HSPA5

Summary

HSPA5 (heat shock protein family A (Hsp70) member 5, HGNC:5238) is a protein-coding gene on chromosome 9q33.3, encoding Endoplasmic reticulum chaperone BiP (P11021). Endoplasmic reticulum chaperone that plays a key role in protein folding and quality control in the endoplasmic reticulum lumen. In precision oncology, HSPA5 EXPRESSION confers sensitivity to Fluorouracil in Colorectal Cancer (CIViC Level B). It is a common-essential gene (DepMap: required in 98.2% of cancer cell lines).

The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. This protein localizes to the lumen of the endoplasmic reticulum (ER) where it operates as a typical HSP70 chaperone involved in the folding and assembly of proteins in the ER and is a master regulator of ER homeostasis. During cellular stress, as during viral infection or tumorogenesis, this protein interacts with the transmembrane stress sensor proteins PERK (protein kinase R-like endoplasmic reticulum kinase), IRE1 (inositol-requiring kinase 1), and ATF6 (activating transcription factor 6) where it acts as a repressor of the unfolded protein response (UPR) and also plays a role in cellular apoptosis and senescence. Elevated expression and atypical translocation of this protein to the cell surface has been reported in viral infections and some types of cancer cells. At the cell surface this protein may facilitate viral attachment and entry to host cells. This gene is a therapeutic target for the treatment of coronavirus diseases and chemoresistant cancers.

Source: NCBI Gene 3309 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 56 total
• Druggable target: yes — 5 molecules with ChEMBL bioactivity
• Precision-oncology evidence (CIViC): 1 curated variant–drug association
• Cancer dependency (DepMap): dependent in 98.2% of screened cell lines (common-essential)
• MANE Select transcript: NM_005347

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:5238
Approved symbol	HSPA5
Name	heat shock protein family A (Hsp70) member 5
Location	9q33.3
Locus type	gene with protein product
Status	Approved
Aliases	BiP
Ensembl gene	ENSG00000044574
Ensembl biotype	protein_coding
OMIM	138120
Entrez	3309

Gene structure

Transcript identifiers

Ensembl transcripts: 22 — 12 retained_intron, 10 protein_coding

ENST00000324460, ENST00000679355, ENST00000679475, ENST00000680032, ENST00000680234, ENST00000680257, ENST00000680272, ENST00000680494, ENST00000680640, ENST00000681045, ENST00000681424, ENST00000681540, ENST00000681544, ENST00000681675, ENST00000681774, ENST00000852484, ENST00000852485, ENST00000852486, ENST00000930639, ENST00000930640, ENST00000930641, ENST00000930642

RefSeq mRNA: 1 — MANE Select: NM_005347 NM_005347

CCDS: CCDS6863

Canonical transcript exons

ENST00000324460 — 8 exons

Exon	Start	End
ENSE00000727542	125238590	125238827
ENSE00000727547	125238141	125238308
ENSE00000983644	125240676	125240907
ENSE00000983645	125240172	125240309
ENSE00000983646	125239421	125239533
ENSE00000983647	125238941	125239331
ENSE00001246525	125234853	125237154
ENSE00001460790	125241005	125241343

Expression profiles

Bgee: expression breadth ubiquitous, 295 present calls, max score 99.91.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 450.3226 / max 5078.7439, expressed in 1828 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
102481	445.4873	1828
102474	1.2264	730
102478	1.1553	727
102480	0.9936	622
102479	0.9663	631
102475	0.2914	107
102476	0.2023	47

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
vena cava	UBERON:0004087	99.91	gold quality
type B pancreatic cell	CL:0000169	99.86	gold quality
olfactory bulb	UBERON:0002264	99.81	gold quality
pericardium	UBERON:0002407	99.76	gold quality
corpus epididymis	UBERON:0004359	99.72	gold quality
mucosa of sigmoid colon	UBERON:0004993	99.57	gold quality
pylorus	UBERON:0001166	99.55	gold quality
islet of Langerhans	UBERON:0000006	99.43	gold quality
trachea	UBERON:0003126	99.43	gold quality
lower lobe of lung	UBERON:0008949	99.43	gold quality
parotid gland	UBERON:0001831	99.42	gold quality
caput epididymis	UBERON:0004358	99.42	gold quality
cardia of stomach	UBERON:0001162	99.36	gold quality
penis	UBERON:0000989	99.35	gold quality
colonic mucosa	UBERON:0000317	99.33	gold quality
mucosa of paranasal sinus	UBERON:0005030	99.32	gold quality
decidua	UBERON:0002450	99.31	gold quality
seminal vesicle	UBERON:0000998	99.30	gold quality
stromal cell of endometrium	CL:0002255	99.26	gold quality
superficial temporal artery	UBERON:0001614	99.26	gold quality
trigeminal ganglion	UBERON:0001675	99.25	gold quality
heart right ventricle	UBERON:0002080	99.25	gold quality
pharyngeal mucosa	UBERON:0000355	99.21	gold quality
cartilage tissue	UBERON:0002418	99.18	gold quality
adult organism	UBERON:0007023	99.18	gold quality
oral cavity	UBERON:0000167	99.16	gold quality
cauda epididymis	UBERON:0004360	99.16	gold quality
saphenous vein	UBERON:0007318	99.16	gold quality
bronchial epithelial cell	CL:0002328	99.14	gold quality
renal medulla	UBERON:0000362	99.08	gold quality

Single-cell (SCXA)

Detected in 20 experiment(s), a significant marker in 14.

Experiment	Marker?	Max mean expression
E-MTAB-9388	yes	11267.77
E-HCAD-13	yes	6622.25
E-CURD-7	yes	5637.10
E-GEOD-150728	yes	5019.99
E-MTAB-8559	yes	1804.61
E-MTAB-9467	yes	50.04
E-CURD-122	yes	44.51
E-HCAD-4	yes	38.13
E-HCAD-1	yes	34.92
E-HCAD-31	yes	22.33
E-MTAB-9067	yes	15.04
E-CURD-46	yes	13.37
E-CURD-112	yes	4.16
E-MTAB-8060	no	6369.58
E-ENAD-21	no	5871.52

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AR, ATF1, ATF2, ATF3, ATF4, ATF6, ATF6B, BRCA1, CEBPB, CREB1, CREB3L1, CREB3L4, CTCF, DDIT3, E2F1, EIF2AK3, ELF1, ERP29, ESR1, FOS, FOXO1, GATA4, GTF2I, HDAC1, HDAC9, HNF1A, HNF4A, JUN, KAT7, LITAF, MBTPS2, MYB, NFIA, NFIC, NFKB1, NFKB2, NFYA, NR4A1, PARP1, PRDM1

miRNA regulators (miRDB)

79 targeting HSPA5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4713-3P	100.00	65.92	505
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-338-5P	99.92	72.34	2951
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-627-3P	99.90	71.42	3316
HSA-MIR-7162-3P	99.89	68.16	1682
HSA-MIR-548E-5P	99.89	72.73	4486
HSA-MIR-4496	99.88	68.89	2236
HSA-MIR-30D-3P	99.87	69.92	2917
HSA-MIR-30A-3P	99.87	69.74	2928
HSA-MIR-30E-3P	99.87	69.68	2942
HSA-MIR-383-3P	99.85	65.84	1359
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-4320	99.75	65.80	793
HSA-MIR-4719	99.73	72.10	3329
HSA-MIR-4699-3P	99.71	70.15	3142
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-548AU-3P	99.70	68.22	1373
HSA-MIR-4729	99.69	72.18	4233

