HTT

Summary

HTT (huntingtin, HGNC:4851) is a protein-coding gene on chromosome 4p16.3, encoding Huntingtin (P42858). May play a role in microtubule-mediated transport or vesicle function.

Huntingtin is a disease gene linked to Huntington’s disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington’s disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5’ UTR that inhibits expression of the huntingtin gene product through translational repression.

Source: NCBI Gene 3064 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Huntington disease (Definitive, ClinGen) — +2 more curated relationships
• Clinical variants (ClinVar): 885 total — 6 pathogenic, 8 likely-pathogenic (top 4% of genes corpus-wide)
• Expression (HPA): Group enriched — highest in median raphe nucleus, dorsal raphe nucleus, pontine raphe nucleus
• GTEx eGene: eQTL in 24 tissues, sQTL in 15 (q < 0.05)
• Drug target: yes — 1 curated mechanism-of-action drug; 165 molecules with ChEMBL bioactivity (top 1% of genes corpus-wide)
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.35 (moderately constrained)
• MANE Select transcript: NM_001388492
• Interaction hub: 4,334 STRING partners (top 1% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:4851
Approved symbol	HTT
Name	huntingtin
Location	4p16.3
Locus type	gene with protein product
Status	Approved
Aliases	IT15
Ensembl gene	ENSG00000197386
Ensembl biotype	protein_coding
OMIM	613004
Entrez	3064

Gene structure

Transcript identifiers

Ensembl transcripts: 24 — 10 retained_intron, 6 protein_coding, 4 protein_coding_CDS_not_defined, 4 nonsense_mediated_decay

MANE Select: ENST00000355072

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 3, TSL 3: 6, TSL 5: 1

ENST00000355072, ENST00000506137, ENST00000508321, ENST00000509043, ENST00000509618, ENST00000509751, ENST00000510626, ENST00000512068, ENST00000512909, ENST00000513326, ENST00000513639, ENST00000513806, ENST00000647962, ENST00000648150, ENST00000649131, ENST00000649900, ENST00000650588, ENST00000650595, ENST00000680239, ENST00000680291, ENST00000680360, ENST00000680956, ENST00000681528, ENST00001118545

RefSeq mRNA: 2 — MANE Select: NM_001388492 NM_001388492, NM_002111

CCDS: CCDS43206

Canonical transcript exons

ENST00000355072 — 67 exons

Exon	Start	End
ENSE00000854943	3086939	3087022
ENSE00000854944	3099274	3099394
ENSE00000854945	3103824	3103883
ENSE00000854946	3105357	3105436
ENSE00000854947	3107285	3107423
ENSE00000854948	3115304	3115445
ENSE00000854953	3125549	3125629
ENSE00000854954	3127264	3127604
ENSE00000854955	3129924	3130047
ENSE00000854956	3130305	3130423
ENSE00000854981	3187651	3187886
ENSE00000854982	3188951	3189093
ENSE00000854987	3207281	3207357
ENSE00000854988	3208773	3208911
ENSE00001251499	3074681	3075088
ENSE00001506818	3122889	3122936
ENSE00001506819	3121228	3121432
ENSE00003460831	3154293	3154419
ENSE00003467481	3235565	3235778
ENSE00003472889	3209827	3209949
ENSE00003475088	3131638	3131775
ENSE00003476697	3225661	3225743
ENSE00003479441	3211929	3212142
ENSE00003490959	3222387	3222487
ENSE00003494967	3116085	3116263
ENSE00003501297	3236149	3236254
ENSE00003503216	3228880	3229009
ENSE00003512853	3148005	3148207
ENSE00003512984	3212564	3212709
ENSE00003522087	3174721	3174799
ENSE00003522768	3177332	3177387
ENSE00003543993	3223406	3223560
ENSE00003548126	3238818	3238978
ENSE00003558932	3172320	3172397
ENSE00003559384	3204007	3204148
ENSE00003571103	3132562	3132720
ENSE00003574493	3180515	3180651
ENSE00003581669	3186597	3186719
ENSE00003584863	3145152	3145228
ENSE00003589182	3233163	3233353
ENSE00003596776	3206496	3206675
ENSE00003597650	3160282	3160392
ENSE00003603422	3217765	3217952
ENSE00003607438	3136226	3136326
ENSE00003613725	3199732	3199939
ENSE00003615800	3182354	3182470
ENSE00003620583	3146797	3146948
ENSE00003635707	3140510	3140656
ENSE00003639044	3215110	3215211
ENSE00003644432	3228615	3228745
ENSE00003648724	3132814	3132911
ENSE00003651248	3223992	3224131
ENSE00003657059	3135904	3135967
ENSE00003658160	3157072	3157199
ENSE00003658909	3142766	3142886
ENSE00003659509	3172908	3173131
ENSE00003665848	3178298	3178446
ENSE00003669528	3220182	3220308
ENSE00003671014	3174946	3175107
ENSE00003673769	3134401	3134540
ENSE00003678629	3238447	3238609
ENSE00003679310	3213958	3214135
ENSE00003681950	3131286	3131397
ENSE00003685801	3229887	3230042
ENSE00003689364	3206807	3206983
ENSE00003691918	3235284	3235398
ENSE00004783037	3239846	3243957

Expression profiles

Bgee: expression breadth ubiquitous, 208 present calls, max score 95.04.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 31.8293 / max 398.7661, expressed in 1820 samples.

Highest expression (Bgee): sural nerve, body of pancreas, colonic epithelium, granulocyte, adrenal tissue.

Genetic regulation across tissues (GTEx eQTL / sQTL)

HTT is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 24 tissues and its splicing (sQTL) in 15 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 39 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Skin Sun Exposed Lower leg	sqtl	3.1e-42	-2.83	4:3223039:A:G
Adipose Subcutaneous	sqtl	1.7e-33	-2.44	4:3223355:G:C
Nerve Tibial	sqtl	2.1e-25	-2.19	4:3223039:A:G
Muscle Skeletal	eqtl	1.2e-22	+1.45	4:3132744:G:A
Lung	sqtl	1.8e-18	-2.11	4:3223039:A:G
Cells EBV-transformed lymphocytes	sqtl	5.0e-18	-1.74	4:3077868:TAACA:T
Whole Blood	eqtl	4.4e-15	+0.14	4:3041785:C:G
Skin Not Sun Exposed Suprapubic	sqtl	4.2e-14	-1.88	4:3223039:A:G
Testis	sqtl	2.3e-12	-0.70	4:3223644:A:C
Nerve Tibial	eqtl	1.4e-09	+0.17	4:3041458:A:G
Testis	eqtl	1.3e-08	+0.43	4:3082156:A:T
Small Intestine Terminal Ileum	sqtl	4.0e-05	-1.76	4:3079002:C:T
Cells Cultured fibroblasts	eqtl	4.7e-05	-0.56	4:3011685:C:T
Adipose Subcutaneous	eqtl	1.6e-04	+0.61	4:3691195:T:A
Brain Cerebellum	sqtl	1.0e-03	-1.88	4:3011685:C:T
Brain Caudate basal ganglia	eqtl	1.2e-03	-0.23	4:3563897:G:C
Lung	eqtl	1.4e-03	+0.12	4:3040883:G:GCGTGCTGGGGTGCCCAGGTGTGGGCGCCTTC
Brain Cerebellar Hemisphere	sqtl	1.4e-03	-1.93	4:3011685:C:T
Thyroid	eqtl	2.7e-03	+0.20	4:3136793:G:A
Cells EBV-transformed lymphocytes	eqtl	3.1e-03	-0.17	4:2763976:A:G

FANTOM5 promoters

1 alternative TSS:

