IL12RB1

Summary

IL12RB1 (interleukin 12 receptor subunit beta 1, HGNC:5971) is a protein-coding gene on chromosome 19p13.11, encoding Interleukin-12 receptor subunit beta-1 (P42701). Functions as an interleukin receptor which binds interleukin-12 with low affinity and is involved in IL12 transduction.

The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 3594 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Mendelian susceptibility to mycobacterial diseases due to complete IL12RB1 deficiency (Strong, GenCC)
• GWAS associations: 5
• Clinical variants (ClinVar): 678 total — 62 pathogenic, 16 likely-pathogenic
• Phenotypes (HPO): 58
• Druggable target: yes
• MANE Select transcript: NM_005535

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:5971
Approved symbol	IL12RB1
Name	interleukin 12 receptor subunit beta 1
Location	19p13.11
Locus type	gene with protein product
Status	Approved
Aliases	CD212
Ensembl gene	ENSG00000096996
Ensembl biotype	protein_coding
OMIM	601604
Entrez	3594

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 6 protein_coding, 1 retained_intron

ENST00000322153, ENST00000430026, ENST00000593993, ENST00000594176, ENST00000597416, ENST00000598019, ENST00000600835

RefSeq mRNA: 4 — MANE Select: NM_005535 NM_001290023, NM_001290024, NM_005535, NM_153701

CCDS: CCDS32957, CCDS54232

Canonical transcript exons

ENST00000593993 — 17 exons

Exon	Start	End
ENSE00000515728	18069546	18069713
ENSE00000515732	18062181	18062277
ENSE00000690033	18061122	18061197
ENSE00000690035	18063876	18064010
ENSE00000690061	18066542	18066697
ENSE00000690062	18068389	18068526
ENSE00000690064	18072112	18072349
ENSE00000690066	18073517	18073599
ENSE00000690067	18075749	18075868
ENSE00000690086	18076297	18076327
ENSE00000690087	18077516	18077655
ENSE00000690088	18080832	18081001
ENSE00000690089	18082150	18082264
ENSE00000690090	18083432	18083491
ENSE00000871075	18059894	18060085
ENSE00002990248	18058995	18059613
ENSE00003057410	18086760	18086934

Expression profiles

Bgee: expression breadth ubiquitous, 177 present calls, max score 94.41.

FANTOM5 (CAGE): breadth broad, TPM avg 2.2056 / max 78.3808, expressed in 364 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
179909	1.5612	315
179910	0.5347	195
179912	0.0589	30
179908	0.0508	36

Top tissues by expression

268 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	94.41	gold quality
leukocyte	CL:0000738	88.00	gold quality
blood	UBERON:0000178	87.98	gold quality
monocyte	CL:0000576	87.94	gold quality
mononuclear cell	CL:0000842	87.73	gold quality
spleen	UBERON:0002106	82.46	gold quality
lymph node	UBERON:0000029	82.22	gold quality
vermiform appendix	UBERON:0001154	77.73	gold quality
buccal mucosa cell	CL:0002336	76.86	gold quality
amniotic fluid	UBERON:0000173	76.02	silver quality
palpebral conjunctiva	UBERON:0001812	74.93	gold quality
caecum	UBERON:0001153	74.65	gold quality
epithelium of nasopharynx	UBERON:0001951	73.06	silver quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	73.06	gold quality
superficial temporal artery	UBERON:0001614	71.95	silver quality
small intestine Peyer’s patch	UBERON:0003454	71.37	gold quality
tendon of biceps brachii	UBERON:0008188	70.61	silver quality
parotid gland	UBERON:0001831	70.54	gold quality
bone marrow	UBERON:0002371	70.08	gold quality
small intestine	UBERON:0002108	69.97	gold quality
upper lobe of left lung	UBERON:0008952	69.93	gold quality
jejunal mucosa	UBERON:0000399	69.84	silver quality
gall bladder	UBERON:0002110	69.59	gold quality
upper lobe of lung	UBERON:0008948	69.47	gold quality
rectum	UBERON:0001052	68.97	gold quality
bone marrow cell	CL:0002092	68.84	silver quality
nasal cavity epithelium	UBERON:0005384	68.33	gold quality
mucosa of paranasal sinus	UBERON:0005030	68.11	gold quality
biceps brachii	UBERON:0001507	67.98	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	67.78	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	4.05