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 98.2% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 40)

• Glucose-regulated protein 78 is induced by chronic hypoxia in human gastric tumor cells through a protein kinase C-epsilon/ERK/AP-1 signaling cascade. (PMID:11719466)
• a coreceptor for coxsackievirus A9, interacts with major histocompatibility complex class I molecules which mediate virus internalization (PMID:11752154)
• p38MAPK is activated by phosphorylated ATF6 and induces HSPA5 binding (PMID:12076252)
• stimulated by HCV replicons (PMID:12097557)
• a molecular chaperone, possibly involved in reduced formation of amyloid-beta protein in the endoplasmic reticulum (PMID:12480769)
• small amounts of circulating, free GRP78 and naturally-occurring anti-GRP78 autoantibodies were detected in the peripheral circulation of healthy human individuals. (PMID:12516782)
• interacts with the large surface protein of hepatitis B virus in vitro (PMID:12552023)
• overexpression of GRP78/BiP decreases thrombin generation thereby suppressing prothrombotic potential of cells (PMID:12621026)
• overexpression of GRP78 results in reduced apoptosis and higher colony survival when challenged with topoisomerase inhibitors (PMID:12665508)
• The endoplasmic reticulum stress pathway mediated by ATF6 and by IRE1-XBP1 systems seems essential for the transformation-associated expression of the grp78 gene in hepatocarcinogenesis (PMID:12713871)
• mononuclear leukocytes responded to BiP with secretion of an antiinflammatory profile of cytokines. (PMID:15077298)
• GRP78 can serve as a novel independent favorable prognostic factor for patients with neuroblastoma. (PMID:15514946)
• ERdj3 is a stress-inducible endoplasmic reticulum DnaJ homologue which serves as a cofactor for BiP’s interactions with unfolded substrates (PMID:15525676)
• Interaction with core lipoprotein lipids may facilitate apoB transport out of the ER by reducing Grp78-mediated ER retention. (PMID:15618547)
• Stable BiP binding is essential for ATF6 regulation and that ER stress dissociates BiP from ATF6 by actively restarting the BiP ATPase cycle. (PMID:15657421)
• TFII-I is required for optimal induction of Grp78 by ER stress (PMID:15664986)
• data suggest that amplification of c-myb in tumor cells may lead to robust GRP78 gene induction, which may in turn assist cells in survival under conditions of oxygen deprivation and nutrient stress (PMID:15778089)
• GRP78/BiP plays a protective role against UVC-induced cell death possibly via nucleotide excision repair. (PMID:15817150)
• Upon ER stress, Grp78 promoter is occupied by YY1 mediated in part by the nuclear form of ATF6. (PMID:15899857)
• Endoplasmic reticulum stress pathway mediated by Grp78 may be responsible for controlling the growth of lung cancer cells (PMID:15949590)
• Promotor polymorphisms of HSPA5 may affect the interindividual variability of ER stress response and may confer a genetic risk factor for bipolar disorder. (PMID:16168956)
• Findings indicate that overexpression of GRP78 protein may be an important biomarker for malignant transformation, and increased expression might be related with the posttranscriptional regulation of GRP78 in tumor tissues. (PMID:16182273)
• Disturbed SIL1-HSPA5 interaction and protein folding is the primary pathology in Marinesco-Sjogren syndrome. (PMID:16282978)
• Taken together, GRP78/75 and RHAMM complexes may stabilize microtubules in the interphase, associated with a downregulation of RHAMM. These results reveal a new biochemical activity of RHAMM. (PMID:16329989)
• Up-regulation of GRP78 protein is associated with hepatocellular carcinoma (PMID:16400691)
• analyzed the cooperation of ER-60 and BiP in the oxidative refolding of denatured proteins (PMID:16428306)
• REVIEW: transcriptional regulation of Grp78, the molecular basis for the cytoprotective function of GRP78 and its role in cancer progression, drug resistance and potential future cancer therapy (PMID:16472112)
• N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) can induce the clustering of epidermal growth factor receptor (EGFR) with GRP78 in human amnion FL cells. (PMID:16488447)
• These results suggest that CYP2E1 mediated oxidative stress downregulates the expression of GRP proteins in HepG2 cells and oxidative stress is an important mechanism in causing ER dysfunction in these cells. (PMID:16497268)
• The activation and regulation of Akt and NF-kappa B in prostatic cancer cell line 1-LN are reported. (PMID:16543232)
• US2 and US11 bridge the MHC class I heavy chain onto BiP promoting interactions with other ER-associated degradation proteins (PMID:16731524)
• A predictor of responsiveness to drug therapy breast camcer. (PMID:16912156)
• BiP/GRP78 is a defined intracellular target of action and presents an unparalleled opportunity to develop improved therapeutic versions of this cancer-specific apoptosis-inducing cytokine. (PMID:16912197)
• Single molecule dynamics of transcriptional activation in the stress inducible GRP78 promoter, is studied. (PMID:17002502)
• Up-regulation of Grp78 is associated with the development of castration resistance, may serve as an important prognostic indicator of recurrence in a subset of prostate cancer patients (PMID:17062670)
• Retention of amyloidogenic mutant TTRs induced the unfolded protein response and upregulated the expression of BIP. (PMID:17431395)
• GRP78 protein expression is significantly higher in prostate cancer than in benign prostatic tissue. The intensity of expression is significantly associated with survival and clinical recurrence (PMID:17640713)
• Grp78 was present in the uterus and oviduct epithelial cells and was shown to bind to human spermatozoa. Incubation with either exogenous Hsp60 or Grp78 did not affect sperm viability, motility or acrosomal integrity. (PMID:17670764)
• Endoplasmic reticulum chaperones stabilize nicotinic receptor subunits and regulate receptor assembly. (PMID:17728248)
• ERGIC-53 provides a platform that receives micro(2)L(2) subunits from the BiP-dependent checkpoint, assisting polymerization. In this process, ERp44 couples thiol-dependent assembly and quality control. (PMID:17805346)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	hspa5	ENSDARG00000103846
mus_musculus	Hspa5	ENSMUSG00000026864
rattus_norvegicus	Hspa5	ENSRNOG00000018294
drosophila_melanogaster	Hsc70-3	FBGN0001218
caenorhabditis_elegans		WBGENE00002007
caenorhabditis_elegans		WBGENE00002008

Paralogs (13): HSPA8 (ENSG00000109971), HSPA9 (ENSG00000113013), HSPH1 (ENSG00000120694), HSPA2 (ENSG00000126803), HYOU1 (ENSG00000149428), HSPA13 (ENSG00000155304), HSPA4L (ENSG00000164070), HSPA4 (ENSG00000170606), HSPA6 (ENSG00000173110), HSPA14 (ENSG00000187522), HSPA1B (ENSG00000204388), HSPA1A (ENSG00000204389), HSPA1L (ENSG00000204390)