Promoter ID	TPM avg	Samples expressed
46672	31.8293	1820

Top tissues by expression

showing 100 of 270 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
sural nerve	UBERON:0015488	95.04	gold quality
body of pancreas	UBERON:0001150	92.59	gold quality
colonic epithelium	UBERON:0000397	91.95	gold quality
granulocyte	CL:0000094	91.03	gold quality
adrenal tissue	UBERON:0018303	90.74	gold quality
stromal cell of endometrium	CL:0002255	90.59	gold quality
calcaneal tendon	UBERON:0003701	90.29	gold quality
pancreas	UBERON:0001264	90.21	gold quality
ventricular zone	UBERON:0003053	90.06	gold quality
hindlimb stylopod muscle	UBERON:0004252	89.58	gold quality
cortical plate	UBERON:0005343	89.53	gold quality
skin of leg	UBERON:0001511	89.42	gold quality
skin of abdomen	UBERON:0001416	88.69	gold quality
right frontal lobe	UBERON:0002810	88.26	gold quality
islet of Langerhans	UBERON:0000006	88.10	gold quality
prefrontal cortex	UBERON:0000451	87.99	gold quality
right hemisphere of cerebellum	UBERON:0014890	87.86	gold quality
gastrocnemius	UBERON:0001388	87.85	gold quality
muscle of leg	UBERON:0001383	87.73	gold quality
cerebellar hemisphere	UBERON:0002245	87.54	gold quality
cerebellar cortex	UBERON:0002129	87.52	gold quality
upper lobe of left lung	UBERON:0008952	87.21	gold quality
anterior cingulate cortex	UBERON:0009835	87.07	gold quality
ganglionic eminence	UBERON:0004023	87.02	gold quality
cingulate cortex	UBERON:0003027	86.99	gold quality
leukocyte	CL:0000738	86.96	gold quality
bone marrow cell	CL:0002092	86.94	gold quality
left lobe of thyroid gland	UBERON:0001120	86.90	gold quality
monocyte	CL:0000576	86.80	gold quality
right lobe of thyroid gland	UBERON:0001119	86.75	gold quality
mononuclear cell	CL:0000842	86.65	gold quality
zone of skin	UBERON:0000014	86.61	gold quality
corpus callosum	UBERON:0002336	86.57	gold quality
right lung	UBERON:0002167	86.51	gold quality
mucosa of stomach	UBERON:0001199	86.48	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	86.35	gold quality
tibial nerve	UBERON:0001323	86.28	gold quality
tonsil	UBERON:0002372	86.24	gold quality
upper lobe of lung	UBERON:0008948	86.24	gold quality
cerebellum	UBERON:0002037	85.90	gold quality
thyroid gland	UBERON:0002046	85.81	gold quality
adrenal gland	UBERON:0002369	85.78	gold quality
left adrenal gland cortex	UBERON:0035825	85.65	gold quality
left adrenal gland	UBERON:0001234	85.63	gold quality
right adrenal gland	UBERON:0001233	85.62	gold quality
small intestine Peyer’s patch	UBERON:0003454	85.54	gold quality
right adrenal gland cortex	UBERON:0035827	85.53	gold quality
esophagus mucosa	UBERON:0002469	85.51	gold quality
stomach	UBERON:0000945	85.49	gold quality
right uterine tube	UBERON:0001302	85.42	gold quality
esophagus	UBERON:0001043	85.40	gold quality
body of stomach	UBERON:0001161	85.24	gold quality
spleen	UBERON:0002106	85.24	gold quality
neocortex	UBERON:0001950	85.14	gold quality
lymph node	UBERON:0000029	85.09	gold quality
lower esophagus	UBERON:0013473	85.03	gold quality
lower esophagus muscularis layer	UBERON:0035833	85.03	gold quality
metanephros cortex	UBERON:0010533	85.00	gold quality
adenohypophysis	UBERON:0002196	84.98	gold quality
ectocervix	UBERON:0012249	84.97	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	84.89	gold quality
frontal cortex	UBERON:0001870	84.88	gold quality
Brodmann (1909) area 9	UBERON:0013540	84.76	gold quality
adrenal cortex	UBERON:0001235	84.64	gold quality
small intestine	UBERON:0002108	84.61	gold quality
body of uterus	UBERON:0009853	84.61	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	84.50	gold quality
lower esophagus mucosa	UBERON:0035834	84.47	gold quality
popliteal artery	UBERON:0002250	84.45	gold quality
tibial artery	UBERON:0007610	84.44	gold quality
amygdala	UBERON:0001876	84.38	gold quality
right ovary	UBERON:0002118	84.36	gold quality
left ovary	UBERON:0002119	84.35	gold quality
ascending aorta	UBERON:0001496	84.32	gold quality
aorta	UBERON:0000947	84.30	gold quality
thoracic aorta	UBERON:0001515	84.29	gold quality
left testis	UBERON:0004533	84.21	gold quality
minor salivary gland	UBERON:0001830	84.03	gold quality
descending thoracic aorta	UBERON:0002345	84.01	gold quality
transverse colon	UBERON:0001157	84.00	gold quality
tendon	UBERON:0000043	83.92	gold quality
right testis	UBERON:0004534	83.83	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	83.79	gold quality
pituitary gland	UBERON:0000007	83.71	gold quality
muscle organ	UBERON:0001630	83.65	gold quality
apex of heart	UBERON:0002098	83.50	gold quality
left coronary artery	UBERON:0001626	83.47	gold quality
nucleus accumbens	UBERON:0001882	83.46	gold quality
subcutaneous adipose tissue	UBERON:0002190	83.30	gold quality
vermiform appendix	UBERON:0001154	83.26	gold quality
muscle layer of sigmoid colon	UBERON:0035805	83.26	gold quality
rectum	UBERON:0001052	83.18	gold quality
right lobe of liver	UBERON:0001114	83.12	gold quality
caudate nucleus	UBERON:0001873	83.12	gold quality
omental fat pad	UBERON:0010414	83.07	gold quality
peritoneum	UBERON:0002358	83.03	gold quality
embryo	UBERON:0000922	82.90	gold quality
cerebral cortex	UBERON:0000956	82.85	gold quality
mouth mucosa	UBERON:0003729	82.83	gold quality
testis	UBERON:0000473	82.79	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	9.89

HPA expression

RNA tissue specificity: Group enriched

showing 60 of 139 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Hippocampus	tissue	54.3	medium
Periaqueductal gray	tissue	51.2
Postcentral gyrus	tissue	49.7
Choroid plexus	tissue	41.5
Pons	tissue	38.2
Small intestine	tissue	38.0	not detected
Locus coeruleus	tissue	35.9
Nucleus accumbens	tissue	34.9
Cerebral cortex	tissue	31.2	high
Somatosensory cortex	tissue	31.2
Insular cortex	tissue	29.7
Hippocampal formation	tissue	28.5
Entorhinal cortex	tissue	28.5
Motor cortex	tissue	28.4
Prefrontal cortex	tissue	27.9
Temporal cortex	tissue	27.9
Occipital cortex	tissue	27.8
Lung	tissue	27.2	not detected
Retrosplenial and cingulate cortex	tissue	25.5
Retrosplenial cortex	tissue	24.7
Amygdala	tissue	23.5
Caudate putamen	tissue	23.0
Thalamus	tissue	22.2
Frontal cortex	tissue	22.1
Putamen	tissue	22.1
Basal ganglia	tissue	21.5	medium
Ventral forebrain	tissue	20.6
Superior colliculi	tissue	20.4
Midbrain	tissue	19.5
Cerebellum	tissue	19.5	high
Pons	tissue	19.2
Olfactory bulb	tissue	18.9
Placenta	tissue	17.3	low
Substantia nigra	tissue	17.2
Septum	tissue	16.7
Medulla oblongata	tissue	15.6
Hypothalamus	tissue	15.5
Corpus callosum	tissue	15.5
Skin 1	tissue	14.3	high
Spinal cord	tissue	13.4
Periaqueductal gray	tissue	13.3
Tongue	tissue	11.6
Parathyroid gland	tissue	11.5	high
Pancreas	tissue	11.5	medium
Locus coeruleus	tissue	11.3
Lymph node	tissue	10.8	low
Thymus	tissue	10.6
Duodenum	tissue	9.7	not detected
Skeletal muscle	tissue	9.6	medium
Retina	tissue	9.5
Esophagus	tissue	8.6	high
Pituitary gland	tissue	8.4
Lung	tissue	8.4	medium
Spleen	tissue	8.3	low
Tonsil	tissue	8.3	high
Testis	tissue	7.9	high
Epididymis	tissue	7.8	high
Appendix	tissue	7.8	medium
Bone marrow	tissue	7.7	low
Colon	tissue	7.5	high

Brain sub-regions (HPA Brain Atlas): detected in 383; highest nTPM — Median raphe nucleus (507.8), Dorsal raphe nucleus (311.8), Pontine raphe nucleus (183.3), Hippocampus, CA1 (58.4), Perirhinal gyrus (58.4).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting HTT by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 140 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-4713-3P	100.00	65.92	505
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-22-3P	99.93	68.13	917
HSA-MIR-4753-3P	99.90	71.03	3786
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-4779	99.86	66.50	1583
HSA-MIR-8073	99.86	65.21	1118
HSA-MIR-221-5P	99.86	65.45	1052

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.353, missense Z 3.72 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000355072 splits into 4 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
4:3,074,826–3,074,916	12 / 30.3	0.40	no
4:3,074,917–3,212,068	2316 / 2658.5	0.87	no
4:3,212,069–3,217,804	220 / 218.5	1.01	no
4:3,217,805–3,240,056	753 / 1021.3	0.74	no

Literature-anchored findings (GeneRIF, showing 40)

• wild type huntingtin reduces the cellular toxicity of mutant huntingtin in mammalian cell models of Huntington’s disease (PMID:11432963)
• Normal huntingtin has an important role in neuronal cell survival, and loss of function of the normal protein may contribute to HD as well as gain of function of the abnormal huntingtin. (PMID:11642542)
• In human fibroblasts from normal and HD patients, huntingtin localized diffusely in the nucleus and in subnuclear compartments identified as speckles, promyelocytic leukemia protein bodies, and nucleoli (PMID:11739372)
• Effects of intracellular expression of anti-huntingtin antibodies of various specificities on mutant huntingtin aggregation and toxicity. (PMID:11792860)
• arfaptin 2 is involved in regulating huntingtin protein aggregation (PMID:11854752)
• Huntingtin is found in the perinuclear region along with microtubules, and in the centrosomal region along with gamma-tubulin. Inclusions are found in perinuclear locations because the beta-tubulin binding property of huntingtin brings it there. (PMID:11870213)
• These results suggest that medium-sized spiny striatal neurons are more vulnerable to NR2B-subtype NMDAR-mediated cell death in a transgenic mouse model of HD expressing full-length mutant huntingtin, compared with wild-type mice. (PMID:11906693)
• findings suggest that altered gene expression may result from the interactions of soluble mutant huntingtin with nuclear transcription factors, rather than from the depletion of transcription factors by nuclear inclusions (PMID:11971872)
• huntingtin interacts with Sp1 and TAFII130; transcriptional activity of SP1 and TAFII130 disrupted in early Huntingtin’s Disease (PMID:11988536)
• mutant huntingtin containing an expanded polyglutamine stretch induces neuronal death. (PMID:12062094)
• Impaired glutamate transport and glutamate-glutamine cycling: downstream effects of the Huntington mutation in transgenic mice (PMID:12135980)
• Proteases acting on mutant huntingtin generate cleaved products that differentially build up cytoplasmic and nuclear inclusions. (PMID:12191472)
• An upstream open reading frame impedes translation of the huntingtin gene (PMID:12466534)
• Role of huntingtin in human health and disease [review] (PMID:12569151)
• Context-dependent neurodegeneration in huntington disease may be mediated by different N-terminal huntingtin fragments (PMID:12657678)
• In cases where the mother is known to be not a carrier, early Huntington disease prenatal diagnosis is possible by semiquantitative fluorescent-PCR of trace fetal dna in maternal blood samples (PMID:12682342)
• may function as a transcriptional coactivator of nuclear hormone receptors. (PMID:12799135)
• HD mutation is accompanied by a dramatic decline in Ca2+-triggered exocytosis of neurotransmitter and the decline in neurotransmitter release is a direct consequence of complexin II depletion. (PMID:12807877)
• polyglutamine-expanded huntingtin induces tyrosine phosphorylation of N-methyl-D-aspartate receptors (PMID:12810713)
• Huntingtin and huntingtin-associated protein 1 influence neuronal calcium signaling mediated by inositol-(1,4,5) triphosphate receptor type 1. (PMID:12873381)
• Regulated expression of huntingtin (Huntington disease) induced reversible striatal neuropathology typical for Huntington disease. (PMID:12952868)
• theories differ with respect to subcellular distribution of HD at initiation of toxicity in Huntington’s diease: nuclear if cleaved and cytoplasmic in the absence of cleavage (PMID:14527999)
• Here we show dramatic mutation length increases (gains of up to 1000 CAG repeats) in human striatal cells early in the disease course, most likely before the onset of pathological cell loss. (PMID:14570710)
• huntingtin has a role in regulating cysteine string protein inhibition of N-type calcium channels (PMID:14570907)
• modeling framework based on a key analogy of the physicochemical properties of the huntingtin exon1 fragment to block copolymers (PMID:14617779)
• genome-wide screens were performed in yeast to identify genes that enhance the toxicity of mutant huntingtin;the genes clustered in the functionally related cellular processes of response to stress, protein folding & ubiquitin-dependent protein catabolism (PMID:14657499)
• A patient with triosephosphate isomerase (TPI) deficiency exhibited worsening of abnormal involuntary movements of the dystonic type and developed psychiatric symptoms while on selegiline. (PMID:14743370)
• Nonnuclear events induced by cytoplasmic huntingtin aggregation play a central role in the progressive neurodegeneration observed in Huntington’s disease. (PMID:14978262)
• Inhibiting the interaction of calmodulin with transglutaminase and huntingtin protein could decrease cross-linking and diminish huntingtin aggregate formation in the HD brain (PMID:14985437)
• Rapid clearance through the ubiquitin-proteasome pathway slows huntingtin aggregate formation, yet increases cellular toxicity. Polyglutamine neurotoxicity may be triggered by non-aggregated protein and aggregate formation may be a defense mechanism (PMID:15140195)
• Our findings using htt exon 1 suggest that the process of mutant htt aggregation rather than the resulting inclusion body is critical for neuronal cell death (PMID:15140196)
• the mutant huntingtin protein significantly decreased the Ca2+ threshold necessary to trigger MPT pore opening which accompanied by a significant release of cytochrome c (PMID:15163634)
• Causes huntingti0n disase when transfected into mice. (PMID:15240759)
• In Huntington’s disease, expansion occurs in the huntingtin protein. (review) (PMID:15261377)
• Time course of striatal degeneration produced by expanded huntingtin (Exp-Htt)occurs rapidly: at 48 h post-transfection, 60% of cultured striatal neurons expressing Exp-Htt have apoptotic characteristics including fragmented DNA and neuritic retraction. (PMID:15312898)
• unusual infantile onset of the disease in a little girl who presented with a history of seizures and psychomotor regression starting at the age of 3 years (PMID:15338298)
• is involved in fast axonal trafficking (PMID:15340079)
• siRNA is not directly linked to DNA methylation at the target huntingtin genomic locus in human cells (PMID:15351733)
• Growing evidence discussed in this review suggests that mutant huntingtin mediates multiple pathological pathways causing selective neurodegeneration in brains of Huntington’s disease patients. (PMID:15359012)
• Here we report the purification of huntingtin aggregates from postmortem Huntington’s disease brains. (PMID:15496672)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	htt	ENSDARG00000052866
mus_musculus	Htt	ENSMUSG00000029104
rattus_norvegicus	Htt	ENSRNOG00000011073
drosophila_melanogaster	htt	FBGN0027655
caenorhabditis_elegans		WBGENE00009027