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F1, FOXC1, GATA3, HAND1, IRF1, IRF3, MAF, SIRPA, SPI1, STAT1

miRNA regulators (miRDB)

18 targeting IL12RB1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-2052	99.79	69.37	2031
HSA-MIR-6794-5P	99.76	66.38	1048
HSA-MIR-3156-3P	99.76	66.72	939
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-1260A	99.61	66.67	1098
HSA-MIR-1260B	99.61	66.67	1098
HSA-MIR-6752-5P	99.59	67.32	1243
HSA-MIR-1286	99.09	66.23	1046
HSA-MIR-4651	99.06	67.57	2002
HSA-MIR-4695-5P	99.06	64.87	1151
HSA-MIR-608	98.93	67.83	2013
HSA-MIR-8055	97.62	66.09	1023
HSA-MIR-2467-5P	97.36	67.71	991
HSA-MIR-6775-5P	92.43	61.00	132

Literature-anchored findings (GeneRIF, showing 40)

• IL-12R beta 1- and IFN-gamma R1 signals co-ordinately regulate IFN-gamma production, but only IL-12 negatively controls IL-4 production. IL-12 and IFN-gamma signals are each sufficient for IFN-gamma production but both are needed for optimal production. (PMID:11857344)
• A splice acceptor mutation affecting exon 15 of the IL-12R beta 1 subunit gene results in complete loss of surface expression of this subunit, and impairment of memory CD4 T cells with Th1 effector function. (PMID:12496448)
• Severe Mycobacterium bovis BCG infections in a large series of novel IL-12 receptor beta1 deficient patients and evidence for the existence of partial IL-12 receptor beta1 deficiency. (PMID:12594833)
• These data suggest that the R214-T365-R378 allele, i.e., variation in IL12RB1, contribute to tuberculosis susceptibility in the Japanese population. (PMID:12596048)
• impact of amino acid variations on the three-dimensional structure of the IL-12Rbeta1 protein (PMID:12671732)
• Mutations have no association with the susceptibility to lepromatous leprosy in the Korean population. (PMID:12743658)
• surface expression of nonfunctional IL-12Rbeta1 is related to an IL12RB1 mutation (PMID:15178580)
• IL12RB1 polymorphisms might influence the risk of development of pulmonary tuberculosis in adults (PMID:15243935)
• Interleukin-12 receptor beta 1 codon 378 gene polymorphism is not correlated with endometriosis development. (PMID:16084898)
• In individuals with the -111T/T genotype, reduced IL-12Rbeta1 expression may lead to increased Th2 cytokine production in the skin and contribute to the development of Atopic dermatitis and other subsequent allergic diseases. (PMID:16159888)
• Genetic variants of IL12RB1, at least in part, confer genetic susceptibility to TB, and are associated with the progression of the disease, in Japanese. (PMID:17284226)
• IL12B promoter heterozygosity was associated with protection from tuberculosis in BCG-vaccinated individuals, supporting the role that IL-23, of which IL12B encodes a subunit, plays in generation of memory T cells (PMID:17392024)
• A twofold increase in the percentage of CD4-resting T cells expressing IL-12Rbeta1 and IL-18Ralpha from HIV-1-infected patients; deregulation of the IL-12 and IL-18 pathways may play a role in the immunopathogenesis of HIV-1 infection. (PMID:17403771)
• data indicate that genetic variants of IL12RB1confer genetic susceptibility to SARS infection, but not necessary associated with the progression of the disease in Chinese population (PMID:18478121)
• IL-12Rbeta1 gene polymorphisms do not appear to be responsible for host susceptibility to nontuberculous mycobacterial lung disease in a Korean population. (PMID:18493823)
• IL-12Rbeta1- and STAT-3–dependent signals play a key role in the differentiation and/or expansion of human IL-17-producing T cell populations in vivo. (PMID:18591412)
• analysis of a known (c.1623_1624delGCinsTT) and a novel mutation (c.65_68delCTGC of exon2) of the Interleukin-12 Receptor-beta1 gene in a patient with a fatal case of relapsing cervical lymphadenopathy due to Mycobacterium avium [case report] (PMID:18940359)