Protein

Protein identifiers

Endoplasmic reticulum chaperone BiP — P11021 (reviewed: P11021)

Alternative names: 78 kDa glucose-regulated protein, Binding-immunoglobulin protein, Heat shock protein 70 family protein 5, Heat shock protein family A member 5, Immunoglobulin heavy chain-binding protein

All UniProt accessions (4): A0A7P0TAI0, A0A7P0TB36, P11021, V9HWB4

UniProt curated annotations — full annotation on UniProt →

Function. Endoplasmic reticulum chaperone that plays a key role in protein folding and quality control in the endoplasmic reticulum lumen. Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10/ERdj5, probably to facilitate the release of DNAJC10/ERdj5 from its substrate. Acts as a key repressor of the EIF2AK3/PERK and ERN1/IRE1-mediated unfolded protein response (UPR). In the unstressed endoplasmic reticulum, recruited by DNAJB9/ERdj4 to the luminal region of ERN1/IRE1, leading to disrupt the dimerization of ERN1/IRE1, thereby inactivating ERN1/IRE1. Also binds and inactivates EIF2AK3/PERK in unstressed cells. Accumulation of misfolded protein in the endoplasmic reticulum causes release of HSPA5/BiP from ERN1/IRE1 and EIF2AK3/PERK, allowing their homodimerization and subsequent activation. Plays an auxiliary role in post-translational transport of small presecretory proteins across endoplasmic reticulum (ER). May function as an allosteric modulator for SEC61 channel-forming translocon complex, likely cooperating with SEC62 to enable the productive insertion of these precursors into SEC61 channel. Appears to specifically regulate translocation of precursors having inhibitory residues in their mature region that weaken channel gating. May also play a role in apoptosis and cell proliferation. (Microbial infection) Plays an important role in viral binding to the host cell membrane and entry for several flaviruses such as Dengue virus, Zika virus and Japanese encephalitis virus. Acts as a component of the cellular receptor for Dengue virus serotype 2/DENV-2 on human liver cells. (Microbial infection) Acts as a receptor for CotH proteins expressed by fungi of the order mucorales, the causative agent of mucormycosis, which plays an important role in epithelial cell invasion by the fungi. Acts as a receptor for R.delemar CotH3 in nasal epithelial cells, which may be an early step in rhinoorbital/cerebral mucormycosis (RCM) disease progression.

Subunit / interactions. Monomer and homooligomer; homooligomerization via the interdomain linker inactivates the chaperone activity and acts as a storage of HSPA5/BiP molecules. Interacts with DNAJC1 (via J domain). Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5. Part of a large chaperone multiprotein complex comprising DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PDIA6, PPIB, SDF2L1, UGGT1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX. Interacts with TMEM132A and TRIM21. May form a complex with ERLEC1, OS9, SEL1L and SYVN1. Interacts with DNAJC10. Interacts with DNAJB9/ERdj4; leading to recruit HSPA5/BiP to ERN1/IRE1. Interacts with ERN1/IRE1 (via luminal domain); the interaction takes place following interaction with DNAJB9/ERdj4 and leads to inactivate ERN1/IRE1, the interaction also competitively inhibits ERN1 interaction with MANF. Interacts directly with MANF (via SAP domain); the interaction inhibits ATP binding to HSPA5/BiP and subsequent nucleotide exchange. Interacts with EIF2AK3/PERK (via luminal domain); interaction leads to inactivate EIF2AK3/PERK. Interacts with MX1. Interacts with METTL23. Interacts with CEMIP; the interaction induces calcium leakage from the endoplasmic reticulum and cell migration. Interacts with PCSK4 form; the interaction takes place in the endoplasmic reticulum. Interacts with CIPC. Interacts with CCDC88B (via C-terminus); the interaction opposes ERN1-mediated JNK activation, protecting against apoptosis. Interacts with INPP5K; necessary for INPP5K localization at the endoplasmic reticulum. Interacts with MANF; the interaction is direct. Interacts with LOXL2; leading to activate the ERN1/IRE1-XBP1 pathway of the unfolded protein response. Interacts with CLU under stressed condition; interaction increases CLU protein stability; facilitates its retrotranslocation and redistribution to the mitochondria; cooperatively suppress stress-induced apoptosis by stabilizing mitochondrial membrane integrity. Interacts with CCDC47. Interacts with CLN3. Interacts with ELAPOR1; may regulate the function of HSPA5 in apoptosis and cell proliferation. Interacts with CASP7. Interacts with ILDR2; the interaction stabilizes ILDR2 expression. Interacts with ADAM7. (Microbial infection) Interacts with Japanese encephalitis virus envelope protein E. (Microbial infection) Interacts with R.delemar invasin CotH3 on the surface of nasal epithelial cells. Interacts with R.delemar invasin CotH2. (Microbial infection) Interacts with Zika virus envelope protein E and non-structural protein 1 in a chaperone-client manner.

Subcellular location. Endoplasmic reticulum lumen. Melanosome. Cytoplasm. Cell surface.

Post-translational modifications. AMPylated by FICD. In unstressed cells, AMPylation at Thr-518 by FICD inactivates the chaperome activity: AMPylated form is locked in a relatively inert state and only weakly stimulated by J domain-containing proteins. In response to endoplasmic reticulum stress, de-AMPylation by the same protein, FICD, restores the chaperone activity.

Disease relevance. Autoantigen in rheumatoid arthritis.

Activity regulation. The chaperone activity is regulated by ATP-induced allosteric coupling of the nucleotide-binding (NBD) and substrate-binding (SBD) domains. In the ADP-bound and nucleotide-free (apo) states, the two domains have little interaction. In contrast, in the ATP-bound state the two domains are tightly coupled, which results in drastically accelerated kinetics in both binding and release of polypeptide substrates. J domain-containing co-chaperones (DNAJB9/ERdj4 or DNAJC10/ERdj5) stimulate the ATPase activity and are required for efficient substrate recognition by HSPA5/BiP. Homooligomerization inactivates participating HSPA5/BiP protomers and probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell.

Domain organisation. The interdomain linker regulates the chaperone activity by mediating the formation of homooligomers. Homooligomers are formed by engagement of the interdomain linker of one HSPA5/BiP molecule as a typical substrate of an adjacent HSPA5/BiP molecule. HSPA5/BiP oligomerization inactivates participating HSPA5/BiP protomers. HSPA5/BiP oligomers probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell. When the levels of unfolded proteins rise, cells can rapidly break up these oligomers to make active monomers.

Induction. By endoplasmic reticulum stress. Induced in nasal epithelial cells by high free iron levels. Induced in nasal epithelial cells in high glucose. Induced in nasal epithelial cells by 3-hydroxybutyric acid (BHB).

Similarity. Belongs to the heat shock protein 70 family.