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:96067) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 146 distinct phenotype terms.

Mouse phenotype (MP)	Records
decreased locomotor activity	7
abnormal striatum morphology	7
abnormal gait	6
limb grasping	6
impaired coordination	5
tremors	4
abnormal cerebral cortex morphology	4
decreased body weight	4
abnormal motor capabilities/coordination/movement	4
weight loss	3
decreased body size	3
hyperactivity	3
short stride length	3
premature death	3
abnormal embryonic tissue morphology	3
abnormal extraembryonic tissue morphology	3
gliosis	3
astrocytosis	3
neuronal intranuclear inclusions	3
abnormal brain ventricle morphology	2
abnormal motor coordination/balance	2
decreased embryo size	2
embryonic growth arrest	2
neurodegeneration	2
tonic-clonic seizures	2

+121 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Takifugu rubripes	P51112	69.8%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
HTT-AS	ncRNA	100750326
MSANTD1	protein-coding	345222
RGS12	protein-coding	6002
HGFAC	protein-coding	3083
GRK4	protein-coding	2868
NOP14-AS1	ncRNA	317648
NOP14	protein-coding	8602
DOK7	protein-coding	285489

Protein

Protein identifiers

Huntingtin — P42858 (reviewed: P42858)

Alternative names: Huntington disease protein

All UniProt accessions (8): A0A3B3ISR3, A0A3B3IU25, A0A7P0TA78, A0A7P0TAC5, A0A7P0TAN5, A0A7P0Z417, H0YA07, P42858

UniProt curated annotations — full annotation on UniProt →

Function. May play a role in microtubule-mediated transport or vesicle function. Promotes the formation of autophagic vesicles.

Subunit / interactions. Interacts with PFN1. Interacts through its N-terminus with PRPF40A. Interacts with PQBP1. Interacts with SETD2. Interacts with SH3GLB1. Interacts with SYVN. Interacts with TPR; the interaction is inhibited by forms of Huntingtin with expanded polyglutamine stretch. Interacts with ZDHHC13 (via ANK repeats). Interacts with ZDHHC17 (via ANK repeats). Interacts with F8A1/F8A2/F8A3. Found in a complex with F8A1/F8A2/F8A3, HTT and RAB5A; mediates the recruitment of HTT by RAB5A.

Subcellular location. Cytoplasm. Nucleus. Early endosome Cytoplasmic vesicle. Autophagosome.

Tissue specificity. Expressed in the brain cortex (at protein level). Widely expressed with the highest level of expression in the brain (nerve fibers, varicosities, and nerve endings). In the brain, the regions where it can be mainly found are the cerebellar cortex, the neocortex, the striatum, and the hippocampal formation.

Post-translational modifications. Cleaved by caspases downstream of the polyglutamine stretch. The resulting N-terminal fragments are cytotoxic and provokes apoptosis. Forms with expanded polyglutamine expansion are specifically ubiquitinated by SYVN1, which promotes their proteasomal degradation. Phosphorylation at Ser-1179 and Ser-1199 by CDK5 in response to DNA damage in nuclei of neurons protects neurons against polyglutamine expansion as well as DNA damage mediated toxicity. Myristoylated at Gly-551, following proteolytic cleavage at Asp-550.

Disease relevance. Huntington disease (HD) [MIM:143100] A neurodegenerative disorder characterized by involuntary movements (chorea), general motor impairment, psychiatric disorders and dementia. Onset of the disease occurs usually in the third or fourth decade of life. Onset and clinical course depend on the degree of poly-Gln repeat expansion, longer expansions resulting in earlier onset and more severe clinical manifestations. Neuropathology of Huntington disease displays a distinctive pattern with loss of neurons, especially in the caudate and putamen. The disease is caused by variants affecting the gene represented in this entry. Lopes-Maciel-Rodan syndrome (LOMARS) [MIM:617435] An autosomal recessive neurodevelopmental disorder characterized by developmental regression in infancy, delayed psychomotor development, severe intellectual disability, and cerebral and cerebellar atrophy. Additional features include swallowing problems, dystonia, bradykinesia, and continuous manual stereotypies without chorea. Some patients manifest seizures. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The N-terminal Gln-rich and Pro-rich domain has great conformational flexibility and is likely to exist in a fluctuating equilibrium of alpha-helical, random coil, and extended conformations.

Polymorphism. The poly-Gln region of HTT is highly polymorphic (10 to 35 repeats) in the normal population and is expanded to about 36-120 repeats in Huntington disease patients. The repeat length usually increases in successive generations, but also contracts on occasion. The adjacent poly-Pro region is also polymorphic and varies between 7-12 residues. Polyglutamine expansion leads to elevated susceptibility to apopain cleavage and likely result in accelerated neuronal apoptosis.

Similarity. Belongs to the huntingtin family.

RefSeq proteins (2): NP_001375421, NP_002102 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000091	Huntingtin	Family
IPR011989	ARM-like	Homologous_superfamily
IPR016024	ARM-type_fold	Homologous_superfamily
IPR024613	Huntingtin_N_HEAT_rpt-2	Repeat
IPR028426	Huntingtin_fam	Family
IPR048411	Htt_N_HEAT_rpt-1	Repeat
IPR048412	Htt_bridge	Repeat
IPR048413	Htt_C-HEAT_rpt	Repeat

Pfam: PF12372, PF20925, PF20926, PF20927

UniProt features (279 total): helix 159, turn 27, strand 24, modified residue 15, sequence variant 15, mutagenesis site 10, region of interest 8, compositionally biased region 6, repeat 5, site 5, chain 2, short sequence motif 1, lipid moiety-binding region 1, sequence conflict 1

Structure

Experimental structures (PDB)

showing 30 of 31 structures by resolution:

PDB	Title	Method	Resolution (Å)
9PMW	Structure of HTTQ23-HAP40 complex bound to macrocycles HHL1, HD4 and HL2	ELECTRON MICROSCOPY	2.1
9YR6	Structure of HTTQ23-HAP40 complex bound to a small molecule ligand	ELECTRON MICROSCOPY	2.3
9PN0	Structure of HTTQ23-HAP40 complex bound to macrocycles HHD3, HD4 and HL2	ELECTRON MICROSCOPY	2.3
4RAV	Crystal structure of scFvC4 in complex with the first 17 AA of huntingtin	X-RAY DIFFRACTION	2.5
3LRH	Structure of anti-huntingtin VL domain in complex with huntingtin peptide	X-RAY DIFFRACTION	2.6
6X9O	High resolution cryoEM structure of huntingtin in complex with HAP40	ELECTRON MICROSCOPY	2.6
8VLX	HTT in complex with HAP40 and a small molecule.	ELECTRON MICROSCOPY	2.6
8W15	HTT in complex with HAP40 in the apo state.	ELECTRON MICROSCOPY	2.72
4FEB	Crystal Structure of Htt36Q3H-EX1-X1-C2(Beta)	X-RAY DIFFRACTION	2.8
4FED	Crystal Structure of Htt36Q3H	X-RAY DIFFRACTION	2.81
4FE8	Crystal Structure of Htt36Q3H-EX1-X1-C1(Alpha)	X-RAY DIFFRACTION	3
4FEC	Crystal Structure of Htt36Q3H	X-RAY DIFFRACTION	3
8SAH	Huntingtin C-HEAT domain in complex with HAP40	ELECTRON MICROSCOPY	3.2
8R2O	Huntingtin-Q17, 1-66, N-MBP fusion	X-RAY DIFFRACTION	3.23
3IOT	Huntingtin amino-terminal region with 17 Gln residues - crystal C92-b	X-RAY DIFFRACTION	3.5
3IOW	Huntingtin amino-terminal region with 17 Gln residues - crystal C99-Hg	X-RAY DIFFRACTION	3.5
3IOR	Huntingtin amino-terminal region with 17 Gln residues - crystal C95	X-RAY DIFFRACTION	3.6
7DXJ	Human 46QHuntingtin-HAP40 complex structure	ELECTRON MICROSCOPY	3.6
3IO4	Huntingtin amino-terminal region with 17 Gln residues - Crystal C90	X-RAY DIFFRACTION	3.63
3IO6	Huntingtin amino-terminal region with 17 Gln residues - crystal C92-a	X-RAY DIFFRACTION	3.7
3IOU	Huntingtin amino-terminal region with 17 Gln residues - crystal C94	X-RAY DIFFRACTION	3.7
3IOV	Huntingtin amino-terminal region with 17 Gln residues - crystal C99	X-RAY DIFFRACTION	3.7
6EZ8	Human Huntingtin-HAP40 complex structure	ELECTRON MICROSCOPY	4
7DXK	Human 128QHuntingtin-HAP40 complex structure	ELECTRON MICROSCOPY	4.1
6RMH	The Rigid-body refined model of the normal Huntingtin.	ELECTRON MICROSCOPY	9.6
8YAE	Cryo-ET structure of huntingtin actin complex	ELECTRON MICROSCOPY	10.08
6YEJ	Cryo-EM structure of the Full-length disease type human Huntingtin	ELECTRON MICROSCOPY	18.2
8YAO	Cryo-ET structure of huntingtin actin dimer complex	ELECTRON MICROSCOPY	20.8
2LD0	Solution structure of the N-terminal domain of huntingtin (htt17) in 50 % TFE	SOLUTION NMR
2LD2	Solution structure of the N-terminal domain of huntingtin (htt17) in presence of DPC …	SOLUTION NMR

