HTR1F

Summary

HTR1F (5-hydroxytryptamine receptor 1F, HGNC:5292) is a protein-coding gene on chromosome 3p12, encoding 5-hydroxytryptamine receptor 1F (P30939). G-protein coupled receptor for 5-hydroxytryptamine (serotonin).

Enables Gi/o-coupled serotonin receptor activity; serotonin binding activity; and serotonin receptor activity. Involved in adenylate cyclase-inhibiting serotonin receptor signaling pathway. Located in plasma membrane.

Source: NCBI Gene 3355 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 35 total
• Druggable target: yes — 5 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_001322209

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:5292
Approved symbol	HTR1F
Name	5-hydroxytryptamine receptor 1F
Location	3p12
Locus type	gene with protein product
Status	Approved
Aliases	HTR1EL, 5-HT1F
Ensembl gene	ENSG00000179097
Ensembl biotype	protein_coding
OMIM	182134
Entrez	3355

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000319595, ENST00000858974

RefSeq mRNA: 4 — MANE Select: NM_001322209 NM_000866, NM_001322208, NM_001322209, NM_001322210

CCDS: CCDS2920

Canonical transcript exons

ENST00000319595 — 3 exons

Exon	Start	End
ENSE00001220697	87990708	87993839
ENSE00003907719	87822008	87822124
ENSE00003909302	87792706	87792842

Expression profiles

Bgee: expression breadth ubiquitous, 105 present calls, max score 73.96.

FANTOM5 (CAGE): breadth broad, TPM avg 1.4367 / max 582.1069, expressed in 293 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
37445	0.8290	178
37446	0.4075	119
37447	0.1685	91
37444	0.0317	12

Top tissues by expression

247 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	73.96	silver quality
islet of Langerhans	UBERON:0000006	69.86	gold quality
buccal mucosa cell	CL:0002336	69.81	gold quality
calcaneal tendon	UBERON:0003701	65.47	gold quality
tendon	UBERON:0000043	62.65	gold quality
tibialis anterior	UBERON:0001385	60.92	silver quality
pancreatic ductal cell	CL:0002079	60.79	silver quality
tendon of biceps brachii	UBERON:0008188	58.22	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	57.18	silver quality
prefrontal cortex	UBERON:0000451	57.05	gold quality
ileal mucosa	UBERON:0000331	56.89	silver quality
decidua	UBERON:0002450	56.55	gold quality
smooth muscle tissue	UBERON:0001135	55.47	gold quality
subcutaneous adipose tissue	UBERON:0002190	53.83	gold quality
deltoid	UBERON:0001476	53.15	gold quality
hair follicle	UBERON:0002073	52.43	gold quality
epithelial cell of pancreas	CL:0000083	51.33	gold quality
sural nerve	UBERON:0015488	50.89	gold quality
pancreas	UBERON:0001264	50.73	gold quality
omental fat pad	UBERON:0010414	50.69	gold quality
peritoneum	UBERON:0002358	50.66	gold quality
muscle tissue	UBERON:0002385	50.62	gold quality
adipose tissue of abdominal region	UBERON:0007808	50.14	gold quality
adipose tissue	UBERON:0001013	49.80	gold quality
connective tissue	UBERON:0002384	49.79	gold quality
primary visual cortex	UBERON:0002436	49.76	gold quality
quadriceps femoris	UBERON:0001377	49.43	gold quality
frontal cortex	UBERON:0001870	49.37	gold quality
cervix squamous epithelium	UBERON:0006922	49.20	gold quality
uterine cervix	UBERON:0000002	48.99	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-HCAD-35	yes	669.57
E-GEOD-83139	yes	9.06
E-ANND-3	yes	3.76

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

132 targeting HTR1F, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-6888-3P	99.97	65.95	1170
HSA-MIR-8075	99.97	67.20	962
HSA-MIR-1468-3P	99.96	72.74	3797

Literature-anchored findings (GeneRIF, showing 3)

• 5-HT6 show no striking effects on executive function in the Chinese Han population. (PMID:21457069)
• Supporting this model, pharmacological activation of 5-HT1F receptors reduces glucagon secretion and has hypoglycemic effects in diabetic mice. Thus, modulation of serotonin signaling in the islet represents a drug intervention opportunity (PMID:28009296)
• stimulation of 5-HT1F receptor is involved in mitochondrial biogenesis in endothelial cells. (PMID:31542386)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Htr1f	ENSMUSG00000050783
rattus_norvegicus	Htr1f	ENSRNOG00000000716
drosophila_melanogaster	5-HT1A	FBGN0004168
drosophila_melanogaster	5-HT1B	FBGN0263116