RefSeq proteins (1): NP_005338* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013126	Hsp_70_fam	Family
IPR018181	Heat_shock_70_CS	Conserved_site
IPR029047	HSP70_peptide-bd_sf	Homologous_superfamily
IPR029048	HSP70_C_sf	Homologous_superfamily
IPR042050	BIP_NBD	Domain
IPR043129	ATPase_NBD	Homologous_superfamily

Pfam: PF00012

Catalyzed reactions (Rhea), 1 shown:

• ATP + H2O = ADP + phosphate + H(+) (RHEA:13065)

UniProt features (101 total): strand 28, helix 22, modified residue 17, turn 9, binding site 5, region of interest 5, mutagenesis site 4, sequence conflict 4, cross-link 2, signal peptide 1, chain 1, sequence variant 1, short sequence motif 1, compositionally biased region 1

Structure

Experimental structures (PDB)

33 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
5YP8	X-RAY DIFFRACTION	1.45
9I5Y	X-RAY DIFFRACTION	1.5
5F0X	X-RAY DIFFRACTION	1.6
5YPH	X-RAY DIFFRACTION	1.63
9H0C	X-RAY DIFFRACTION	1.65
6CZ1	X-RAY DIFFRACTION	1.68
6DO2	X-RAY DIFFRACTION	1.7
5EVZ	X-RAY DIFFRACTION	1.85
6ASY	X-RAY DIFFRACTION	1.85
5EY4	X-RAY DIFFRACTION	1.86
5EX5	X-RAY DIFFRACTION	1.9
5EXW	X-RAY DIFFRACTION	1.9
5F1X	X-RAY DIFFRACTION	1.9
6DWS	X-RAY DIFFRACTION	1.9
3LDO	X-RAY DIFFRACTION	1.95
5YPC	X-RAY DIFFRACTION	1.96
7N1R	X-RAY DIFFRACTION	2.03
6DFM	X-RAY DIFFRACTION	2.14
5F2R	X-RAY DIFFRACTION	2.15
5YPG	X-RAY DIFFRACTION	2.2
3LDN	X-RAY DIFFRACTION	2.2
3LDP	X-RAY DIFFRACTION	2.2
3LDL	X-RAY DIFFRACTION	2.3
3IUC	X-RAY DIFFRACTION	2.4
5YPA	X-RAY DIFFRACTION	2.5
6DFO	X-RAY DIFFRACTION	2.54
5E85	X-RAY DIFFRACTION	2.57
6ZMD	X-RAY DIFFRACTION	2.64
5E86	X-RAY DIFFRACTION	2.68
5YPE	X-RAY DIFFRACTION	2.85

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P11021-F1	90.20	0.71

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (5): 96; 227–229; 293–300; 364–367; 36–39

Post-translational modifications (19): 86, 125, 160, 213, 271, 326, 353, 447, 492, 518, 518, 585, 585, 585, 591, 643, 648, 352, 353

Mutagenesis-validated functional residues (4):

Position	Phenotype
229	impaired atpase activity.
492	significantly reduced binding to zikv e and ns1 proteins.
518	significantly reduced binding to zikv e and ns1 proteins.
585	complete loss of in vitro methylation by mettl21a.

Function

Pathways and Gene Ontology

Reactome pathways

23 pathways

ID	Pathway
R-HSA-114608	Platelet degranulation
R-HSA-3371453	Regulation of HSF1-mediated heat shock response
R-HSA-381033	ATF6 (ATF6-alpha) activates chaperones
R-HSA-381042	PERK regulates gene expression
R-HSA-381070	IRE1alpha activates chaperones
R-HSA-381183	ATF6 (ATF6-alpha) activates chaperone genes
R-HSA-8874177	ATF6B (ATF6-beta) activates chaperones
R-HSA-983170	Antigen Presentation: Folding, assembly and peptide loading of class I MHC
R-HSA-9909505	Modulation of host responses by IFN-stimulated genes
R-HSA-9918432	Maturation of DENV proteins
R-HSA-9918485	Dengue Virus Attachment and Entry
R-HSA-109582	Hemostasis
R-HSA-1280215	Cytokine Signaling in Immune system
R-HSA-1280218	Adaptive Immune System
R-HSA-168256	Immune System
R-HSA-2262752	Cellular responses to stress
R-HSA-3371556	Cellular response to heat stress
R-HSA-381119	Unfolded Protein Response (UPR)
R-HSA-76002	Platelet activation, signaling and aggregation
R-HSA-76005	Response to elevated platelet cytosolic Ca2+
R-HSA-8953897	Cellular responses to stimuli
R-HSA-913531	Interferon Signaling
R-HSA-983169	Class I MHC mediated antigen processing & presentation

MSigDB gene sets: 472 (showing top): GOBP_NEGATIVE_REGULATION_OF_RESPONSE_TO_ENDOPLASMIC_RETICULUM_STRESS, GOBP_NEGATIVE_REGULATION_OF_PROTEIN_CONTAINING_COMPLEX_ASSEMBLY, GOBP_HINDBRAIN_DEVELOPMENT, TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_MONOCYTE_UP, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, BERENJENO_ROCK_SIGNALING_NOT_VIA_RHOA_DN, GOBP_REGULATION_OF_CELLULAR_RESPONSE_TO_GROWTH_FACTOR_STIMULUS, HONMA_DOCETAXEL_RESISTANCE, REACTOME_UNFOLDED_PROTEIN_RESPONSE_UPR, GOBP_METENCEPHALON_DEVELOPMENT, GOBP_IRE1_MEDIATED_UNFOLDED_PROTEIN_RESPONSE, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, REACTOME_ANTIGEN_PRESENTATION_FOLDING_ASSEMBLY_AND_PEPTIDE_LOADING_OF_CLASS_I_MHC

GO Biological Process (30): ER overload response (GO:0006983), cerebellum structural organization (GO:0021589), cerebellar Purkinje cell layer development (GO:0021680), substantia nigra development (GO:0021762), positive regulation of cell migration (GO:0030335), negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512), endoplasmic reticulum unfolded protein response (GO:0030968), post-translational protein targeting to membrane, translocation (GO:0031204), negative regulation of protein-containing complex assembly (GO:0031333), positive regulation of protein ubiquitination (GO:0031398), protein folding in endoplasmic reticulum (GO:0034975), response to endoplasmic reticulum stress (GO:0034976), maintenance of protein localization in endoplasmic reticulum (GO:0035437), IRE1-mediated unfolded protein response (GO:0036498), ERAD pathway (GO:0036503), protein refolding (GO:0042026), cellular response to glucose starvation (GO:0042149), negative regulation of apoptotic process (GO:0043066), positive regulation of transcription by RNA polymerase II (GO:0045944), regulation of protein folding in endoplasmic reticulum (GO:0060904), cellular response to interleukin-4 (GO:0071353), regulation of ATF6-mediated unfolded protein response (GO:1903891), regulation of IRE1-mediated unfolded protein response (GO:1903894), negative regulation of IRE1-mediated unfolded protein response (GO:1903895), regulation of PERK-mediated unfolded protein response (GO:1903897), negative regulation of PERK-mediated unfolded protein response (GO:1903898), translational initiation (GO:0006413), protein folding (GO:0006457), PERK-mediated unfolded protein response (GO:0036499), obsolete proteolysis involved in protein catabolic process (GO:0051603)

