl)-4-naphthalen-1-yl-1H-1,2,4-triazole-5-thione	1799585: Competition Assay from Article 10.1111/j.1747-0285.2009.00833.x: “Potent triazolothione inhibitor of heat-shock protein-90.”	ic50	0.0003	uM
4-amino-20,22-dimethyl-7-thia-3,5,11,17-tetrazatricyclo[17.3.1.12,6]tetracosa-1(23),2(24),3,5,19,21-hexaene-10,18-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0003	uM
(2S)-3-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]-2-methylpropanamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0003	uM
5-(2,4-dihydroxy-5-propan-2-ylphenyl)-N-ethyl-4-[4-(morpholin-4-ylmethyl)phenyl]-1,2-oxazole-3-carboxamide	716071: Inhibition of Hsp90alpha	ic50	0.0004	uM
4-amino-19,21-dimethyl-7-thia-3,5,11,16-tetrazatricyclo[16.3.1.12,6]tricosa-1(22),2(23),3,5,18,20-hexaene-10,17-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0004	uM
N-[2-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]ethyl]methanesulfonamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0004	uM
1,3-dihydroisoindol-2-yl-(5-ethyl-2,4-dihydroxyphenyl)methanone	1866070: Inhibition of HSP90 (unknown origin)	kd	0.0005	uM
4-[5-(4-methoxyphenyl)thiadiazol-4-yl]-6-propan-2-ylbenzene-1,3-diol	2108967: Binding affinity to human N-terminal his tagged Hsp90alpha (1 to 241 residues) expressed in Escherichia coli (DE3) strain assessed as dissociation constant by Fluorescent thermal shift assay	kd	0.0005	uM
4-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]butanamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0005	uM
4-amino-18,20-dimethyl-7-thia-3,5,11,15-tetrazatricyclo[15.3.1.12,6]docosa-1(21),2(22),3,5,17,19-hexaene-10,16-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0005	uM
2-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]ethanol	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0005	uM
2-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]ethyl carbamate	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0005	uM
3-(2,4-dihydroxyphenyl)-4-phenyl-1H-1,2,4-triazole-5-thione	1799585: Competition Assay from Article 10.1111/j.1747-0285.2009.00833.x: “Potent triazolothione inhibitor of heat-shock protein-90.”	ic50	0.0005	uM
4-amino-18,20-dimethyl-7-thia-3,5,12,15-tetrazatricyclo[15.3.1.12,6]docosa-1(21),2(22),3,5,17,19-hexaene-11,16-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0006	uM
4-amino-18,20-dimethyl-7-thia-3,5,10,15-tetrazatricyclo[15.3.1.12,6]docosa-1(21),2(22),3,5,17,19-hexaene-11,16-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0006	uM
3-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]-2-methylpropanamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0006	uM
3-[2-amino-4-chloro-7-[(4-methoxy-3,5-dimethyl-2-pyridinyl)methyl]pyrrolo[2,3-d]pyrimidin-5-yl]prop-2-yn-1-ol	716071: Inhibition of Hsp90alpha	ic50	0.0007	uM
(5-ethyl-2,4-dihydroxyphenyl)-[5-[(4-methylpiperazin-1-yl)methyl]-1,3-dihydroisoindol-2-yl]methanone	1866070: Inhibition of HSP90 (unknown origin)	kd	0.0007	uM
(1S,5S)-2-[[1-(3-bromophenyl)triazol-4-yl]methyl]-1,8,8-trimethyl-2-azabicyclo[3.2.1]octan-3-one	1755711: Inhibition of recombinant human N terminal his-tagged HSP90 alpha (1 to 732 residues) expressed in Escherichia coli measured after 60 mins by Flourescence polarization assay	ic50	0.0007	uM
4-[6,6-dimethyl-4-oxo-3-(trifluoromethyl)-5,7-dihydroindazol-1-yl]-2-[(4-hydroxycyclohexyl)amino]benzamide	780857: Displacement of FITC-Geldanamycin from Hsp90 (unknown origin) after 18 hrs by fluorescence polarization assay	kd	0.0007	uM
4-amino-18,20-dimethyl-12-oxa-7-thia-3,5,10,15-tetrazatricyclo[15.3.1.12,6]docosa-1(21),2(22),3,5,17,19-hexaene-11,16-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0007	uM
3-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]-N-methylpropanamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0007	uM
3-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]propanamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0007	uM