Paralogs (8): HTR2A (ENSG00000102468), HTR1B (ENSG00000135312), HTR2B (ENSG00000135914), HTR2C (ENSG00000147246), HTR7 (ENSG00000148680), HTR5A (ENSG00000157219), HTR6 (ENSG00000158748), HTR1E (ENSG00000168830)

Protein

Protein identifiers

5-hydroxytryptamine receptor 1F — P30939 (reviewed: P30939)

Alternative names: Serotonin receptor 1F

All UniProt accessions (1): P30939

UniProt curated annotations — full annotation on UniProt →

Function. G-protein coupled receptor for 5-hydroxytryptamine (serotonin). Also functions as a receptor for various alkaloids and psychoactive substances. Receptor for lasmiditan, a drug for the treatment of acute migraine. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of downstream effectors, such as adenylate cyclase. HTR1F is coupled to G(i)/G(o) G alpha proteins and mediates inhibitory neurotransmission by inhibiting adenylate cyclase activity.

Subcellular location. Cell membrane.

Similarity. Belongs to the G-protein coupled receptor 1 family.

RefSeq proteins (4): NP_000857, NP_001309137, NP_001309138, NP_001309139 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000276	GPCR_Rhodpsn	Family
IPR000450	5HT1F_rcpt	Family
IPR002231	5HT_rcpt	Family
IPR017452	GPCR_Rhodpsn_7TM	Domain

Pfam: PF00001

UniProt features (48 total): helix 13, mutagenesis site 10, topological domain 8, transmembrane region 7, short sequence motif 2, binding site 2, glycosylation site 2, turn 2, chain 1, disulfide bond 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
21AG	ELECTRON MICROSCOPY	3.13
21AH	ELECTRON MICROSCOPY	3.18
7EXD	ELECTRON MICROSCOPY	3.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P30939-F1	83.34	0.50

Antibody-complex structures (SAbDab): 1 — 7EXD

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (2): 103; 107

Disulfide bonds (1): 96–172

Glycosylation sites (2): 5, 10

Mutagenesis-validated functional residues (10):

Position	Phenotype
103	decreased binding to lasmiditan drug.
104	decreased binding to lasmiditan drug.
107	decreased binding to lasmiditan drug.
108	decreased binding to lasmiditan drug.
182	decreased binding to lasmiditan drug.
306	decreased binding to lasmiditan drug.
309	decreased binding to lasmiditan drug.
310	decreased binding to lasmiditan drug.
313	decreased binding to lasmiditan drug. nearly abolished g(i)/(o)-coupled receptor activity.
337	decreased binding to lasmiditan drug.

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-390666	Serotonin receptors
R-HSA-418594	G alpha (i) signalling events
R-HSA-162582	Signal Transduction
R-HSA-372790	Signaling by GPCR
R-HSA-373076	Class A/1 (Rhodopsin-like receptors)
R-HSA-375280	Amine ligand-binding receptors
R-HSA-388396	GPCR downstream signalling
R-HSA-500792	GPCR ligand binding

MSigDB gene sets: 100 (showing top): GOMF_G_PROTEIN_COUPLED_SEROTONIN_RECEPTOR_ACTIVITY, GOBP_CELL_CELL_SIGNALING, GOBP_ADENYLATE_CYCLASE_MODULATING_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, ROSS_LEUKEMIA_WITH_MLL_FUSIONS, KEGG_NEUROACTIVE_LIGAND_RECEPTOR_INTERACTION, GOBP_SYNAPTIC_SIGNALING, GOBP_ADENYLATE_CYCLASE_INHIBITING_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, GOCC_NEURON_PROJECTION, FOXJ2_02, TGGAAA_NFAT_Q4_01, HADDAD_T_LYMPHOCYTE_AND_NK_PROGENITOR_UP, GOCC_SYNAPSE, GOCC_SOMATODENDRITIC_COMPARTMENT, GOMF_SEROTONIN_RECEPTOR_ACTIVITY, GOMF_G_PROTEIN_COUPLED_AMINE_RECEPTOR_ACTIVITY