GO Molecular Function (19): calcium ion binding (GO:0005509), ATP binding (GO:0005524), ATP hydrolysis activity (GO:0016887), enzyme binding (GO:0019899), protein domain specific binding (GO:0019904), protein serine/threonine kinase inhibitor activity (GO:0030291), heat shock protein binding (GO:0031072), ubiquitin protein ligase binding (GO:0031625), ribosome binding (GO:0043022), protein folding chaperone (GO:0044183), cadherin binding (GO:0045296), obsolete unfolded protein binding (GO:0051082), protein-folding chaperone binding (GO:0051087), misfolded protein binding (GO:0051787), protein sequestering activity (GO:0140311), ATP-dependent protein folding chaperone (GO:0140662), nucleotide binding (GO:0000166), protein binding (GO:0005515), hydrolase activity (GO:0016787)

GO Cellular Component (19): nucleus (GO:0005634), cytoplasm (GO:0005737), mitochondrion (GO:0005739), endoplasmic reticulum (GO:0005783), endoplasmic reticulum lumen (GO:0005788), endoplasmic reticulum membrane (GO:0005789), endoplasmic reticulum-Golgi intermediate compartment (GO:0005793), cytosol (GO:0005829), plasma membrane (GO:0005886), focal adhesion (GO:0005925), cell surface (GO:0009986), membrane (GO:0016020), midbody (GO:0030496), protein-containing complex (GO:0032991), endoplasmic reticulum chaperone complex (GO:0034663), melanosome (GO:0042470), intracellular membrane-bounded organelle (GO:0043231), extracellular exosome (GO:0070062), COP9 signalosome (GO:0008180)

Reactome top-level categories

Rollup of top-13 pathways:

Category	Pathways
Unfolded Protein Response (UPR)	4
Immune System	2
Cellular responses to stress	2
Response to elevated platelet cytosolic Ca2+	1
Cellular response to heat stress	1
ATF6 (ATF6-alpha) activates chaperones	1
Class I MHC mediated antigen processing & presentation	1
Interferon Signaling	1
Dengue Virus Genome Translation and Replication	1
Dengue Virus Infection	1
Cellular responses to stimuli	1
Hemostasis	1
Platelet activation, signaling and aggregation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein binding	6
cellular anatomical structure	5
intracellular membrane-bounded organelle	4
cytoplasm	4
response to endoplasmic reticulum stress	3
protein folding	3
endoplasmic reticulum	2
ATP-dependent activity	2
intracellular anatomical structure	2
ER-nucleus signaling pathway	1
cellular response to biotic stimulus	1
hindbrain structural organization	1
cerebellum morphogenesis	1
anatomical structure arrangement	1
cerebellar cortex development	1
anatomical structure development	1
midbrain development	1
neural nucleus development	1
cell migration	1
regulation of cell migration	1
positive regulation of cell motility	1
transforming growth factor beta receptor signaling pathway	1
regulation of transforming growth factor beta receptor signaling pathway	1
negative regulation of transmembrane receptor protein serine/threonine kinase signaling pathway	1
cellular response to unfolded protein	1
intracellular signal transduction	1
post-translational protein targeting to endoplasmic reticulum membrane	1
intracellular protein transmembrane transport	1
regulation of protein-containing complex assembly	1
negative regulation of cellular component organization	1
protein-containing complex assembly	1
protein ubiquitination	1
regulation of protein ubiquitination	1
positive regulation of protein modification by small protein conjugation or removal	1
cellular response to stress	1
protein localization to endoplasmic reticulum	1
maintenance of protein localization in organelle	1
endoplasmic reticulum unfolded protein response	1
proteasomal protein catabolic process	1
response to chemical	1

Protein interactions and networks

STRING

8610 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HSPA5	EIF2AK3	Q9NZJ5	999
HSPA5	ERN1	O75460	999
HSPA5	ATF6	P18850	999
HSPA5	HSP90B1	P14625	997
HSPA5	SIGMAR1	Q99720	992
HSPA5	PDIA3	P30101	986
HSPA5	CANX	P27824	982
HSPA5	XBP1	P17861	964
HSPA5	A2M	P01023	960
HSPA5	DNAJC1	Q96KC8	960
HSPA5	CALR	P27797	956
HSPA5	GPX4	P36969	953
HSPA5	P4HB	P07237	952
HSPA5	EDEM1	Q92611	945
HSPA5	HSP90AB1	P08238	945

IntAct

1162 interactions, top by confidence:

A	B	Type	Score
PRKAA1	PRKAB2	psi-mi:“MI:0914”(association)	0.950
MAPRE1	CLASP2	psi-mi:“MI:0914”(association)	0.850
VIM	NEFL	psi-mi:“MI:0914”(association)	0.840
DNAJB11	HSPA5	psi-mi:“MI:0407”(direct interaction)	0.830
APP	APBB1	psi-mi:“MI:0914”(association)	0.740
CFTR	XPO1	psi-mi:“MI:0914”(association)	0.710
	HSPA5	psi-mi:“MI:0407”(direct interaction)	0.690
	HSPA5	psi-mi:“MI:0915”(physical association)	0.690
	HSPA5	psi-mi:“MI:0403”(colocalization)	0.690
	HSPA5	psi-mi:“MI:2364”(proximity)	0.690
HSPA5	HYOU1	psi-mi:“MI:0915”(physical association)	0.670
IFT88	IFT56	psi-mi:“MI:0914”(association)	0.640
ERN1	HSPA5	psi-mi:“MI:0915”(physical association)	0.610
ERN1	HSPA5	psi-mi:“MI:0914”(association)	0.610
PARD3	HSPA5	psi-mi:“MI:0915”(physical association)	0.610
MAST1	HSPA5	psi-mi:“MI:0915”(physical association)	0.610
EIF2AK3	HSPA5	psi-mi:“MI:0915”(physical association)	0.590
HSPA5	RAF1	psi-mi:“MI:0915”(physical association)	0.580
RAF1	HSPA5	psi-mi:“MI:0915”(physical association)	0.580
HSPA5	RAF1	psi-mi:“MI:0403”(colocalization)	0.580
PDIA6	HSPA5	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (2220): HSPA5 (Affinity Capture-MS), HSPA5 (Affinity Capture-Western), GPX7 (Affinity Capture-Western), HSPA5 (Affinity Capture-MS), HSPA5 (Affinity Capture-MS), AMFR (Affinity Capture-Western), HSPA5 (Affinity Capture-Western), HSPA5 (Affinity Capture-Western), EP300 (Affinity Capture-Western), HSPA5 (Affinity Capture-MS), HSPA5 (Affinity Capture-MS), HSPA5 (Affinity Capture-RNA), HSPA5 (Affinity Capture-RNA), HSPA5 (Affinity Capture-RNA), HSPA5 (Affinity Capture-MS)

ESM2 similar proteins: A0A0D1CD96, G0SCU5, G3I8R9, G4NAY4, O24581, O35501, P07823, P11021, P16474, P19208, P20029, P20163, P22010, P24067, P27420, P29844, P29845, P36604, P38646, P38647, P48721, P49118, P59769, P78695, P83616, P83617, P86233, Q03684, Q03685, Q08276, Q0VCX2, Q16956, Q24798, Q24895, Q39043, Q3S4T7, Q42434, Q5R4P0, Q5R511, Q6BZH1

Diamond homologs: A0A0D1CD96, A0A509AJG0, A2Q0Z1, A5A8V7, F5HB71, G3I8R9, J9VZ70, O24581, O59855, O73885, O93866, P02827, P06761, P07823, P08108, P08418, P09189, P0CB32, P0DMV8, P0DMV9, P10591, P10592, P11021, P11142, P14659, P16474, P17156, P17879, P19120, P19208, P19378, P20029, P20163, P22010, P22202, P24067, P26413, P27420, P29844, P34933

SIGNOR signaling

20 interactions.