• A common haplotype spanning 1.45-3.51Mb was shared by all chromosomes carrying mutation 1623_1624delinsTT, an IL12RB1 mutation, which results in Mendelian Susceptibility to Mycobacterial Diseases; mutation was not detected on 100 control chromosomes. (PMID:19460324)
• novel nonsense mutation in exon 4 results in protein deficiency and increased susceptibility to bacterial infections (PMID:19839503)
• rs438421 (IVS12+1266T/C) SNP and the haplotype CCA (rs375947, rs438421, and rs1870063) significantly associated with atopic dermatitis (PMID:20060272)
• first cases in Mexico of patients with BCG disease traced to a mutation in the IL12RB1 gene, with a fatal outcome (PMID:20171917)
• Coupled regulation of interleukin-12 receptor beta-1 of CD8+ central memory and CCR7-negative (PMID:20345976)
• study has shown strong associations between polymorphisms in the genes of IL12A and IL12RB1 and protection from severe malarial anemia in Kenyan children (PMID:20350312)
• autosomal recessive IL12Rbeta1 deficiency who suffered from sepsis attributable to Klebsiella pneumoniae. (PMID:20855390)
• Our data suggest that the effect of breast-feeding on food sensitization (FS) was modified by SNPs in the IL12RB1, TLR9, and TSLP genes both individually and jointly. (PMID:21689850)
• IL12RB1 polymorphisms may affect IL-12 and IL-23 binding and downstream effects, which are critical cytokines in the cell-mediated immune response to measles vaccine. (PMID:22504412)
• Data indicate that IL-12B gene rs3212227 CC/AC and IL-12Rbeta1 gene 378 GG/GC genotypes, which associated with decreased IL-12p40 level, may contribute to esophageal cancer susceptibility. (PMID:22740240)
• IL12RB1 is located on autosomal chromosome 19 at location 19p13.1 and comprises exons 1-9, 9b, and 10-17. IL12RB1 isoform 2 is distinct from isoform 1 and is derived from alternate 3’ exon inclusion. (PMID:23024274)
• The IL1B gene -5839C > T and IL4R 1902A > G polymorphisms and IL12RB1 -1094A/-641C and TNF -1031 T/-863A/-857 T/-308 G/-238 G haplotypes were associated with malaria susceptibility. (PMID:23217179)
• Although SNPs of the IL12RB1 gene do not seem to convey some genetic predisposition for hidradenitis suppurativa, they impact considerably on the clinical phenotype of the disease. (PMID:23557799)
• Results suggest a relationship between certain TNF-alpha and IL12B polymorphisms and the short-term response to anti-TNF-alpha drugs. (PMID:23662788)
• A review of the molecular genetics of all known IL12RB1 mutations and variants. (PMID:23864330)
• IL-12Rbeta1 expression on the cell surface was negligible or absent. (PMID:23952477)
• IL12Rbeta1 expression is lacking on CD8+ T and natural killer (NK) cell surface in a 33-year-old patient with Mycobacterium tilburgii infection. (PMID:24114017)
• Genetic variations of IL-12B, IL-12Rbeta1, IL-12Rbeta2 in Behcet’s disease and VKH syndrome. (PMID:24859272)
• Strong association of rs438421 in the IL-12Rbeta1 gene with Allergic rhinitis in Chinese was demonstrated . The GG genotype of rs438421 was validated as stimulus factors to AR, while the AG genotype of rs438421 was confirmed as protective factors to AR. (PMID:24997981)
• SNP rs2305743 in IL12RB1 was associated with systemic sclerosis. (PMID:25199642)
• The IL-23/IL-23R/IL-12Rbeta1 complex formation does not follow the classical “site I-II-III” architectural paradigm. (PMID:25371211)
• we describe cosegregation of a heterozygous germline defect in IL12RB1 and gastric cancer development in a family with IL-12Rbeta1 deficiency (PMID:25467645)
• individual variability in IL12RB1 function is introduced at the epigenetic, genomic polymorphism, and mRNA splicing levels [review] (PMID:25516297)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	ghrb	ENSDARG00000007671
danio_rerio	il11ra	ENSDARG00000026736
danio_rerio	lifrb	ENSDARG00000039863
danio_rerio	ghra	ENSDARG00000054771
danio_rerio	lifra	ENSDARG00000098857
danio_rerio	il6r	ENSDARG00000104474
mus_musculus	Il12rb1	ENSMUSG00000000791
rattus_norvegicus	Il12rb1	ENSRNOG00000019216