Predicted structure (AlphaFold)

No AlphaFold model available for P42858 — AlphaFold DB does not currently provide models for proteins above ~3000 aa.

Antibody-complex structures (SAbDab)

2 antibodies co-crystallized with this protein: 3LRH, 4RAV

Human Protein Atlas

Protein class: Metabolic proteins, Transporters, Electrochemical Potential-driven transporters, Predicted membrane proteins, FDA approved drug targets, Small molecule drugs, Human disease related genes, Mental and behavioural disorders

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): golgi apparatus; vesicles

Antibody reliability (HPA): IH supported · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (5)

Position	Role
511–512	cleavage; by caspase-3
528–529	cleavage; by caspase-3
550–551	cleavage; by caspase-3
584–585	cleavage; by caspase-6
587–588	cleavage; by caspase-3

Post-translational modifications (16)

Type	Positions
N6-acetyllysine	9, 176, 234, 343, 442
Phosphoserine	411, 417, 419, 432, 640, 643, 1179, 1199, 1870, 1874
N-myristoyl glycine	551

Mutagenesis-validated functional residues (10)

Position	Phenotype
495	inhibits interaction with zdhhc13 and zdhhc17.
498–499	abolishes interaction with zdhhc17.
498	inhibits interaction with zdhhc13 and zdhhc17.
499	inhibits interaction with zdhhc13 and zdhhc17.
511	loss of proteolytic cleavage.
528	no effect on proteolytic cleavage.
550	loss of proteolytic cleavage. loss of myristoylation.
551	loss of myristoylation.
584	loss of proteolytic cleavage.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 5; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

5 pathways:

ID	Pathway	Evidence
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-212436	Generic Transcription Pathway	—
R-HSA-73857	RNA Polymerase II Transcription	—
R-HSA-9022692	Regulation of MECP2 expression and activity	electronic
R-HSA-8986944	Transcriptional Regulation by MECP2	—

MSigDB gene sets: 443 (showing top): GOBP_SYNAPTIC_VESICLE_LOCALIZATION, GOBP_ESTABLISHMENT_OF_SPINDLE_ORIENTATION, GOBP_REGULATION_OF_AUTOPHAGY, GOBP_COGNITION, GRUETZMANN_PANCREATIC_CANCER_DN, GOBP_BEHAVIOR, GOBP_REGULATION_OF_CALCIUM_MEDIATED_SIGNALING, GOBP_ESTABLISHMENT_OR_MAINTENANCE_OF_CELL_POLARITY, GOBP_VESICLE_LOCALIZATION, GOBP_SPINDLE_LOCALIZATION, GOBP_EXTRINSIC_APOPTOTIC_SIGNALING_PATHWAY, GOBP_NEUROGENESIS, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_ORGANELLE_TRANSPORT_ALONG_MICROTUBULE, GOBP_POSITIVE_REGULATION_OF_ORGANELLE_ORGANIZATION

GO Biological Process (23): establishment of mitotic spindle orientation (GO:0000132), retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum (GO:0006890), apoptotic process (GO:0006915), Golgi organization (GO:0007030), central nervous system development (GO:0007417), neurogenesis (GO:0022008), protein destabilization (GO:0031648), vocal learning (GO:0042297), positive regulation of apoptotic process (GO:0043065), positive regulation of cilium assembly (GO:0045724), vesicle transport along microtubule (GO:0047496), synaptic vesicle transport (GO:0048489), positive regulation of calcium-mediated signaling (GO:0050850), positive regulation of mitophagy (GO:1901526), positive regulation of lipophagy (GO:1904504), regulation of CAMKK-AMPK signaling cascade (GO:1905289), positive regulation of CAMKK-AMPK signaling cascade (GO:1905291), positive regulation of aggrephagy (GO:1905337), negative regulation of extrinsic apoptotic signaling pathway (GO:2001237), microtubule-based process (GO:0007017), regulation of signal transduction (GO:0009966), endosomal transport (GO:0016197), negative regulation of apoptotic process (GO:0043066)

GO Molecular Function (11): p53 binding (GO:0002039), phosphoprotein phosphatase activity (GO:0004721), profilin binding (GO:0005522), kinase binding (GO:0019900), heat shock protein binding (GO:0031072), dynactin binding (GO:0034452), identical protein binding (GO:0042802), transmembrane transporter binding (GO:0044325), dynein intermediate chain binding (GO:0045505), beta-tubulin binding (GO:0048487), protein binding (GO:0005515)

GO Cellular Component (20): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), early endosome (GO:0005769), late endosome (GO:0005770), autophagosome (GO:0005776), endoplasmic reticulum (GO:0005783), Golgi apparatus (GO:0005794), centriole (GO:0005814), cytosol (GO:0005829), inclusion body (GO:0016234), axon (GO:0030424), dendrite (GO:0030425), cytoplasmic vesicle membrane (GO:0030659), cytoplasmic vesicle (GO:0031410), protein-containing complex (GO:0032991), perinuclear region of cytoplasm (GO:0048471), presynaptic cytosol (GO:0099523), postsynaptic cytosol (GO:0099524), synapse (GO:0045202)

Reactome top-level categories

4 top-level categories:

Category	Pathways
Transcriptional Regulation by MECP2	1
RNA Polymerase II Transcription	1
Gene expression (Transcription)	1
Generic Transcription Pathway	1

GO top-level categories

showing 60 of 74 GO namespaces:

Category	Terms
protein binding	6
cytoplasm	5
cellular anatomical structure	4
positive regulation of macroautophagy	3
intracellular membrane-bounded organelle	3
nervous system development	2
cellular process	2
regulation of calcium-mediated signaling	2
CAMKK-AMPK signaling cascade	2
intracellular anatomical structure	2
endosome	2
endomembrane system	2
neuron projection	2
cytosol	2
mitotic cell cycle	1
establishment of mitotic spindle localization	1
establishment of spindle orientation	1
Golgi vesicle transport	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
organelle organization	1
endomembrane system organization	1
system development	1
animal gross anatomical part developmental process	1
cell differentiation	1
regulation of protein stability	1
auditory behavior	1
imitative learning	1
learned vocalization behavior or vocal learning	1
apoptotic process	1
regulation of apoptotic process	1
positive regulation of programmed cell death	1
cilium assembly	1
positive regulation of plasma membrane bounded cell projection assembly	1
regulation of cilium assembly	1
positive regulation of organelle assembly	1
organelle transport along microtubule	1
vesicle cytoskeletal trafficking	1
transport	1
establishment of vesicle localization	1
synaptic vesicle localization	1
calcium-mediated signaling	1
positive regulation of intracellular signal transduction	1
mitophagy	1
regulation of mitophagy	1
positive regulation of autophagy of mitochondrion	1
lipophagy	1
regulation of lipophagy	1
positive regulation of calcium-mediated signaling	1
regulation of CAMKK-AMPK signaling cascade	1
aggrephagy	1
regulation of aggrephagy	1
extrinsic apoptotic signaling pathway	1
negative regulation of apoptotic signaling pathway	1
regulation of extrinsic apoptotic signaling pathway	1
phosphatase activity	1
catalytic activity, acting on a protein	1
enzyme binding	1
cytoskeletal protein binding	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 43 of 54 annotations. The rest are phylogenetic / computational / electronic (IEA).