GO Biological Process (7): G protein-coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187), adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway (GO:0007193), adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198), chemical synaptic transmission (GO:0007268), signal transduction (GO:0007165), G protein-coupled receptor signaling pathway (GO:0007186), adenylate cyclase-activating G protein-coupled receptor signaling pathway (GO:0007189)

GO Molecular Function (6): Gi/o-coupled serotonin receptor activity (GO:0001586), G protein-coupled serotonin receptor activity (GO:0004993), neurotransmitter receptor activity (GO:0030594), serotonin binding (GO:0051378), serotonin receptor activity (GO:0099589), G protein-coupled receptor activity (GO:0004930)

GO Cellular Component (4): plasma membrane (GO:0005886), dendrite (GO:0030425), synapse (GO:0045202), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Signaling by GPCR	2
Amine ligand-binding receptors	1
GPCR downstream signalling	1
Signal Transduction	1
GPCR ligand binding	1
Class A/1 (Rhodopsin-like receptors)	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
G protein-coupled receptor signaling pathway	2
adenylate cyclase-modulating G protein-coupled receptor signaling pathway	2
G protein-coupled serotonin receptor signaling pathway	2
transmembrane signaling receptor activity	2
adenylate cyclase inhibitor activity	1
Gi/o-coupled serotonin receptor activity	1
adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway	1
anterograde trans-synaptic signaling	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
G protein-coupled receptor activity	1
signal transduction	1
adenylate cyclase activator activity	1
G protein-coupled serotonin receptor activity	1
G protein-coupled amine receptor activity	1
serotonin binding	1
signaling receptor activity	1
cation binding	1
amine binding	1
heterocyclic compound binding	1
membrane	1
cell periphery	1
neuron projection	1
dendritic tree	1
cell junction	1
cellular anatomical structure	1

Protein interactions and networks

STRING

600 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HTR1F	HTR3A	P46098	703
HTR1F	HTR3B	O95264	666
HTR1F	EPHA6	Q9UF33	499
HTR1F	SLC6A4	P31645	493
HTR1F	HTR3C	Q8WXA8	491
HTR1F	HTR3D	Q70Z44	486
HTR1F	HTR2C	P28335	479
HTR1F	HTR3E	A5X5Y0	478
HTR1F	GBE1	Q04446	470
HTR1F	QDPR	P09417	427
HTR1F	TPH1	P17752	426
HTR1F	AKR1D1	P51857	424
HTR1F	RYR2	Q92736	422
HTR1F	HTR1D	P28221	416
HTR1F	IL31RA	Q8NI17	402

IntAct

2 interactions, top by confidence:

A	B	Type	Score
RAMP3	HTR1F	psi-mi:“MI:0915”(physical association)	0.400
HTR1F	RAMP3	psi-mi:“MI:0915”(physical association)	0.400

ESM2 similar proteins: A0A678XMK4, A6QLE7, G3M4F8, O08890, O42384, O42574, O70528, P07550, P0C5J4, P10608, P17124, P18762, P25021, P25102, P28221, P28222, P28334, P28564, P28565, P28566, P30939, P30940, P35404, P35406, P46636, P47747, P56496, P60020, P60021, P61752, P79748, P97288, Q02284, Q0EAB5, Q13639, Q28044, Q28509, Q588Y6, Q61224, Q62758

Diamond homologs: E7EM37, G3M4F8, O02213, O08890, O18935, O19014, O19025, O42384, O42385, O73810, O77715, O77723, O77830, P08908, P08909, P08913, P11614, P14416, P18825, P18871, P19020, P20288, P21917, P22086, P22270, P22909, P24628, P28221, P28222, P28334, P28335, P28564, P28566, P30545, P30728, P30729, P30939, P32304, P32305, P34968

SIGNOR signaling

9 interactions.

A	Effect	B	Mechanism
HTR1F	“up-regulates activity”	GNAI1	binding
HTR1F	“up-regulates activity”	GNAI3	binding
serotonin(1+)	“up-regulates activity”	HTR1F	“chemical activation”
serotonin	“up-regulates activity”	HTR1F	“chemical activation”
olanzapine	“up-regulates activity”	HTR1F	“chemical activation”
clozapine	“up-regulates activity”	HTR1F	“chemical activation”
risperidone	“down-regulates activity”	HTR1F	“chemical inhibition”
quetiapine	“up-regulates activity”	HTR1F	“chemical activation”
sertindole	“down-regulates activity”	HTR1F	“chemical inhibition”