A	Effect	B	Mechanism
ATF4	“down-regulates quantity by repression”	HSPA5	“transcriptional regulation”
BRCA1	“down-regulates quantity by repression”	HSPA5	“transcriptional regulation”
E2F1	“down-regulates quantity by repression”	HSPA5	“transcriptional regulation”
GTF2I	“up-regulates quantity by expression”	HSPA5	“transcriptional regulation”
HDAC1	“down-regulates quantity by repression”	HSPA5	“transcriptional regulation”
YY1	“up-regulates quantity by expression”	HSPA5	“transcriptional regulation”
Unfolded_Proteins	down-regulates	HSPA5
HSPA5	“down-regulates activity”	EIF2AK3	binding
HSPA5	“down-regulates activity”	ERN1	binding
HSPA5	“down-regulates activity”	ATF6	binding
S	“up-regulates quantity by expression”	HSPA5	“transcriptional regulation”
ATE1	“down-regulates quantity by destabilization”	HSPA5	“post transcriptional regulation”
HERPUD1	“up-regulates quantity by stabilization”	HSPA5	relocalization
ATF6	“up-regulates quantity by expression”	HSPA5	“transcriptional regulation”
ATF6B	“up-regulates quantity by expression”	HSPA5	“transcriptional regulation”
DNAJB9	“up-regulates activity”	HSPA5	binding
SIL1	“up-regulates activity”	HSPA5	binding
“SEC61 complex”	“up-regulates activity”	HSPA5	binding
HSPA5	up-regulates	UPR
HSPA5	up-regulates	“Chaperone-mediated protein folding”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 191 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Activation of AMPK downstream of NMDARs	5	15.0×	6e-03
DNA Damage Recognition in GG-NER	5	11.2×	9e-03
Cargo recognition for clathrin-mediated endocytosis	9	7.4×	2e-03
EML4 and NUDC in mitotic spindle formation	8	5.8×	9e-03
RHO GTPases Activate Formins	9	5.5×	9e-03
Neddylation	11	4.1×	9e-03

GO biological processes:

GO term	Partners	Fold	FDR
intrinsic apoptotic signaling pathway	6	13.2×	2e-03
endoplasmic reticulum unfolded protein response	6	10.9×	4e-03
response to endoplasmic reticulum stress	10	10.2×	7e-05
microtubule cytoskeleton organization	10	7.4×	7e-04
cellular response to oxidative stress	7	6.6×	9e-03
DNA damage response	12	3.9×	7e-03
negative regulation of apoptotic process	16	3.4×	4e-03

Disease & clinical

Cancer significance

Clinical variants and AI predictions

ClinVar

56 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	34
Likely benign	2
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

582 predictions. Top by Δscore:

Variant	Effect	Δscore
9:125237150:TTCAC:T	acceptor_gain	1.0000
9:125237151:TCAC:T	acceptor_gain	1.0000
9:125237152:CAC:C	acceptor_gain	1.0000
9:125237152:CACC:C	acceptor_gain	1.0000
9:125237153:AC:A	acceptor_gain	1.0000
9:125237154:CC:C	acceptor_gain	1.0000
9:125237154:CCTAG:C	acceptor_loss	1.0000
9:125237155:C:CC	acceptor_gain	1.0000
9:125237162:T:C	acceptor_gain	1.0000
9:125237162:T:TC	acceptor_gain	1.0000
9:125237165:C:CT	acceptor_gain	1.0000
9:125237166:A:C	acceptor_gain	1.0000
9:125238270:CAAG:C	acceptor_gain	1.0000
9:125238305:TCACC:T	acceptor_loss	1.0000
9:125238306:CAC:C	acceptor_gain	1.0000
9:125238306:CACCT:C	acceptor_loss	1.0000
9:125238308:CCTGT:C	acceptor_loss	1.0000
9:125238309:C:CC	acceptor_gain	1.0000
9:125238309:C:CG	acceptor_loss	1.0000
9:125238585:CCTA:C	donor_loss	1.0000
9:125238587:TA:T	donor_loss	1.0000
9:125238588:A:AC	donor_gain	1.0000
9:125238588:A:AT	donor_loss	1.0000
9:125238588:AC:A	donor_gain	1.0000
9:125238589:C:CT	donor_gain	1.0000
9:125238589:CC:C	donor_gain	1.0000
9:125238589:CCTGT:C	donor_gain	1.0000
9:125238823:AGATC:A	acceptor_gain	1.0000
9:125238824:GATC:G	acceptor_gain	1.0000
9:125238825:ATC:A	acceptor_gain	1.0000

AlphaMissense

4316 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
9:125237019:G:T	A513D	1.000
9:125237106:A:G	L484P	1.000
9:125238161:A:T	V461D	1.000
9:125238190:A:C	F451L	1.000
9:125238190:A:T	F451L	1.000
9:125238192:A:G	F451L	1.000
9:125238628:G:T	A399D	1.000
9:125238629:C:G	A399P	1.000
9:125238631:G:T	A398D	1.000
9:125238632:C:G	A398P	1.000
9:125238634:C:A	G397V	1.000
9:125238634:C:T	G397D	1.000
9:125238635:C:A	G397C	1.000
9:125238635:C:G	G397R	1.000
9:125238640:G:T	A395E	1.000
9:125238653:C:G	D391H	1.000
9:125238724:C:G	R367P	1.000
9:125238733:C:T	G364D	1.000
9:125238734:C:G	G364R	1.000
9:125238736:C:A	G363V	1.000
9:125238736:C:T	G363D	1.000
9:125238737:C:A	G363C	1.000
9:125238737:C:G	G363R	1.000
9:125238745:A:T	V360D	1.000
9:125238799:A:T	V342D	1.000
9:125239041:A:G	L299P	1.000
9:125239047:C:G	R297P	1.000
9:125239049:T:A	K296N	1.000
9:125239049:T:G	K296N	1.000
9:125239050:T:A	K296I	1.000

dbSNP variants (sampled 300 via entrez): RS1000089203 (9:125242018 T>C), RS1000192312 (9:125241627 C>G,T), RS1001027372 (9:125235961 GTGGAT>G), RS1001147608 (9:125243149 G>A), RS1001276387 (9:125234658 TTATATATGTATACATAAACACA>T,TTATATATGTATACATAAACACATATATATGTATACATAAACACA), RS1001386461 (9:125241382 C>A,G,T), RS1001477164 (9:125241462 C>A), RS1001514557 (9:125242014 A>C), RS1001733052 (9:125241554 A>G), RS1002112028 (9:125236463 A>G), RS1002231438 (9:125235818 C>G), RS1002995781 (9:125240023 T>C), RS1003459903 (9:125239784 A>G), RS1003480777 (9:125238511 G>C,T), RS1003553205 (9:125240420 A>C,G)

Disease associations

OMIM: gene MIM:138120 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST010002_280	Refractive error	1.000000e-13
GCST011703_94	Smoking initiation	9.000000e-09

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0005670	smoking initiation

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL1781865 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

5 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 137,107 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL496	HEXACHLOROPHENE	4	26,164
CHEMBL849	TRICLOSAN	4	77,720
CHEMBL1232461	MOLIBRESIB	2	1,538
CHEMBL2105450	OXYCLOZANIDE	2	2,189
CHEMBL33845	DICHLOROPHEN	2	29,496

Clinical evidence (CIViC)

Drug × variant × indication: 1 predictive associations from 1 curated evidence items.