43 experimentally-supported GO terms:

GO term	NS	Evidence
Golgi organization	BP	mutant phenotype
establishment of mitotic spindle orientation	BP	mutant phenotype
negative regulation of extrinsic apoptotic signaling pathway	BP	mutant phenotype
positive regulation of CAMKK-AMPK signaling cascade	BP	mutant phenotype
positive regulation of aggrephagy	BP	mutant phenotype
positive regulation of apoptotic process	BP	direct assay
positive regulation of calcium-mediated signaling	BP	direct assay
positive regulation of cilium assembly	BP	mutant phenotype
positive regulation of lipophagy	BP	mutant phenotype
positive regulation of mitophagy	BP	mutant phenotype
protein destabilization	BP	mutant phenotype
regulation of CAMKK-AMPK signaling cascade	BP	mutant phenotype
retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum	BP	mutant phenotype
vesicle transport along microtubule	BP	mutant phenotype
vocal learning	BP	mutant phenotype
Golgi apparatus	CC	direct assay
autophagosome	CC	direct assay
axon	CC	direct assay
centriole	CC	direct assay
cytoplasm	CC	direct assay
cytoplasmic vesicle membrane	CC	direct assay
cytosol	CC	direct assay
dendrite	CC	direct assay
early endosome	CC	direct assay
endoplasmic reticulum	CC	direct assay
inclusion body	CC	mutant phenotype
late endosome	CC	direct assay
nucleoplasm	CC	direct assay
nucleus	CC	direct assay
perinuclear region of cytoplasm	CC	mutant phenotype
postsynaptic cytosol	CC	direct assay
presynaptic cytosol	CC	direct assay
protein-containing complex	CC	direct assay
beta-tubulin binding	MF	direct assay
dynactin binding	MF	physical interaction
dynein intermediate chain binding	MF	direct assay
heat shock protein binding	MF	physical interaction
identical protein binding	MF	physical interaction
kinase binding	MF	physical interaction
p53 binding	MF	physical interaction
phosphoprotein phosphatase activity	MF	mutant phenotype
profilin binding	MF	physical interaction
transmembrane transporter binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 4,334 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
HTT	SNCA	P37840	933
HTT	ATXN3L	Q9H3M9	889
HTT	ATXN1	P54253	875
HTT	ATXN3	P54252	871
HTT	HIP1R	O75146	849
HTT	HAP1	P54257	838
HTT	BDNF	P23560	829
HTT	F8A2	P23610	822
HTT	TARDBP	Q13148	820
HTT	APP	P05067	815
HTT	HYPK	Q9NX55	800
HTT	ATN1	P54259	797
HTT	ATM	Q13315	793
HTT	GAPDH	P00354	766
HTT	PRNP	P04156	762

IntAct

Human interaction partners of HTT in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records, in a sample of 1,100 of 6,601 records).

showing 30 of 146 partners by confidence:

Partner	Interaction type	MIscore	Records
OPTN	physical association	0.820	15
ZDHHC17	physical association	0.810	30
HIP1	physical association	0.810	7
F8A1	physical association	0.780	6
BECN1	physical association	0.770	13
DYNC1H1	physical association	0.770	7
SQSTM1	physical association	0.770	5
UBAC1	physical association	0.740	26
RNF20	physical association	0.740	24
UBE2K	physical association	0.740	24
ZFYVE19	physical association	0.740	21
DNALI1	physical association	0.740	15
PRPF40A	physical association	0.740	15
ZNF655	physical association	0.740	14
SH3GL3	physical association	0.740	8
NUP58	physical association	0.740	7
EEF1D	physical association	0.740	3
FEZ1	physical association	0.720	5
TP53	physical association	0.710	19
HAP1	physical association	0.710	8
MRFAP1L1	physical association	0.700	21
XRCC6	physical association	0.700	21
ERCC6L	physical association	0.700	20
FTL	physical association	0.700	20
GOLPH3L	physical association	0.700	20
H3C1	physical association	0.700	20
ZMAT2	physical association	0.700	20
CRMP1	physical association	0.700	14
MED31	physical association	0.700	9
PFN2	physical association	0.700	7

BioGRID (608 interactions; top human partners by supporting records in a sample of 600 records): HAP1 (Affinity Capture-Western; 10 records), OPTN (Co-localization; 8 records), VCP (Affinity Capture-Western; 8 records), HIP1 (Two-hybrid; 7 records), SP1 (Affinity Capture-Western; 6 records), ZDHHC17 (Two-hybrid; 6 records), CREBBP (Co-fractionation; 5 records), UBE2K (Two-hybrid; 5 records), GIT1 (Reconstituted Complex; 4 records), SETD2 (Co-crystal Structure; 4 records), SH3GL3 (Two-hybrid; 4 records), SQSTM1 (Affinity Capture-Western; 4 records), AGO2 (Affinity Capture-MS; 3 records), AMFR (Affinity Capture-Western; 3 records), ATXN3 (Affinity Capture-Western; 3 records)

SIGNOR signaling

showing 6 of 7 signaling interactions:

A	Effect	B	Mechanism
SGK1	down-regulates	HTT	phosphorylation
CDK5	up-regulates	HTT	phosphorylation
AKT1	unknown	HTT	phosphorylation
TBK1	“up-regulates activity”	HTT	phosphorylation
AKT	unknown	HTT	phosphorylation
PRKACA	“down-regulates quantity by destabilization”	HTT	phosphorylation

Protein complexes (CORUM) (4)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

4 complexes by size:

Complex	Subunits	Members
HTT-OPTN-RAB8A complex	3	HTT, OPTN, RAB8A
★ TGM2-HD-CALM1 complex	3	TGM2, CALM1, HTT
★ HTT-DISC1-PDE4B complex	3	PDE4B, DISC1, HTT
TGM2-HD complex	2	TGM2, HTT

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 146 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Antigen processing: Ub, ATP-independent proteasomal degradation	5	23.4×	4e-05
Autodegradation of the E3 ubiquitin ligase COP1	8	17.4×	5e-06
Vif-mediated degradation of APOBEC3G	8	16.6×	5e-06
AUF1 (hnRNP D0) binds and destabilizes mRNA	8	16.3×	5e-06
Regulation of activated PAK-2p34 by proteasome mediated degradation	7	16.0×	1e-05
Hh mutants are degraded by ERAD	8	15.9×	5e-06
Regulation of ornithine decarboxylase (ODC)	7	15.6×	1e-05
Somitogenesis	8	15.3×	6e-06

Disease & clinical

Genetic variants

Variant evidence for HTT: 885 ClinVar records (14 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

885 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	6
Likely pathogenic	8
Uncertain significance	279
Likely benign	408
Benign	58

Top pathogenic / likely-pathogenic (14)

Showing all 14 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
409	NC_000004.11:g.3076606GCA[40_?]	Pathogenic	practice guideline	3
1393012	NM_001388492.1(HTT):c.2710C>T (p.Gln904Ter)	Pathogenic	criteria provided, single submitter	1
1464611	NM_001388492.1(HTT):c.2085del (p.Gly697fs)	Pathogenic	criteria provided, single submitter	1
1494729	NM_001388492.1(HTT):c.5821_5833del (p.Ser1941fs)	Pathogenic	criteria provided, single submitter	1
1357041	NM_001388492.1(HTT):c.8110-1G>A	Likely pathogenic	criteria provided, single submitter	1
1375718	NM_001388492.1(HTT):c.1403-1G>C	Likely pathogenic	criteria provided, single submitter	1
1687507	NM_001388492.1(HTT):c.54GCA[40] (p.Gln18_Gln38dup)	Likely pathogenic	criteria provided, single submitter	1
3779747	NM_001388492.1(HTT):c.107del (p.Gln36fs)	Likely pathogenic	criteria provided, single submitter	1
3779748	NM_001388492.1(HTT):c.99_102del (p.Gln33fs)	Likely pathogenic	criteria provided, single submitter	1
3779749	NM_001388492.1(HTT):c.99del (p.Gln33fs)	Likely pathogenic	criteria provided, single submitter	1
3897713	NM_001388492.1:c.52CAG[55_59]	Likely pathogenic	criteria provided, single submitter	1
4845680	NM_001388492.1(HTT):c.6921C>G (p.Leu2307=)	Likely pathogenic	criteria provided, single submitter	1
1808621	GRCh37/hg19 4p16.3-15.33(chr4:1-12785001)x1	Pathogenic	criteria provided, single submitter	1
417745	NM_001388492.1(HTT):c.8150T>A (p.Phe2717Tyr)	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore HTT’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

AlphaMissense

6,100 missense substitutions predicted likely pathogenic (of 20,487 scored), across 1,636 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M1574	9	0.891	0.992
D1466	8	0.999	1.000
F1471	8	0.994	0.999
D1525	8	0.993	0.999
F1425	8	0.991	0.998
D1650	8	0.988	0.997
D2667	8	0.988	0.996
D761	8	0.986	0.998
F1500	8	0.986	0.997
D1548	8	0.986	0.995
F1320	8	0.985	0.999
H1510	8	0.984	0.998
F2674	8	0.983	0.999
D1904	8	0.982	0.997
N1461	8	0.981	1.000
F2464	8	0.980	0.999
F2711	8	0.972	0.996
F190	8	0.970	0.997
D920	8	0.970	0.993
D2709	8	0.970	0.994

HPA cancer prognostics

RNA cancer specificity: Cancer enhanced (Breast Invasive Carcinoma)

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	1.88e-07
Lung Adenocarcinoma (validation)	favorable	0.000664
Kidney Renal Clear Cell Carcinoma (validation)	favorable	0.000934

Disease associations

OMIM: gene MIM:613004 | disease phenotypes: MIM:143100 (Huntington disease), MIM:617435 (Lopes-Maciel-Rodan syndrome)

GenCC curated gene-disease

3 curated gene-disease records:

Disease	Classification	Inheritance	Records
Huntington disease	Definitive	Autosomal dominant	4
Lopes-Maciel-Rodan syndrome	Strong	Autosomal recessive	2
juvenile Huntington disease	Supportive	Autosomal dominant

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
Huntington disease	Definitive	AD

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (5 panels, 0 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

5 panels:

Panel	Rating
Dystonia, chorea or related movement disorder, childhood onset	amber
Hypotonic infant	amber
Intellectual disability	amber
Leukodystrophy, childhood onset	amber
Paediatric disorders	amber

Mondo (3): Huntington disease (MONDO:0007739), Lopes-Maciel-Rodan syndrome (MONDO:0054573), juvenile Huntington disease (MONDO:0016621)

Orphanet (1): Huntington disease (Orphanet:399)

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D006816	Huntington Disease	C10.228.140.079.545; C10.228.140.380.278; C10.228.662.262.249.750; C10.574.500.497; C16.320.400.430; F03.615.250.400; F03.615.400.390

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (3): CHEMBL4296121 (PROTEIN-PROTEIN INTERACTION), CHEMBL5514 (SINGLE PROTEIN), CHEMBL6193806 (PROTEIN-PROTEIN INTERACTION)

Drugs by curated mechanism of action (ChEMBL)

Drugs whose curated ChEMBL mechanism of action targets the HTT protein itself — single-protein targets only (drugs acting on a protein family or complex that merely includes it are excluded). Includes antibodies and oligonucleotides that bioactivity screening does not capture.