Paralogs (23): CRLF1 (ENSG00000006016), IL12RB2 (ENSG00000081985), IL5RA (ENSG00000091181), IL27RA (ENSG00000104998), EBI3 (ENSG00000105246), GHR (ENSG00000112964), PRLR (ENSG00000113494), LIFR (ENSG00000113594), LEPR (ENSG00000116678), CSF3R (ENSG00000119535), CNTFR (ENSG00000122756), IL13RA2 (ENSG00000123496), IL13RA1 (ENSG00000131724), IL6ST (ENSG00000134352), IL11RA (ENSG00000137070), OSMR (ENSG00000145623), IL2RG (ENSG00000147168), IL6R (ENSG00000160712), IL23R (ENSG00000162594), IL31RA (ENSG00000164509), IL3RA (ENSG00000185291), CSF2RA (ENSG00000198223), CRLF2 (ENSG00000205755)

Protein

Protein identifiers

Interleukin-12 receptor subunit beta-1 — P42701 (reviewed: P42701)

Alternative names: IL-12 receptor beta component

All UniProt accessions (4): P42701, M0QX06, M0R382, X6RGM1

UniProt curated annotations — full annotation on UniProt →

Function. Functions as an interleukin receptor which binds interleukin-12 with low affinity and is involved in IL12 transduction. Associated with IL12RB2 it forms a functional, high affinity receptor for IL12. Also associates with IL23R to form the interleukin-23 receptor which functions in IL23 signal transduction probably through activation of the Jak-Stat signaling cascade.

Subunit / interactions. Dimer or oligomer; disulfide-linked. Interacts with IL12RB2 to form the high affinity IL12 receptor. Heterodimer with IL23R; in presence of IL23. The heterodimer forms the IL23 receptor.

Subcellular location. Membrane.

Disease relevance. Immunodeficiency 30 (IMD30) [MIM:614891] A form of Mendelian susceptibility to mycobacterial disease, a rare condition caused by impairment of interferon-gamma mediated immunity. It is characterized by predisposition to illness caused by moderately virulent mycobacterial species, such as Bacillus Calmette-Guerin (BCG) vaccine, environmental non-tuberculous mycobacteria, and by the more virulent Mycobacterium tuberculosis. Other microorganisms rarely cause severe clinical disease in individuals with susceptibility to mycobacterial infections, with the exception of Salmonella which infects less than 50% of these individuals. Clinical outcome severity depends on the degree of impairment of interferon-gamma mediated immunity. Some patients die of overwhelming mycobacterial disease with lepromatous-like lesions in early childhood, whereas others develop, later in life, disseminated but curable infections with tuberculoid granulomas. IMD30 has low penetrance, and affected individuals have relatively mild disease and good prognosis. BCG disease and salmonellosis are the most frequent infections in IMD30 patients. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The WSXWS motif appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif is required for JAK interaction and/or activation.