Variant	Therapy	Indication	Effect	Level	CIViC
HSPA5 EXPRESSION	Fluorouracil	Colorectal Cancer	Sensitivity/Response	CIViC B	EID914

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

1 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs430397	Efficacy	3	Platinum compounds	Non-Small Cell Lung Carcinoma

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs430397	HSPA5, RABEPK	3	10.50	1	Platinum compounds

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: other protein — Heat shock proteins

ChEMBL bioactivities

51 potent at pChembl≥5 of 63 total, top 45 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.62	Kd	23.8	nM	CHEMBL5653589
7.60	ED50	25.02	nM	CHEMBL5653589
7.25	Kd	56	nM	MOLIBRESIB
7.22	Kd	60	nM	CHEMBL462871
7.10	Kd	80	nM	CHEMBL470334
7.00	Kd	100	nM	CHEMBL462871
6.96	Kd	110	nM	CHEMBL5414287
6.89	IC50	130	nM	MOLIBRESIB
6.70	Kd	200	nM	CHEMBL470334
6.64	Kd	230	nM	CHEMBL515570
6.60	Kd	250	nM	CHEMBL473972
6.52	IC50	300	nM	CHEMBL3576921
6.48	Kd	334	nM	CHEMBL5431926
6.46	Kd	350	nM	CHEMBL515570
6.23	IC50	590	nM	CHEMBL5414287
6.17	Kd	679	nM	CHEMBL5639838
6.16	IC50	700	nM	CHEMBL5419391
6.11	Kd	770	nM	CHEMBL538168
6.10	IC50	800	nM	CHEMBL470334
6.06	Kd	870	nM	CHEMBL516357
6.00	Kd	990	nM	CHEMBL1784882
6.00	Kd	990	nM	CHEMBL516357
5.96	IC50	1100	nM	CHEMBL5403845
5.82	IC50	1500	nM	CHEMBL5425293
5.82	IC50	1500	nM	CHEMBL1439833
5.77	IC50	1700	nM	CHEMBL5409255
5.73	Kd	1853	nM	CHEMBL3752910
5.71	ED50	1948	nM	CHEMBL3752910
5.66	Kd	2170	nM	ADENOSINE DIPHOSPHATE
5.62	Kd	2410	nM	CHEMBL1614768
5.58	IC50	2600	nM	CHEMBL1439833
5.57	Kd	2710	nM	CHEMBL1784884
5.54	IC50	2900	nM	CHEMBL5424525
5.46	IC50	3500	nM	CHEMBL5424525
5.46	IC50	3500	nM	CHEMBL5410567
5.44	IC50	3600	nM	CHEMBL5407447
5.42	Kd	3830	nM	ADENOSINE DIPHOSPHATE
5.36	Kd	4360	nM	CHEMBL1784883
5.18	IC50	6600	nM	CHEMBL5433282
5.17	IC50	6700	nM	CHEMBL5437667
5.17	Kd	6800	nM	CHEMBL516197
5.13	Kd	7460	nM	CHEMBL451058
5.12	IC50	7500	nM	CHEMBL5308000
5.12	IC50	7500	nM	CHEMBL5422252
5.04	IC50	9100	nM	HEXACHLOROPHENE