1 curated-mechanism drugs:

Drug	Modality	Max phase
TOMINERSEN	Oligonucleotide	3

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 672,082 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

showing 60 of 165 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL945	AMILORIDE	4	64,123
CHEMBL633	AMIODARONE	4	30,023
CHEMBL3187985	APOMORPHINE HYDROCHLORIDE	4	5,317
CHEMBL296419	ASTEMIZOLE	4	21,684
CHEMBL1489	AZACITIDINE	4	98,570
CHEMBL1008	BEPRIDIL	4	11,851
CHEMBL290106	BITHIONOL	4	6,490
CHEMBL1319139	BROMHEXINE HYDROCHLORIDE	4	1,944
CHEMBL223448	BROXYQUINOLINE	4	859
CHEMBL73234	CARBETAPENTANE	4	7,334
CHEMBL513	CARMUSTINE	4	150,180
CHEMBL5219790	CETRIMIDE	4
CHEMBL790	CHLORHEXIDINE	4	85,849
CHEMBL1200596	CHLOROXINE	4	1,799
CHEMBL1201284	CINACALCET	4	5,997
CHEMBL1619	CLADRIBINE	4	92,508
CHEMBL497	CLIOQUINOL	4	13,056
CHEMBL2355051	CLOMIPHENE	4	36
CHEMBL104	CLOTRIMAZOLE	4	56,839
CHEMBL516	CYPROHEPTADINE	4	17,623
CHEMBL1554	DACTINOMYCIN	4
CHEMBL53418	DANTHRON	4
CHEMBL5416410	DASATINIB	4
CHEMBL178	DAUNORUBICIN	4
CHEMBL1200474	DEMECLOCYCLINE HYDROCHLORIDE	4
CHEMBL333826	DEQUALINIUM	4
CHEMBL72	DESIPRAMINE	4
CHEMBL1200612	DIBUCAINE HYDROCHLORIDE	4
CHEMBL23	DILTIAZEM	4
CHEMBL1597	DIMERCAPROL	4
CHEMBL657	DIPHENHYDRAMINE	4
CHEMBL964	DISULFIRAM	4
CHEMBL1185568	DITHIAZANINE	4
CHEMBL421701	DITHIAZANINE IODIDE	4
CHEMBL926	DOBUTAMINE	4
CHEMBL1175	DULOXETINE	4
CHEMBL305660	EBASTINE	4
CHEMBL1201049	ECONAZOLE NITRATE	4
CHEMBL456	ETHACRYNIC ACID	4
CHEMBL413965	FELBINAC	4
CHEMBL1057	FLUORESCEIN	4
CHEMBL1200600	FLUOROMETHOLONE	4
CHEMBL185	FLUOROURACIL	4
CHEMBL41	FLUOXETINE	4
CHEMBL46516	FLUSPIRILENE	4
CHEMBL806	FLUTAMIDE	4
CHEMBL64894	GENTIAN VIOLET	4
CHEMBL562	GRISEOFULVIN	4
CHEMBL496	HEXACHLOROPHENE	4
CHEMBL443605	HEXYLRESORCINOL	4
CHEMBL1200848	HYDROXYPROGESTERONE CAPROATE	4
CHEMBL1117	IDARUBICIN	4
CHEMBL252556	IDEBENONE	4
CHEMBL12856	INAMRINONE	4
CHEMBL15870	INDOPROFEN	4
CHEMBL1201153	ISOETHARINE MESYLATE	4
CHEMBL1201124	KETOROLAC TROMETHAMINE	4
CHEMBL960	LEFLUNOMIDE	4
CHEMBL841	LOPERAMIDE	4
CHEMBL19299	LOXOPROFEN	4

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

327 measured of 339 human assays (360 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
(6-methoxy-3-pyridinyl)-[7-[(5-prop-2-enoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	1.05 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(5-methoxypyrazin-2-yl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	1.2 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-methoxy-3-pyridinyl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	1.24 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[7-[[5-(2-fluoroethoxy)-2-pyridinyl]methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-(6-methoxy-3-pyridinyl)methanone	EC50	1.25 nM	US-11992535: Compounds and probes for imaging huntingtin protein
7-[(5-methoxy-2-pyridinyl)methoxy]-2-(5-methoxypyrimidin-2-yl)-3,4-dihydro-1H-isoquinoline	EC50	1.26 nM	US-11992535: Compounds and probes for imaging huntingtin protein
5-methoxy-N-[2-(6-methoxy-3-pyridinyl)-3,4-dihydro-1H-isoquinolin-7-yl]pyridine-2-carboxamide	EC50	1.3 nM	US-11992535: Compounds and probes for imaging huntingtin protein
CHEMBL4875017	IC50	1.6 nM
(6-methoxy-3-pyridinyl)methyl 7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carboxylate	EC50	1.65 nM	US-11992535: Compounds and probes for imaging huntingtin protein
CHEMBL4878942	IC50	1.7 nM
2-(4-methoxy-2-pyridinyl)-7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline	EC50	1.7 nM	US-11992535: Compounds and probes for imaging huntingtin protein
5-methoxy-N-[2-(6-methoxypyridine-3-carbonyl)-3,4-dihydro-1H-isoquinolin-7-yl]pyridine-2-carboxamide	EC50	1.72 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(4-methoxyphenyl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	1.78 nM	US-11992535: Compounds and probes for imaging huntingtin protein
2-(5-methoxy-2-pyridinyl)-7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline	EC50	1.79 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[6-(dimethylamino)-3-pyridinyl]-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	1.8 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[6-(fluoromethoxy)-3-pyridinyl]-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	1.96 nM	US-11992535: Compounds and probes for imaging huntingtin protein
3-[(5-methoxy-2-pyridinyl)methoxy]-6-(5-methoxypyrimidin-2-yl)-7,8-dihydro-5H-1,6-naphthyridine	EC50	1.97 nM	US-11992535: Compounds and probes for imaging huntingtin protein
2-(6-methoxy-2-pyridinyl)-7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline	EC50	2.02 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-imidazol-1-yl-3-pyridinyl)-[3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridin-6-yl]methanone	EC50	2.06 nM	US-11992535: Compounds and probes for imaging huntingtin protein
CHEMBL4863336	IC50	2.1 nM
CHEMBL4847156	IC50	2.1 nM
[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-(2-methoxypyrimidin-5-yl)methanone	EC50	2.1 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-methoxy-3-pyridinyl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-4-methyl-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	2.19 nM	US-11992535: Compounds and probes for imaging huntingtin protein
CHEMBL4867927	IC50	2.2 nM
2-(6-methoxy-3-pyridinyl)-7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline	EC50	2.21 nM	US-11992535: Compounds and probes for imaging huntingtin protein
CHEMBL4859053	IC50	2.3 nM
[6-(2-fluoroethoxy)-3-pyridinyl]-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	2.48 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-[6-(trifluoromethyl)-3-pyridinyl]methanone	EC50	2.54 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[7-[[5-(fluoromethoxy)-2-pyridinyl]methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-(6-methoxy-3-pyridinyl)methanone	EC50	2.6 nM	US-11992535: Compounds and probes for imaging huntingtin protein
2-(5-methoxy-3-pyridinyl)-7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline	EC50	2.65 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-(6-methyl-3-pyridinyl)methanone	EC50	2.91 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridin-6-yl]-(6-prop-2-enoxy-3-pyridinyl)methanone	EC50	3.01 nM	US-11992535: Compounds and probes for imaging huntingtin protein
6-(5-methoxy-2-pyridinyl)-3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridine	EC50	3.19 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-methoxy-3,4-dihydro-1H-2,7-naphthyridin-2-yl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	3.67 nM	US-11992535: Compounds and probes for imaging huntingtin protein
2-(2-fluoroethyl)-6-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carbonyl]pyridazin-3-one	EC50	4.24 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[6-(2-fluoroethoxy)-3-pyridinyl]-[3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridin-6-yl]methanone	EC50	4.45 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(5-methoxy-2-pyridinyl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	5 nM	US-11992535: Compounds and probes for imaging huntingtin protein
1-(2-fluoroethyl)-5-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carbonyl]pyridin-2-one	EC50	5.12 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-methoxypyridazin-3-yl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	5.2 nM	US-11992535: Compounds and probes for imaging huntingtin protein
1-(3-fluoropropyl)-5-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carbonyl]pyridin-2-one	EC50	5.45 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(5-methoxy-3-pyridinyl)-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	5.59 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-methoxy-3-pyridinyl)-[3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridin-6-yl]methanone	EC50	5.73 nM	US-11992535: Compounds and probes for imaging huntingtin protein
N-(6-methoxy-3-pyridinyl)-7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carboxamide	EC50	6.92 nM	US-11992535: Compounds and probes for imaging huntingtin protein
6-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carbonyl]-2-methylpyridazin-3-one	EC50	7.75 nM	US-11992535: Compounds and probes for imaging huntingtin protein
6-(5-methoxy-3-pyridinyl)-3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridine	EC50	7.86 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-(1-methylpyrazol-4-yl)methanone	EC50	7.87 nM	US-11992535: Compounds and probes for imaging huntingtin protein
CHEMBL5179682	IC50	8 nM
[7-[(5-hydroxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]-(6-methoxy-3-pyridinyl)methanone	EC50	8.44 nM	US-11992535: Compounds and probes for imaging huntingtin protein
(6-methoxy-3-pyridinyl)-[6-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinolin-2-yl]methanone	EC50	8.48 nM	US-11992535: Compounds and probes for imaging huntingtin protein
3-[7-[(5-methoxy-2-pyridinyl)methoxy]-3,4-dihydro-1H-isoquinoline-2-carbonyl]-3H-pyridin-6-one	EC50	12 nM	US-11992535: Compounds and probes for imaging huntingtin protein
[6-(2-methoxyethoxy)-3-pyridinyl]-[3-[(5-methoxy-2-pyridinyl)methoxy]-7,8-dihydro-5H-1,6-naphthyridin-6-yl]methanone	EC50	13.1 nM	US-11992535: Compounds and probes for imaging huntingtin protein