Disease & clinical

Clinical variants and AI predictions

ClinVar

35 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	34
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

19 predictions. Top by Δscore:

Variant	Effect	Δscore
3:87990947:A:AG	acceptor_gain	0.4700
3:87990948:G:GG	acceptor_gain	0.4700
3:87991617:A:T	donor_gain	0.3400
3:87990944:TGCAG:T	acceptor_gain	0.2800
3:87990789:G:C	acceptor_gain	0.2600
3:87990842:T:TA	acceptor_gain	0.2600
3:87991454:G:GT	donor_gain	0.2500
3:87991605:ACAAG:A	donor_gain	0.2500
3:87990843:G:A	acceptor_gain	0.2400
3:87991455:A:T	donor_gain	0.2400
3:87991604:TAC:T	donor_gain	0.2400
3:87993375:A:AG	acceptor_gain	0.2400
3:87993376:G:GG	acceptor_gain	0.2400
3:87991651:CATTT:C	donor_gain	0.2300
3:87991659:A:AG	donor_gain	0.2300
3:87990949:T:G	acceptor_gain	0.2200
3:87990723:C:G	donor_gain	0.2100
3:87990767:ATCT:A	acceptor_gain	0.2000
3:87990770:T:TA	acceptor_gain	0.2000

AlphaMissense

2395 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:87990955:A:C	D69A	1.000
3:87990955:A:T	D69V	1.000
3:87990954:G:C	D69H	0.999
3:87990955:A:G	D69G	0.999
3:87990956:T:A	D69E	0.999
3:87990956:T:G	D69E	0.999
3:87991016:G:C	W89C	0.999
3:87991016:G:T	W89C	0.999
3:87991111:G:C	R121P	0.999
3:87991191:T:A	W148R	0.999
3:87991191:T:C	W148R	0.999
3:87991317:T:C	F190L	0.999
3:87991319:C:A	F190L	0.999
3:87991319:C:G	F190L	0.999
3:87991653:T:C	F302L	0.999
3:87991655:T:A	F302L	0.999
3:87991655:T:G	F302L	0.999
3:87991665:T:A	W306R	0.999
3:87991665:T:C	W306R	0.999
3:87991780:C:A	P344Q	0.999
3:87990954:G:T	D69Y	0.998
3:87991014:T:A	W89R	0.998
3:87991014:T:C	W89R	0.998
3:87991036:G:A	C96Y	0.998
3:87991090:T:C	L114P	0.998
3:87991102:C:A	A118D	0.998
3:87991672:C:A	P308H	0.998
3:87991672:C:G	P308R	0.998
3:87991674:T:C	F309L	0.998
3:87991676:T:A	F309L	0.998

dbSNP variants (sampled 300 via entrez): RS1000019133 (3:87942757 G>C,T), RS1000024090 (3:87839097 T>C), RS1000026145 (3:87908320 T>G), RS1000039922 (3:87876372 CAAAGAAAATGTGAAAATGA>C), RS1000053512 (3:87866844 G>A,C,T), RS1000075923 (3:87914142 A>C), RS1000084321 (3:87850316 G>A,C), RS1000086884 (3:87845379 G>T), RS1000087970 (3:87941672 G>A), RS1000182481 (3:87964761 T>C), RS1000194674 (3:87798324 C>T), RS1000225760 (3:87798044 G>A,T), RS1000228267 (3:87827559 C>G,T), RS1000255957 (3:87970341 G>A,C,T), RS1000269343 (3:87928395 G>A,C)

Disease associations

OMIM: gene MIM:182134 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (6): CHEMBL1805 (SINGLE PROTEIN), CHEMBL2096904 (PROTEIN FAMILY), CHEMBL4523958 (SELECTIVITY GROUP), CHEMBL4523959 (SELECTIVITY GROUP), CHEMBL4523960 (SELECTIVITY GROUP), CHEMBL4524122 (PROTEIN FAMILY)

Molecules with ChEMBL bioactivity

5 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 265,565 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL128	SUMATRIPTAN	4	28,367
CHEMBL3039520	LASMIDITAN	4	550
CHEMBL11	IMIPRAMINE	4	48,893
CHEMBL39	SEROTONIN	3	186,160
CHEMBL7257	MEBUFOTENIN	2	1,595

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: gpcr — 5-Hydroxytryptamine receptors

Most potent curated ligand interactions (41 total), top 25:

Ligand	Action	Affinity	Parameter
[3H]LY334370	Full agonist	9.4	pKd
[125I]LSD	Agonist	9.0	pKd
BRL-54443	Full agonist	8.9	pKi
lasmiditan	Full agonist	8.7	pKi
LY334370	Full agonist	8.7	pKi
5-BODMT	Agonist	8.44	pKi
methysergide	Antagonist	8.2	pKi
naratriptan	Full agonist	8.2	pKi
LY344864	Full agonist	8.2	pKi
eletriptan	Full agonist	8.0	pKi
5-hydroxytryptamine	Full agonist	8.0	pKi
methylergonovine	Antagonist	7.5	pKi
zolmitriptan	Full agonist	7.5	pKi
5-MeO-DMT	Full agonist	7.4	pKi
1-naphthylpiperazine	Antagonist	7.3	pKi
GR 127935	Partial agonist	7.2	pKi
sumatriptan	Full agonist	7.2	pIC50
dihydroergotamine	Full agonist	7.1	pKi
yohimbine	Antagonist	7.0	pKi
clozapine	Full agonist	6.9	pKi
ergotamine	Full agonist	6.8	pKi
rizatriptan	Full agonist	6.8	pKi
α-methyl-5-HT	Full agonist	6.7	pKi
NAN 190	Partial agonist	6.7	pKi
metergoline	Antagonist	6.5	pKi

Binding affinities (BindingDB)

27 measured of 33 human assays (54 total across all organisms); most potent 27 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
METHIOTHEPIN	KI	1 nM
14C-5-hydroxy tryptamine creatinine disulfate	KI	1.2 nM
2-{4-[4-(2-Methoxy-phenyl)-piperazin-1-yl]-butyl}-isoindole-1,3-dione	KI	1.25 nM
4-[4-(4-Chloro-phenyl)-4-hydroxy-piperidin-1-yl]-1-(4-fluoro-phenyl)-butan-1-one;propionate(HCl)	KI	2.92 nM
8-[4-(4-fluorophenyl)-4-keto-butyl]-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one	KI	2.94 nM	US-9359372: Hexahydrodibenzo[a,g]quinolizine compound, preparation method thereof, pharmaceutical composition and use thereof
(S)-mianserin	KI	3 nM
4-[2-methyl-4-(5-methyl-1,2,4-oxadiazol-3-yl)phenyl]phenyl-1’-methylspiro[3,5,6,7-tetrahydro-2H-furo[2,3-f]indole-3,4’-(hexahydropyridine)]-5-ylmethanone	KI	6.91 nM
LY 246708	KI	50.1 nM
SMR001230745	KI	63.1 nM
Methylergometrine	KI	89 nM
5-HT,omega-N-Me	KI	120 nM
MESULERGINE	KI	195 nM
(R)-1-(2-(1-(3-bromo-benzenesulfonyl)-pyrrolidin-2-yl)-ethyl)-4-methyl piperidine	KI	398 nM
CAS_3292447	KI	501 nM
NSC_5311097	KI	549 nM
(R)-4-Methyl-1-(2-(1-(naphthalene-1-sulfonyl)-pyrrolidin-2-yl)-ethyl)-piperidine(10)	KI	1000 nM
(R)-4-Methyl-1-(2-(1-toluene-3-sulfonyl)-pyrrolidin-2-yl)-ethyl)-piperidine (Oxalate salt)	KI	1000 nM
1-[2-[4-[5-chloro-1-(4-fluorophenyl)-indol-3-yl]-1-piperidyl]ethyl]imidazolidin-2-one	KI	1050 nM
4-(3-CHLOROPHENYL)-ALPHA-(DIPHENYLMETHYL)-1-PIPERAZINEETHANOL HYDROCHLORIDE	KI	1260 nM
(R)-1-(2-(1-(3,4-Dichloro-benzene sulfonyl)-pyrrolidin-2-yl)-ethyl)-4-methyl piperidine	KI	1580 nM
(R)-4-Methyl-1-(2-(1-(naphthalene-1-sulfonyl)-piperidin-2-yl)-ethyl)-piperidine(5)	KI	1580 nM
CAS_1893-33-0	KI	2770 nM
BUTACLAMOL,d-	KI	2880 nM
[125I]2,5-dimethoxy-4-iodoamphetamine	KI	2970 nM
METERGOLINE	EC50	3520 nM
SB-258719	KI	5010 nM
Quinoline-4-carboxylic acid {4-[2-(6-cyano-3,4-dihydro-1H-isoquinolin-2-yl)-ethyl]-cyclohexyl}-amide	KI	6310 nM