PubChem BioAssay actives

65 with measured affinity, of 144 total; 37 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148553: Binding affinity to human HSPA5 incubated for 45 mins by Kinobead based pull down assay	kd	0.0238	uM
2-[(4S)-6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-[1,2,4]triazolo[4,3-a][1,4]benzodiazepin-4-yl]-N-ethylacetamide	2179133: Binding affinity against HSPA5 (unknown origin) assessed as apparent dissociation constant incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	kd	0.0560	uM
4-[[(2R,3S,4R,5R)-5-[6-amino-8-(quinolin-6-ylmethylamino)purin-9-yl]-3,4-dihydroxyoxolan-2-yl]methoxymethyl]benzonitrile	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	0.0600	uM
4-[[(2R,3S,4R,5R)-5-[6-amino-8-[(3,4-dichlorophenyl)methylamino]purin-9-yl]-3,4-dihydroxyoxolan-2-yl]methoxymethyl]benzonitrile	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	0.0800	uM
N-[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]-1H-indole-2-carboxamide	2141348: Binding affinity to GRP78 (unknown origin) assessed as dissociation constant	kd	0.1100	uM
(2R,3R,4S,5R)-2-[6-amino-8-(quinolin-6-ylmethylamino)purin-9-yl]-5-(hydroxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	0.2300	uM
(2R,3R,4S,5R)-2-[6-amino-8-[(3,4-dichlorophenyl)methylamino]purin-9-yl]-5-(methoxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	0.2500	uM
(1S,3R,6R,10R,11R,12R,14R,15Z,17S,20S,21S,24R,25S,26S,27E)-11-[(2R,4S,5S,6R)-5-[(2S,3R,4S,5S,6S)-5-[(2S,4S,5S,6R)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-3-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-16,26-diethyl-21,27-dihydroxy-14-(hydroxymethyl)-3,4,6,10,12,18,24-heptamethyl-30-oxapentacyclo[26.2.1.01,6.017,26.020,25]hentriaconta-4,15,18,27-tetraene-23,29,31-trione	1225249: Inhibition of 2-deoxyglucose-induced GRP78 (unknown origin) expression transfected in human HT1080 cells by luciferase reporter gene assay	ic50	0.3000	uM
2-(3-amino-6-imino-8a,9-dihydroxanthen-9-yl)-5-[2-[2-[2-[2-[3-[[3-[5-[2-[[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]carbamoyl]-1H-indol-5-yl]-3,4,5,13-tetrazatetracyclo[13.4.0.02,6.07,12]nonadeca-1(19),2(6),3,7,9,11,15,17-octaen-13-yl]-3-oxopropyl]amino]-3-oxopropoxy]ethoxy]ethoxy]ethoxy]ethylcarbamoyl]benzoic acid	1968969: Binding affinity to HspA5 (unknown origin) assessed as dissociation constant by FP assay	kd	0.3340	uM
N-[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]-1,3-thiazole-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	0.5000	uM
N-[(2S,3R)-1-[(4,5-dimethyl-1,3-thiazol-2-yl)amino]-3-methyl-1-oxopentan-2-yl]-1H-indole-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	0.5000	uM
N-[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]furan-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	0.5000	uM
177372351	2141348: Binding affinity to GRP78 (unknown origin) assessed as dissociation constant	kd	0.6790	uM
N-[(2S)-1-oxo-1-(1,3-thiazol-2-ylamino)hexan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	0.7000	uM
(2R,3R,4S,5R)-2-[6-amino-8-[(3,4-dichlorophenyl)methylamino]purin-9-yl]-5-(phenylmethoxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	0.7700	uM
(2R,3R,4S,5R)-2-[6-amino-8-[(3,4-dichlorophenyl)methylamino]purin-9-yl]-5-(hydroxymethyl)oxolane-3,4-diol	600788: Binding affinity to Grp78 by isothermal titration calorimetric analysis	kd	0.8700	uM
(2R,3R,4S,5R)-2-[6-amino-8-(methylamino)purin-9-yl]-5-(phenylmethoxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	0.9900	uM
N-[(2S)-1-oxo-1-(1,3-thiazol-2-ylamino)pentan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	1.1000	uM
N-[(2S)-1-[(4,5-dimethyl-1,3-thiazol-2-yl)amino]-3-methyl-1-oxobutan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	1.5000	uM
N-[1,3-benzodioxol-5-yl-(5-chloro-8-hydroxyquinolin-7-yl)methyl]butanamide	2141369: Inhibition of GRP78 (unknown origin) by FP assay	ic50	1.5000	uM
N-[(2S,3S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)pentan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	1.7000	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148553: Binding affinity to human HSPA5 incubated for 45 mins by Kinobead based pull down assay	kd	1.8535	uM
[[(2R,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl] hydrogen phosphate	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	2.1700	uM
[(2R,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-dihydroxyoxolan-2-yl]methyl phosphono hydrogen phosphate	600785: Binding affinity to histidine-tagged Grp78 by surface plasmon resonance analysis	kd	2.1700	uM
(2R,3R,4S,5R)-2-[6-amino-8-(quinolin-2-ylmethylamino)purin-9-yl]-5-(hydroxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	2.4100	uM
(2R,3R,4S,5R)-2-[6-amino-8-(methylamino)purin-9-yl]-5-(pyridin-3-ylmethoxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	2.7100	uM
N-[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	2.9000	uM
N-[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]-1H-imidazole-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	3.5000	uM
N-[(2S)-4-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)pentan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	3.6000	uM
(2R,3R,4S,5R)-2-[6-amino-8-(methylamino)purin-9-yl]-5-(cyclohexylmethoxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	4.3600	uM
N-[(2S)-3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]-2-oxochromene-3-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	6.6000	uM
N-[(2S)-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	6.7000	uM
(2R,3R,4S,5R)-2-(6,8-diaminopurin-9-yl)-5-(hydroxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	6.8000	uM
(2R,3R,4S,5R)-2-[6-amino-8-(methylamino)purin-9-yl]-5-(hydroxymethyl)oxolane-3,4-diol	1799592: SPR assay from Article 10.1021/jm101625x: “Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity.”	kd	7.4600	uM
N-[3-methyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]thiophene-2-carboxamide	1968945: Inhibition of FAM-labeled NRLLLTG binding from HspA5 (unknown origin) in presence of ATP by FP assay	ic50	7.5000	uM
N-[(2S)-3,3-dimethyl-1-oxo-1-(1,3-thiazol-2-ylamino)butan-2-yl]thiophene-2-carboxamide	1968962: Inhibition of HspA5 (unknown origin) by FP assay	ic50	7.5000	uM
3,4,6-trichloro-2-[(2,3,5-trichloro-6-hydroxyphenyl)methyl]phenol	1590351: Inhibition of GRP78 (26 to 636 residues) (unknown origin) expressed in Escherichia coli BL21 DE3 cells pre-incubated for 10 mins before FITC-NRLLLTG fluorescent peptide addition in presence of 20 uM ADP followed by further incubation for 2 hrs by fluorescence polarization assay	ic50	9.1000	uM

CTD chemical–gene interactions

423 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tunicamycin	decreases reaction, increases expression, affects cotreatment, affects binding, increases reaction	34
Thapsigargin	increases reaction, decreases transport, increases response to substance, decreases reaction, increases expression	34
4-phenylbutyric acid	decreases reaction, increases cleavage, increases expression, decreases expression, increases reaction	21
Acetylcysteine	decreases expression, increases abundance, affects expression, decreases reaction, increases expression (+2 more)	17
Cadmium Chloride	affects expression, increases phosphorylation, decreases expression, affects cotreatment, increases expression (+3 more)	14
Cyclosporine	affects cotreatment, increases expression	12
Bortezomib	increases expression, increases reaction, decreases response to substance, decreases reaction	11
Particulate Matter	affects cotreatment, increases abundance, increases expression, decreases expression, decreases reaction	11
Quercetin	decreases expression, affects cotreatment, increases expression, decreases reaction, decreases response to substance	10
Cisplatin	increases cleavage, affects cotreatment, increases expression, decreases expression, decreases response to substance (+1 more)	9
Tobacco Smoke Pollution	affects expression, increases expression, increases metabolic processing	9
Resveratrol	decreases reaction, increases expression, increases reaction, affects cotreatment, decreases expression	8
Arsenic Trioxide	affects response to substance, decreases reaction, increases expression, increases reaction, affects cotreatment (+1 more)	8
Cadmium	affects cotreatment, increases expression, decreases expression, decreases reaction, increases abundance	8
bisphenol A	affects expression, affects cotreatment, increases expression, decreases expression	7
sodium arsenite	affects reaction, increases cleavage, increases secretion, affects expression, decreases expression (+2 more)	7
Air Pollutants	decreases reaction, increases abundance, increases expression, affects cotreatment, decreases expression	7
Glucose	decreases reaction, increases expression, affects cotreatment, increases reaction	7
Lipopolysaccharides	affects reaction, decreases expression, increases expression, increases reaction, decreases reaction (+3 more)	7
Brefeldin A	decreases reaction, increases expression, increases cleavage	7
ochratoxin A	increases reaction, decreases expression, decreases methylation, decreases reaction, affects reaction (+1 more)	6
ursodoxicoltaurine	decreases reaction, increases expression	6
Copper	decreases expression, increases abundance, increases expression, affects binding, affects cotreatment	6
Dithiothreitol	increases expression	6
Glucosamine	decreases reaction, increases expression	6
salubrinal	decreases reaction, increases expression, increases reaction	4
Calcimycin	increases expression, decreases reaction	4
Benzo(a)pyrene	increases expression, decreases expression	4
Capsaicin	increases expression, increases localization	4
Doxorubicin	increases expression, affects expression, decreases reaction	4

ChEMBL screening assays

38 unique, capped per target: 36 binding, 2 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1786486	Binding	Binding affinity to histidine-tagged Grp78 by surface plasmon resonance analysis	Adenosine-derived inhibitors of 78 kDa glucose regulated protein (Grp78) ATPase: insights into isoform selectivity. — J Med Chem
CHEMBL1794423	Functional	PUBCHEM_BIOASSAY: Inducers of the Endoplasmic Reticulum Stress Response (ERSR) in human glioma: Validation. (Class of assay: confirmatory) [Related pubchem assays (depositor defined):AID504849]	PubChem BioAssay data set

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.