ChEMBL bioactivities

6100 potent at pChembl≥5 of 6100 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
9.00	Potency	1	nM	CHEMBL1307475
9.00	Potency	1	nM	KENPAULLONE
8.96	Potency	1.1	nM	CHEMBL1460806
8.89	Potency	1.3	nM	CHEMBL1314987
8.80	IC50	1.6	nM	CHEMBL4875017
8.77	IC50	1.7	nM	CHEMBL4878942
8.68	IC50	2.1	nM	CHEMBL4863336
8.68	IC50	2.1	nM	CHEMBL4847156
8.66	IC50	2.2	nM	CHEMBL4867927
8.66	Potency	2.2	nM	CHEMBL1374893
8.66	Potency	2.2	nM	CHEMBL1485295
8.64	IC50	2.3	nM	CHEMBL4859053
8.60	Potency	2.5	nM	CHEMBL1531569
8.60	Potency	2.5	nM	CHEMBL1522262
8.55	Potency	2.8	nM	CHEMBL1427457
8.55	Potency	2.8	nM	CHEMBL1366201
8.55	Potency	2.8	nM	CHEMBL1453691
8.55	Potency	2.8	nM	CHEMBL1313778
8.49	Potency	3.2	nM	CHEMBL1373983
8.35	Potency	4.5	nM	CHEMBL1442568
8.35	Potency	4.5	nM	CHEMBL1543244
8.30	Potency	5	nM	CHEMBL1321101
8.20	Potency	6.3	nM	CHEMBL1527550
8.20	Potency	6.3	nM	CHEMBL1580359
8.15	Potency	7.1	nM	CHEMBL1406095
8.10	IC50	8	nM	CHEMBL5179682
8.05	Potency	8.9	nM	CHEMBL1601713
8.00	Potency	10	nM	CHEMBL1602321
7.85	Potency	14.1	nM	CHEMBL1509005
7.85	Potency	14.1	nM	CHEMBL1433254
7.80	Potency	15.8	nM	CHEMBL1427501
7.80	Potency	15.8	nM	CHEMBL1400505
7.75	Potency	17.8	nM	VINCRISTINE
7.70	Potency	20	nM	TRYPAN BLUE FREE ACID
7.60	Potency	25.1	nM	CHEMBL1380650
7.60	Potency	25.1	nM	CHEMBL1461196
7.60	Potency	25.1	nM	CHEMBL1573026
7.55	Potency	28.2	nM	CHEMBL1516718
7.55	Potency	28.2	nM	CHEMBL1444064
7.55	Potency	28.2	nM	CHEMBL3199116
7.55	Potency	28.2	nM	CHEMBL1587526
7.55	Potency	28.2	nM	CHEMBL1413448
7.55	Potency	28.2	nM	CHEMBL1322179
7.50	Potency	31.6	nM	CHEMBL1437881
7.50	Potency	31.6	nM	CHEMBL1359386
7.50	Potency	31.6	nM	CHEMBL473735
7.50	Potency	31.6	nM	CHEMBL1455655
7.50	Potency	31.6	nM	CHEMBL1600349
7.50	Potency	31.6	nM	CHEMBL1535191
7.50	Potency	31.6	nM	CHEMBL1612884

PubChem BioAssay actives

36 with measured affinity, of 183 total; 32 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
5-(7-fluoro-2-methylindazol-5-yl)-2-[3-[3-(hydroxymethyl)piperazin-1-yl]-1,2,4-triazin-6-yl]phenol	1782623: Inhibition of endogenous Huntingtin protein (unknown origin) incubated for overnight in presence of MW1/MAB2166 monoclonal antibody by ELISA-based MSD electrochemiluminescence assay	ic50	0.0016	uM
2-[3-[(3S)-3-cyclopropylpiperazin-1-yl]-1,2,4-triazin-6-yl]-5-(2-methyltriazolo[4,5-b]pyridin-6-yl)phenol	1782623: Inhibition of endogenous Huntingtin protein (unknown origin) incubated for overnight in presence of MW1/MAB2166 monoclonal antibody by ELISA-based MSD electrochemiluminescence assay	ic50	0.0017	uM
2-[3-[(3S)-3-cyclopropylpiperazin-1-yl]-1,2,4-triazin-6-yl]-5-(5-fluoro-1H-pyrazol-4-yl)phenol	1782623: Inhibition of endogenous Huntingtin protein (unknown origin) incubated for overnight in presence of MW1/MAB2166 monoclonal antibody by ELISA-based MSD electrochemiluminescence assay	ic50	0.0021	uM
5-(7-fluoro-2-methylindazol-5-yl)-2-[3-(3-methylpiperazin-1-yl)-1,2,4-triazin-6-yl]phenol	1782623: Inhibition of endogenous Huntingtin protein (unknown origin) incubated for overnight in presence of MW1/MAB2166 monoclonal antibody by ELISA-based MSD electrochemiluminescence assay	ic50	0.0021	uM
2-[3-(3-ethylpiperazin-1-yl)-1,2,4-triazin-6-yl]-5-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)phenol	1782623: Inhibition of endogenous Huntingtin protein (unknown origin) incubated for overnight in presence of MW1/MAB2166 monoclonal antibody by ELISA-based MSD electrochemiluminescence assay	ic50	0.0022	uM
5-(2-methylimidazo[1,2-a]pyrazin-6-yl)-2-[3-[(3S)-3-propan-2-ylpiperazin-1-yl]-1,2,4-triazin-6-yl]phenol	1782623: Inhibition of endogenous Huntingtin protein (unknown origin) incubated for overnight in presence of MW1/MAB2166 monoclonal antibody by ELISA-based MSD electrochemiluminescence assay	ic50	0.0023	uM
7-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-3-(1-ethylpiperidin-4-yl)-5-fluorocinnoline	1874417: Inhibition of HTT (unknown origin)	ic50	0.0080	uM
4-[3-hydroxy-4-[6-(2,2,6,6-tetramethylpiperidin-4-yl)oxypyridazin-3-yl]phenyl]-1H-pyridin-2-one	1874417: Inhibition of HTT (unknown origin)	ic50	0.0400	uM
7-(1-ethylpiperidin-4-yl)-9-methyl-2-(2-methylindazol-5-yl)pyrido[1,2-a]pyrimidin-4-one	1874417: Inhibition of HTT (unknown origin)	ic50	0.0800	uM
N-(3-aminopropyl)-N-[(1R)-1-(3-benzyl-7-iodo-4H-quinazolin-2-yl)-2-methylpropyl]-4-methylbenzamide	1922361: Binding affinity to mutant HTT (unknown origin) mediated HD exon 1-72Q aggregation assessed as dissociation constant	kd	0.1000	uM
(3Z)-3-[(3,5-dibromo-4-hydroxyphenyl)methylidene]-5-iodo-1H-indol-2-one	1922361: Binding affinity to mutant HTT (unknown origin) mediated HD exon 1-72Q aggregation assessed as dissociation constant	kd	0.1000	uM
4-[2-[(6-chloroquinazolin-4-yl)amino]ethyl]phenol	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	0.7100	uM
4-[4-(1,3-benzodioxol-5-ylmethyl)piperazin-1-yl]-6-chloroquinazoline	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	1.0700	uM
4-[2-[(6-bromoquinazolin-4-yl)amino]ethyl]phenol	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	1.1100	uM
methyl 4-[[6-(phenylcarbamoyl)-1,3-benzothiazol-2-yl]carbamoyl]benzoate	729971: Inhibition of HD exon 1 fusion protein with 51 glutamine residues (unknown origin) aggregation expressed in Escherichia coli SURE after 16 hrs by Western blotting analysis	ic50	1.2000	uM
6-bromo-4-(4-methylpiperazin-1-yl)quinazoline	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	1.3100	uM
(2-amino-1,3-thiazol-4-yl)-[3-hydroxy-3-(trifluoromethyl)-4,5,6,7-tetrahydro-3aH-indazol-2-yl]methanone	1922358: Inhibition of HTT (unknown origin)	ic50	1.8000	uM
6-bromo-4-(4-ethylpiperazin-1-yl)quinazoline	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	2.2100	uM
6-bromo-4-piperazin-1-ylquinazoline	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	2.7400	uM
6-chloro-N-[2-(4-chlorophenyl)ethyl]quinazolin-4-amine	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	3.4400	uM
6-chloro-4-(4-ethylpiperazin-1-yl)quinazoline	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	3.6300	uM
ethyl 2-[4-[2-[(6-chloroquinazolin-4-yl)amino]ethyl]phenoxy]acetate	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	4.4800	uM
3-aminospiro[6H-benzo[h]quinazoline-5,1’-cyclopentane]-4-one	1922359: Inhibition of mutant HTT (unknown origin)	ec50	4.9000	uM
(2S)-2-[[(2S)-2-[[(2S,3S)-2-[[2-[[(2S)-1-[(2S)-2-[[(2S)-2-[[(2S)-6-amino-2-[[(2S)-2-[[(2S)-4-amino-2-[[(2S)-2-amino-3-hydroxypropanoyl]amino]-4-oxobutanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]hexanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]-3-(1H-indol-3-yl)propanoyl]pyrrolidine-2-carbonyl]amino]acetyl]amino]-3-methylpentanoyl]amino]-3-phenylpropanoyl]amino]butanedioic acid	2098552: Inhibition of HTT (unknown origin) by ELISA method	ic50	5.0000	uM
4-[(1R)-1-aminoethyl]-N-pyridin-4-ylcyclohexane-1-carboxamide	1922358: Inhibition of HTT (unknown origin)	ic50	5.0000	uM
N-(4-anilinophenyl)-2-(2-methylphenoxy)acetamide	1922358: Inhibition of HTT (unknown origin)	ic50	5.0000	uM
4-(4-ethylpiperazin-1-yl)-6-fluoroquinazoline	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	5.2600	uM
6-bromo-N-prop-2-enylquinazolin-4-amine	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	5.3600	uM
N-benzyl-6-bromoquinazolin-4-amine	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	6.1300	uM
4-[2-[(6-fluoroquinazolin-4-yl)amino]ethyl]phenol	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	6.3800	uM
N-(4-anilinophenyl)-2-(3-methylphenoxy)acetamide	1922358: Inhibition of HTT (unknown origin)	ic50	7.5000	uM
6-bromo-N-propylquinazolin-4-amine	419008: Inhibition of Huntingtin protein aggregation by cell based assay	ic50	8.1300	uM

CTD chemical–gene interactions

43 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol F	increases expression, affects cotreatment, decreases expression	2
sodium arsenite	decreases expression, increases abundance	2
Aflatoxin B1	decreases methylation, increases methylation	2
FR900359	affects phosphorylation	1
TAK-243	decreases sumoylation	1
dicrotophos	increases expression	1
geldanamycin	decreases reaction, affects binding	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases methylation	1
arsenite	affects binding, decreases reaction	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cypermethrin	increases expression	1
manganese chloride	decreases expression, increases abundance	1
aflatoxin B2	increases methylation	1
coumarin	decreases phosphorylation	1
formic acid	affects binding, decreases reaction	1
corosolic acid	increases expression	1
abrine	decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
bisphenol S	increases expression	1
(+)-JQ1 compound	increases expression	1
Arsenic	decreases expression, increases abundance	1
Benzo(a)pyrene	decreases expression	1
Benzophenoneidum	increases expression	1
Caffeine	affects phosphorylation	1
Cisplatin	decreases expression	1
Copper	affects binding, increases reaction, increases reduction	1
Dexamethasone	affects cotreatment, decreases expression	1
Endosulfan	decreases expression	1