24-[2-[4-[[(4E,6Z,8S,9S,10E,12S,13R,14S,16R)-9-carbamoyloxy-13-hydroxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-19-yl]amino]butylamino]-2-oxoethyl]-5,5,27,27-tetramethyl-16-oxa-20-aza-12-azoniaheptacyclo[15.11.0.03,15.04,12.06,11.020,28.021,26]octacosa-1(28),2,4(12),6(11),7,9,21(26),22,24-nonaene-8-sulfonate	767758: Binding affinity to HSP90alpha (unknown origin) by fluorescence polarization assay	kd	0.0007	uM
[(4E,8S,9S,10E,12S,13R,14S,16R)-13,19-dihydroxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3-oxo-2-azabicyclo[16.3.1]docosa-1(22),4,10,18,20-pentaen-9-yl] carbamate	394599: Binding affinity to human recombinant Hsp90alpha N-terminal domain by isothermal titration calorimetry	kd	0.0008	uM
4-amino-18,20-dimethyl-10-oxa-7-thia-3,5,12,15-tetrazatricyclo[15.3.1.12,6]docosa-1(21),2(22),3,5,17,19-hexaene-11,16-dione	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0008	uM
N-[2-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]ethyl]acetamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0008	uM
4-[5-(4-methylphenyl)thiadiazol-4-yl]-6-propan-2-ylbenzene-1,3-diol	2108967: Binding affinity to human N-terminal his tagged Hsp90alpha (1 to 241 residues) expressed in Escherichia coli (DE3) strain assessed as dissociation constant by Fluorescent thermal shift assay	kd	0.0010	uM
2-[[4-(2-chloro-4,5-dimethoxyphenyl)-5-cyano-7H-pyrrolo[2,3-d]pyrimidin-2-yl]sulfanyl]-N,N-dimethylacetamide	2034416: Inhibition of N-terminal human Hsp90-alpha ATP binding domain (2 to 236 residues) overexpressed in HEK293T cell lysate by fluorescence polarization assay	ki	0.0010	uM
(7R)-2-amino-7-[4-fluoro-2-(6-methoxy-2-pyridinyl)phenyl]-4-methyl-7,8-dihydro-6H-pyrido[4,3-d]pyrimidin-5-one	1170429: Inhibition of full-length HSP90 (unknown origin)	ic50	0.0010	uM
4-chloro-5-ethynyl-7-[(4-methoxy-3,5-dimethyl-2-pyridinyl)methyl]pyrrolo[2,3-d]pyrimidin-2-amine	716071: Inhibition of Hsp90alpha	ic50	0.0010	uM
(4R,6R,8R,9Z,11E)-16-chloro-17,19-dihydroxy-4-methyl-3,7-dioxatricyclo[13.4.0.06,8]nonadeca-1(15),9,11,16,18-pentaene-2,13-dione	1625193: Binding affinity to recombinant human HSP90 alpha by Surface plasmon resonance analysis	kd	0.0012	uM
4-amino-20,22-dimethyl-13-oxa-7-thia-3,5,17-triazatetracyclo[17.3.1.12,6.18,12]pentacosa-1(23),2(25),3,5,8,10,12(24),19,21-nonaen-18-one	641013: Binding affinity to N-terminus biotinylated human Hsp90 alpha by surface plasmon resonance assay	kd	0.0013	uM
2-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]acetamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0013	uM
3-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]-N-(2-hydroxyethyl)propanamide	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0013	uM
2-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanyl]ethylurea	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0014	uM
5-[3-[6-amino-8-[(6-iodo-1,3-benzodioxol-5-yl)sulfanyl]purin-9-yl]propylcarbamothioylamino]-2-(3-hydroxy-6-oxoxanthen-9-yl)benzoic acid	767758: Binding affinity to HSP90alpha (unknown origin) by fluorescence polarization assay	kd	0.0014	uM
4-N-(diaminomethylidene)-1-N-[5-(2,4-dihydroxy-5-propan-2-ylphenyl)-3-(ethylcarbamoyl)-1,2-oxazol-4-yl]benzene-1,4-dicarboxamide	1497394: Inhibition of FITC-geldanamycin binding to recombinant human HSP90alpha expressed in Escherichia coli by fluorescence anisotropy method	kd	0.0015	uM
4-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-6-[2-(dimethylamino)ethylsulfanyl]-1,3,5-triazin-2-amine	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0015	uM
(5R)-5-[[4-amino-6-(7-chloro-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-8-yl)-1,3,5-triazin-2-yl]sulfanylmethyl]-1,3-oxazolidin-2-one	1063940: Binding affinity to human biotinylated N-terminal Hsp90alpha (9 to 236) by surface plasmon resonance assay	kd	0.0016	uM