ChEMBL bioactivities

170 potent at pChembl≥5 of 172 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
9.80	Kd	0.1585	nM	CHEMBL323208
9.49	IC50	0.32	nM	CHEMBL4851044
8.96	IC50	1.1	nM	IMIPRAMINE
8.96	Ki	1.1	nM	IMIPRAMINE
8.80	Ki	1.6	nM	CHEMBL128636
8.80	Ki	1.6	nM	CHEMBL101690
8.68	Ki	2.1	nM	CHEMBL101690
8.66	Ki	2.2	nM	CHEMBL361303
8.66	Ki	2.21	nM	LASMIDITAN
8.64	Ki	2.3	nM	CHEMBL173949
8.60	Ki	2.5	nM	CHEMBL323264
8.57	Ki	2.7	nM	CHEMBL606556
8.54	Ki	2.9	nM	CHEMBL369705
8.52	Ki	3	nM	CHEMBL177238
8.51	Ki	3.1	nM	CHEMBL177258
8.50	Ki	3.162	nM	CHEMBL432713
8.44	Ki	3.6	nM	CHEMBL187308
8.42	Ki	3.8	nM	CHEMBL102292
8.42	Ki	3.8	nM	CHEMBL421287
8.41	Ki	3.9	nM	CHEMBL184597
8.41	Ki	3.9	nM	CHEMBL92139
8.39	Ki	4.1	nM	CHEMBL104496
8.39	Ki	4.1	nM	CHEMBL365405
8.34	Ki	4.6	nM	CHEMBL102250
8.33	Ki	4.7	nM	CHEMBL105556
8.33	IC50	4.67	nM	CHEMBL4847626
8.32	Ki	4.8	nM	CHEMBL361061
8.30	Ki	5	nM	CHEMBL431041
8.29	Ki	5.1	nM	CHEMBL3617549
8.26	Ki	5.5	nM	CHEMBL105261
8.24	Ki	5.8	nM	CHEMBL449406
8.22	EC50	6	nM	CHEMBL339980
8.22	Ki	6	nM	CHEMBL1628565
8.20	Ki	6.3	nM	CHEMBL105722
8.20	IC50	6.36	nM	CHEMBL4846825
8.16	Ki	6.9	nM	CHEMBL105955
8.15	Ki	7.1	nM	CHEMBL321080
8.14	Ki	7.3	nM	CHEMBL105743
8.14	Ki	7.2	nM	CHEMBL104484
8.13	Ki	7.4	nM	CHEMBL104753
8.12	Ki	7.5	nM	CHEMBL319920
8.12	Ki	7.6	nM	CHEMBL103479
8.11	Ki	7.7	nM	CHEMBL104692
8.10	EC50	7.9	nM	SEROTONIN
8.09	Ki	8.2	nM	CHEMBL339980
8.09	Ki	8.2	nM	CHEMBL178066
8.08	Ki	8.4	nM	CHEMBL105958
8.08	Ki	8.3	nM	CHEMBL3617550
8.07	Ki	8.6	nM	CHEMBL187952
8.06	Ki	8.7	nM	CHEMBL420475