ChEMBL screening assays

77 unique, capped per target: 72 binding, 5 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4187717	Binding	Induction of IAP-huntingtin interaction-mediated huntingtin protein degradation in fibroblasts derived from Huntington’s disease patient incubated for 24 hrs by Western blot method	Degradation of huntingtin mediated by a hybrid molecule composed of IAP antagonist linked to phenyldiazenyl benzothiazole derivative. — *Bioorg Med Chem Lett*
CHEMBL1613918	Functional	PUBCHEM_BIOASSAY: qHTS Multiplex Assay to Identify Dual Action Probes in a Cell Model of Huntington: Aggregate Formation (GFP). (Class of assay: confirmatory) [Related pubchem assays: 1482, 1471 ]	PubChem BioAssay data set

Cellosaurus cell lines

248 cell lines: 131 induced pluripotent stem cell, 41 finite cell line, 35 transformed cell line, 19 cancer cell line, 16 embryonic stem cell, 4 conditionally immortalized cell line, 2 telomerase immortalized cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_1H81	GM04022	Finite cell line	Female
CVCL_1H82	GM04023	Transformed cell line	Female
CVCL_1I60	GM04854	Transformed cell line	Male
CVCL_1I61	GM04855	Finite cell line	Male
CVCL_1I62	GM04856	Transformed cell line	Female
CVCL_1I63	GM04857	Finite cell line	Female
CVCL_1I94	GM05538	Transformed cell line	Male
CVCL_1I95	GM05539	Finite cell line	Male
CVCL_1J70	GM13503	Transformed cell line	Female
CVCL_1J71	GM13504	Transformed cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 573 trials:

NCT	Phase	Status	Title
NCT00652457	Phase 4	COMPLETED	Study of Memantine to Treat Huntington’s Disease
NCT01834911	Phase 4	COMPLETED	Effect of Tetrabenazine on Stroop Interference in HD
NCT02509793	Phase 4	UNKNOWN	A Pilot Study Assessing Impulsivity in Patients With Huntington’s Disease on Xenazine (Tetrabenazine)
NCT07601516	Phase 4	COMPLETED	Real World Effectiveness and Safety of Deutetrabenazine in Adult Chinese Participants With Huntington’s Disease (HD) Chorea in China
NCT00154830	Phase 4	COMPLETED	Alterations of Functional Activities and Leg Stiffness After Hamstring Lengthening in Cerebral Palsy Children
NCT00432055	Phase 4	COMPLETED	Effects of Botulinum Toxin Type A in Adults With Cerebral Palsy
NCT00549471	Phase 4	TERMINATED	Improvement After Botulinum Toxin Injections to the Arms in Children With Cerebral Palsy
NCT00752934	Phase 4	TERMINATED	Does Oral Baclofen Improve Care and Comfort in Spastic Children in Nursing Homes?
NCT00964639	Phase 4	COMPLETED	Postoperative Pain in Children With Cerebral Palsy After Pelvic and Femoral Osteotomies
NCT01386255	Phase 4	WITHDRAWN	Placebo Controlled Study of Baclofen for GERD in Children With Cerebral Palsy
NCT02546999	Phase 4	COMPLETED	Does Botulinum Toxin A Make Walking Easier in Children With Cerebral Palsy?
NCT02633241	Phase 4	COMPLETED	A Pilot Study of Dexmedetomidine-Propofol in Children Undergoing Magnetic Resonance Imaging
NCT03117322	Phase 4	COMPLETED	Synbiotic, Prebiotics and Probiotics in Children With Cerebral Palsy and Constipation
NCT03648658	Phase 4	UNKNOWN	Paracetamol Study in Patients With Low Muscle Mass
NCT04074265	Phase 4	COMPLETED	Peri-operative Use of a Pain Injection in Pediatric Patients With Cerebral Palsy
NCT04273737	Phase 4	TERMINATED	Amantadine in Treating Cognitive & Motor Impairments in Adolescents and Adults With Cerebral Palsy
NCT04523935	Phase 4	COMPLETED	Excessive Crying in Children With Cerebral Palsy and Communication Deficits
NCT05887765	Phase 4	COMPLETED	Effect of Systematic Dexamethasone on the Duration of Popliteal Nerve Block for Anesthesia After Pediatric Ankle Surgery
NCT06176430	Phase 4	UNKNOWN	Comparison of Twice Weekly Versus Daily Iron Therapy in Treating Anemia in Children With Cerebral Palsy
NCT06189781	Phase 4	RECRUITING	Pain Injection Versus Epidural Anesthesia for Hip Surgery in Pediatric Patients With Cerebral Palsy
NCT00146211	Phase 3	COMPLETED	TREND-HD - A Trial of Ethyl-EPA (Miraxion™) in Treating Mild to Moderate Huntington’s Disease
NCT00219804	Phase 3	COMPLETED	Efficacy and Safety of Tetrabenazine in Chorea
NCT00277602	Phase 3	COMPLETED	Riluzole in Huntington’s Disease
NCT00608881	Phase 3	TERMINATED	Coenzyme Q10 in Huntington’s Disease (HD)
NCT00632645	Phase 3	COMPLETED	Neuroleptic and Huntington Disease Comparison of : Olanzapine, la Tetrabenazine and Tiapride
NCT00665223	Phase 3	COMPLETED	A Study of Treatment With Pridopidine (ACR16) in Participants With Huntington’s Disease
NCT00712426	Phase 3	TERMINATED	Creatine Safety, Tolerability, & Efficacy in Huntington’s Disease (CREST-E)
NCT00920946	Phase 3	COMPLETED	A Safety and Efficacy Study of Dimebon in Patients With Huntington Disease
NCT01085266	Phase 3	TERMINATED	An Extension of the HORIZON Protocol Evaluating the Safety of Dimebon (Latrepirdine) in Subjects With Huntington Disease
NCT03842969	Phase 3	COMPLETED	An Open-Label Extension Study to Evaluate Long-Term Safety and Tolerability of RO7234292 (RG6042) in Huntington’s Disease Participants Who Participated in Prior Roche and Genentech Sponsored Studies
NCT03854019	Phase 3	COMPLETED	Evaluating the Efficacy of Dextromethorphan/Quinidine in Treating Irritability in Huntington’s Disease
NCT04556656	Phase 3	COMPLETED	PRidopidine’s Outcome On Function in Huntington Disease, PROOF- HD
NCT04826692	Phase 3	COMPLETED	TEsting METformin Against Cognitive Decline in HD
NCT05655520	Phase 3	TERMINATED	A Study to Evaluate the Safety and Tolerability of SAGE-718 in Participants With Huntington’s Disease
NCT06097780	Phase 3	UNKNOWN	Efficacy and Safety of NestaCell® in Huntington’s Disease
NCT07326709	Phase 3	RECRUITING	A Study to Investigate the Efficacy, Safety and Tolerability of Votoplam in Participants With Huntington’s Disease
NCT07609108	Phase 3	RECRUITING	Pridopidine Phase 3 Study in Huntington’s Disease
NCT00014989	Phase 3	COMPLETED	Beneficial Effects of Antenatal Magnesium Sulfate (BEAM Trial)
NCT00065949	Phase 3	UNKNOWN	Magnesium Sulfate to Prevent Brain Injury in Premature Infants
NCT00367068	Phase 3	COMPLETED	Dutch National ITB Study in Children With Cerebral Palsy
NCT00491894	Phase 3	COMPLETED	Safety and Efficacy Study of Oral Glycopyrrolate Liquid for the Treatment of Pathologic (Chronic Moderate to Severe) Drooling in Pediatric Patients 3 to 18 Years of Age With Cerebral Palsy or Other Neurologic Conditions
NCT00632528	Phase 3	COMPLETED	MEOPA to Improve Physical Therapy Results After Multilevel Surgery
NCT00822029	Phase 3	TERMINATED	Use of Oral Bisphosphonates in the Treatment of Osteoporosis of Non-walking Children With Cerebral Palsy
NCT00922077	Phase 3	COMPLETED	Individualized Neurodevelopmental Treatment
NCT01249417	Phase 3	COMPLETED	Dysport® Pediatric Lower Limb Spasticity Study
NCT01251380	Phase 3	COMPLETED	Dysport® Pediatric Lower Limb Spasticity Follow-on Study
NCT01437644	Phase 3	COMPLETED	The Post-Operative Pain in Cerebral Palsy (POPPIES) Trial
NCT01492608	Phase 3	COMPLETED	Magnesium Sulphate for Preterm Birth (MASP Study)
NCT01603602	Phase 3	COMPLETED	BOTOX® Treatment in Pediatric Upper Limb Spasticity
NCT01603615	Phase 3	COMPLETED	BOTOX® Open-Label Treatment in Pediatric Upper Limb Spasticity
NCT01603628	Phase 3	COMPLETED	BOTOX® Treatment in Pediatric Lower Limb Spasticity
NCT01603641	Phase 3	COMPLETED	BOTOX® Open-Label Treatment in Pediatric Lower Limb Spasticity
NCT01633736	Phase 3	UNKNOWN	Targeted Hip Strength Training in Children With Cerebral Palsy (CP)
NCT01898520	Phase 3	COMPLETED	A Safety, Efficacy and Tolerability Study of Sativex for the Treatment of Spasticity in Children Aged 8 to 18 Years
NCT01929434	Phase 3	COMPLETED	Efficacy of Stem Cell Transplantation Compared to Rehabilitation Treatment of Patients With Cerebral Paralysis
NCT02002884	Phase 3	COMPLETED	Dose-response Study of Efficacy and Safety of Botulinum Toxin Type A to Treat Spasticity of the Arm(s) or of Arm(s) and Leg(s) in Cerebral Palsy
NCT02270736	Phase 3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02839785	Phase 3	TERMINATED	Analgesia and Physiotherapy in Children With Cerebral Palsy (ANTALKINECP)
NCT03110341	Phase 3	UNKNOWN	Effect of Erythropoietin in Premature Infants on White Matter Lesions and Neurodevelopmental Outcome
NCT03302871	Phase 3	COMPLETED	Integrated Management Enhances Functional Gains in Children With Cerebral Palsy Treated by BoNT-A

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for HTT across ~30M SureChEMBL compounds — explore on Sugi Predict.