CTD chemical–gene interactions

189 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases expression, increases reaction, increases phosphorylation, affects cotreatment, affects binding (+2 more)	15
Arsenic Trioxide	increases expression, affects response to substance, increases reaction	8
Benzo(a)pyrene	increases response to substance, decreases reaction, increases expression, affects cotreatment, affects expression (+2 more)	6
bisphenol A	affects expression, affects cotreatment, decreases expression, decreases reaction, increases expression (+1 more)	4
tanespimycin	affects binding, decreases reaction, affects cotreatment, decreases expression, increases expression	4
Copper	affects binding, decreases expression, increases expression	4
Tobacco Smoke Pollution	affects expression, increases expression, increases methylation	4
Cadmium Chloride	affects expression, decreases expression, increases expression	4
geldanamycin	affects binding, decreases reaction, increases reaction	3
sulforaphane	increases acetylation, affects binding, decreases reaction, increases expression, increases reaction	3
Air Pollutants	decreases expression, affects cotreatment, increases abundance, increases expression, affects methylation	3
Cadmium	decreases reaction, increases expression, decreases expression	3
Cannabidiol	affects cotreatment, increases expression	3
Cisplatin	decreases expression, decreases response to substance, increases expression	3
Doxorubicin	affects expression, increases expression	3
Quercetin	decreases reaction, increases reaction, decreases expression, affects binding	3
Silicon Dioxide	affects secretion, decreases expression, increases expression	3
Silver	increases expression	3
Particulate Matter	decreases expression, increases abundance, affects expression, increases reaction	3
cupric chloride	increases expression	2
2-chloroethyl ethyl sulfide	increases expression, decreases reaction, decreases activity	2
Bortezomib	decreases expression, increases expression	2
Arsenic	increases abundance, increases expression, affects methylation, affects cotreatment	2
Vehicle Emissions	affects expression, increases reaction, increases abundance, increases expression	2
Dexamethasone	increases expression, affects cotreatment, decreases expression	2
Estradiol	decreases expression, increases expression, decreases reaction	2
Ivermectin	affects cotreatment, increases expression, decreases expression	2
Oxygen	decreases expression	2
Plant Extracts	affects expression, increases expression	2
Selenium	decreases reaction, increases expression, increases reaction, affects cotreatment, decreases expression	2

ChEMBL screening assays

1350 unique, capped per target: 1271 binding, 55 admet, 22 functional, 2 toxicity

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1004497	Binding	Binding affinity to human recombinant Hsp90 expressed in Escherichia coli assessed as thermal shift by differential scanning fluorimetry	Discovery of a potent and selective inhibitor for human carbonyl reductase 1 from propionate scanning applied to the macrolide zearalenone. — Bioorg Med Chem
CHEMBL1613874	Functional	PUBCHEM_BIOASSAY: Tumor Hsp90 Inhibitors Dose Response Confirmation. (Class of assay: confirmatory) [Related pubchem assays: 429 (Primary screen preceding this dose response confirmation assay.)]	PubChem BioAssay data set
CHEMBL4019105	ADMET	Inhibition of HSP90 in human HeLa cells assessed as induction of HSP70 protein expression at 20 uM after 6 hrs by Western blot method	Paralog Specificity Determines Subcellular Distribution, Action Mechanism, and Anticancer Activity of TRAP1 Inhibitors. — J Med Chem

Cellosaurus cell lines

8 cell lines: 6 cancer cell line, 2 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2Z5	Abcam HEK293T HSP90AA1 KO	Transformed cell line	Female
CVCL_D7RI	Ubigene A-549 HSP90AA1 KO	Cancer cell line	Male
CVCL_D9GD	Ubigene HEK293 HSP90AA1 KO	Transformed cell line	Female
CVCL_E1MT	HyCyte SK-HEP-1 KO-hHSP90AA1	Cancer cell line	Male
CVCL_E9EA	MDA-MB-231 HSP90AA1 KO#1	Cancer cell line	Female
CVCL_E9EB	MDA-MB-231 HSP90AA1 KO#2	Cancer cell line	Female
CVCL_SR74	HAP1 HSP90AA1 (-) 1	Cancer cell line	Male
CVCL_XP63	HAP1 HSP90AA1 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.