PubChem BioAssay actives

188 with measured affinity, of 428 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(4-oxo-2-azatricyclo[3.3.1.02,7]nonan-8-yl) 1H-indole-3-carboxylate	200911: Potency was evaluated on rabbit heart serotonergic receptors	kd	0.0002	uM
2,4,6-trifluoro-N-[6-[fluoro-(1-methylpiperidin-4-ylidene)methyl]-2-pyridinyl]benzamide	1771281: Binding affinity to human 5HT1F receptor	ic50	0.0003	uM
Imipramine	2198785: Inhibition of 5HT receptor (unknown origin)	ic50	0.0011	uM
4-fluoro-N-[3-(1-methylpiperidin-4-yl)-1H-indol-4-yl]benzamide	4982: Binding affinity towards human 5-hydroxytryptamine 1F receptor	ki	0.0016	uM
4-fluoro-N-[3-(1-methylpiperidin-4-yl)-1H-indol-5-yl]benzamide	404717: Binding affinity at human 5HT1F receptor	ki	0.0016	uM
Lasmiditan	1855157: Binding affinity to human 5-HT1F assessed as inhibition constant incubated for 10 mins by radioligand binding assay	ki	0.0022	uM
4-fluoro-N-[1-(1-methylpiperidin-4-yl)indol-6-yl]benzamide	238743: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0022	uM
2,4,6-trifluoro-N-[3-(1-methylpiperidin-4-yl)furo[3,2-b]pyridin-5-yl]benzamide	4985: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0023	uM
1-methyl-3-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]urea	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0025	uM
3-chloro-N-[3-[[(2R)-1-methylpyrrolidin-2-yl]methyl]-1H-indol-5-yl]benzenesulfonamide	239617: Inhibition of [3H]8-OH-DPAT binding to human 5-hydroxytryptamine 1F receptor expressed in CHO cells	ki	0.0027	uM
2-chloro-6-fluoro-N-[3-(1-methylpiperidin-4-yl)furo[3,2-b]pyridin-5-yl]benzamide	4985: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0029	uM
2-chloro-4-fluoro-N-[3-(1-methylpiperidin-4-yl)furo[3,2-b]pyridin-5-yl]benzamide	4985: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0030	uM
4-fluoro-N-[3-(1-methylpiperidin-4-yl)furo[3,2-b]pyridin-5-yl]benzamide	4985: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0031	uM
(E)-3-(3,4-dichlorophenyl)-N-[5-[4-(5-hydroxy-1H-indol-3-yl)piperidin-1-yl]pentyl]prop-2-enamide	4998: Binding affinity for 5-hydroxytryptamine 1F receptor was determined	ki	0.0032	uM
2-chloro-4-fluoro-N-[3-(1-methylpiperidin-4-yl)-1,2-benzoxazol-5-yl]benzamide	238743: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0036	uM
1-ethyl-3-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]urea	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0038	uM
N-[3-[2-(dimethylamino)ethyl]-1H-indol-4-yl]-4-fluorobenzamide	4982: Binding affinity towards human 5-hydroxytryptamine 1F receptor	ki	0.0038	uM
2-[1-(benzenesulfonyl)indol-4-yl]-N,N-dimethylethanamine	4980: Binding affinity against 5-hydroxytryptamine 1F receptor in CHO cells using [3H]5-HT radioligand	ki	0.0039	uM
4-fluoro-N-[3-(1-methylpiperidin-4-yl)-2H-indazol-5-yl]benzamide	238743: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0039	uM
2,4-dichloro-N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]benzamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0041	uM
4-fluoro-N-[1-(1-methylpiperidin-4-yl)indazol-6-yl]benzamide	238743: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0041	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]furan-3-carboxamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0046	uM
[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl] methanesulfonate	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0047	uM
2,4-difluoro-N-[6-[fluoro-(1-methylpiperidin-4-ylidene)methyl]-2-pyridinyl]benzamide	1771257: Agonist activity at 5HT1F receptor (unknown origin) expressed in HEK293 cells measured after 60 mins by Fluo-4AM dye based FLIPR assay	ic50	0.0047	uM
4-fluoro-N-[1-(1-methylpiperidin-4-yl)-2,3-dihydroindol-6-yl]benzamide	238743: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0048	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]acetamide	1855159: Binding affinity to 5-HT1F (unknown origin) assessed as inhibition constant	ki	0.0050	uM
4-fluoro-N-[3-(1-methylpiperidine-4-carbonyl)phenyl]benzamide	1246539: Binding affinity to human 5HT1F receptor by radioligand binding assay	ki	0.0051	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]propanamide	1855159: Binding affinity to 5-HT1F (unknown origin) assessed as inhibition constant	ki	0.0055	uM
3-methyl-N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]benzamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0058	uM
N-[3-[2-(dimethylamino)ethyl]-2-methyl-1H-indol-4-yl]-4-fluorobenzamide	4974: In vitro effective concentration for inhibition of skolin-stimulated adenylate cyclase in cell line expressing human 5-hydroxytryptamine 1F receptor	ec50	0.0060	uM
N-[(6R)-6-(dimethylamino)-6,7,8,9-tetrahydro-5H-carbazol-3-yl]-4-fluorobenzamide	1855158: Binding affinity to human 5-HT1F assessed as inhibition constant	ki	0.0060	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]pyridine-2-carboxamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0063	uM
4-fluoro-N-[6-[fluoro-(1-methylpiperidin-4-ylidene)methyl]-2-pyridinyl]benzamide	1771257: Agonist activity at 5HT1F receptor (unknown origin) expressed in HEK293 cells measured after 60 mins by Fluo-4AM dye based FLIPR assay	ic50	0.0064	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]butanamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0069	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]thiophene-2-carboxamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0071	uM
4-cyano-N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]benzamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0072	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]benzamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0073	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]thiophene-3-carboxamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0074	uM
[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl] 4-fluorobenzenesulfonate	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0075	uM
4-fluoro-N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]benzamide	4985: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0076	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]-4-nitrobenzamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0077	uM
Serotonin	4974: In vitro effective concentration for inhibition of skolin-stimulated adenylate cyclase in cell line expressing human 5-hydroxytryptamine 1F receptor	ec50	0.0079	uM
N-[3-[2-(dimethylamino)ethyl]-2-methyl-1H-indol-5-yl]-4-fluorobenzamide	1855159: Binding affinity to 5-HT1F (unknown origin) assessed as inhibition constant	ki	0.0082	uM
4-fluoro-N-[2-fluoro-3-(1-methylpiperidine-4-carbonyl)phenyl]benzamide	1246539: Binding affinity to human 5HT1F receptor by radioligand binding assay	ki	0.0083	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]pyridine-4-carboxamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0084	uM
4-fluoro-N-[3-(1-methylpiperidin-4-yl)-2,3-dihydro-1H-indol-5-yl]benzamide	238743: In vitro binding affinity for human 5-hydroxytryptamine 1F receptor	ki	0.0086	uM
N-[3-(1-methylpiperidin-4-yl)-1H-pyrrolo[3,2-b]pyridin-5-yl]cyclobutanecarboxamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0087	uM
4-fluoro-N-[6-(1-methylpiperidine-4-carbonyl)-2-pyridinyl]benzamide	1246539: Binding affinity to human 5HT1F receptor by radioligand binding assay	ki	0.0095	uM
4-fluoro-N-(3-piperidin-4-yl-1H-pyrrolo[3,2-b]pyridin-5-yl)benzamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0095	uM
N-[3-(1-methylpiperidin-4-yl)-1H-indol-5-yl]acetamide	4986: In vitro binding affinity was determined by radioligand binding assay using cell line expressing human 5-hydroxytryptamine 1F receptor	ki	0.0097	uM

CTD chemical–gene interactions

11 total (human), top 11 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases expression	1
butyraldehyde	decreases expression	1
Benzo(a)pyrene	increases methylation, affects methylation	1
Cadmium	decreases expression, increases abundance	1
Estradiol	decreases expression	1
Serotonin	affects binding, decreases reaction, increases activity	1
Cyclosporine	increases expression	1
Cadmium Chloride	decreases expression, increases abundance	1
Okadaic Acid	decreases expression	1
Lactic Acid	increases expression	1
Endocannabinoids	decreases reaction, increases activity, affects binding	1

ChEMBL screening assays

104 unique, capped per target: 70 binding, 33 functional, 1 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1009494	Binding	Binding affinity to 5HT1F receptor	Urotensin-II receptor antagonists: synthesis and SAR of N-cyclic azaalkyl benzamides. — Bioorg Med Chem Lett
CHEMBL3618911	Functional	Agonist activity at human 5HT1F receptor expressed in LM(tk-) cells by [35S]GTPgammaS binding assay	Discovery of selective N-[3-(1-methyl-piperidine-4-carbonyl)-phenyl]-benzamide-based 5-HT₁ F receptor agonists: Evolution from bicyclic to monocyclic cores. — Bioorg Med Chem Lett
CHEMBL4413391	ADMET	Antagonist activity at serotonin receptor in human PBMC assessed as inhibition of PMA-stimulated superoxide anion generation at 10 uM preincubated for 1 hr followed by PMA-stimulation and measured after 30 mins by spectrophotometric method	Identification of a novel DGKα inhibitor for XLP-1 therapy by virtual screening. — Eur J Med Chem

Cellosaurus cell lines

3 cell lines: 1 transformed cell line, 1 spontaneously immortalized cell line, 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_C0SY	ACTOne HTR1F	Transformed cell line	Female
CVCL_KV40	cAMP Hunter CHO-K1 HTR1F Gi	Spontaneously immortalized cell line	Female
CVCL_LA54	PathHunter U2OS HTR1F beta-arrestin	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.