Similarity. Belongs to the type I cytokine receptor family. Type 2 subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
P42701-1	1, Long	yes
P42701-2	2, Short
P42701-3	3

RefSeq proteins (4): NP_001276952, NP_001276953, NP_005526, NP_714912 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003529	Hematopoietin_rcpt_Gp130_CS	Conserved_site
IPR003961	FN3_dom	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR036116	FN3_sf	Homologous_superfamily

Pfam: PF00041

UniProt features (77 total): strand 37, sequence variant 8, glycosylation site 6, helix 5, domain 5, splice variant 3, turn 3, short sequence motif 2, topological domain 2, signal peptide 1, chain 1, region of interest 1, compositionally biased region 1, disulfide bond 1, transmembrane region 1

Structure

Experimental structures (PDB)

7 structures.

PDB	Method	Resolution (Å)
6WDP	X-RAY DIFFRACTION	2.01
8C7M	X-RAY DIFFRACTION	2.56
6WDQ	X-RAY DIFFRACTION	3.4
8YI7	ELECTRON MICROSCOPY	3.57
8OE4	ELECTRON MICROSCOPY	3.6
8XRP	ELECTRON MICROSCOPY	3.75
8ODX	X-RAY DIFFRACTION	4.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P42701-F1	77.84	0.33

Antibody-complex structures (SAbDab): 2 — 8C7M, 8ODX

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (1): 52–62

Glycosylation sites (6): 121, 329, 346, 352, 442, 456

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-9020591	Interleukin-12 signaling
R-HSA-9020933	Interleukin-23 signaling

MSigDB gene sets: 474 (showing top): GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, GOBP_POSITIVE_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOBP_REGULATION_OF_ALPHA_BETA_T_CELL_ACTIVATION, GOBP_POSITIVE_REGULATION_OF_HEMOPOIESIS, GOBP_POSITIVE_REGULATION_OF_CELL_FATE_COMMITMENT, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_REGULATION_OF_DEFENSE_RESPONSE_TO_VIRUS, GOBP_RESPONSE_TO_PEPTIDE, GOBP_T_CELL_ACTIVATION_INVOLVED_IN_IMMUNE_RESPONSE, GOBP_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOBP_ALPHA_BETA_T_CELL_DIFFERENTIATION, GOCC_CELL_SURFACE, GOBP_LEUKOCYTE_MEDIATED_CYTOTOXICITY, GOBP_REGULATION_OF_T_HELPER_CELL_DIFFERENTIATION

GO Biological Process (16): positive regulation of T cell mediated cytotoxicity (GO:0001916), positive regulation of defense response to virus by host (GO:0002230), positive regulation of T-helper 1 type immune response (GO:0002827), signal transduction (GO:0007165), positive regulation of cell population proliferation (GO:0008284), cytokine-mediated signaling pathway (GO:0019221), positive regulation of type II interferon production (GO:0032729), interleukin-12-mediated signaling pathway (GO:0035722), interleukin-23-mediated signaling pathway (GO:0038155), positive regulation of activated T cell proliferation (GO:0042104), positive regulation of memory T cell differentiation (GO:0043382), cellular response to type II interferon (GO:0071346), positive regulation of T-helper 17 type immune response (GO:2000318), positive regulation of T-helper 17 cell lineage commitment (GO:2000330), cell surface receptor signaling pathway (GO:0007166), T-helper 1 cell differentiation (GO:0045063)

GO Molecular Function (8): cytokine receptor activity (GO:0004896), coreceptor activity (GO:0015026), interleukin-12 receptor activity (GO:0016517), cytokine binding (GO:0019955), interleukin-12 receptor binding (GO:0005143), protein binding (GO:0005515), interleukin-23 binding (GO:0042019), interleukin-23 receptor activity (GO:0042020)

GO Cellular Component (6): plasma membrane (GO:0005886), external side of plasma membrane (GO:0009897), interleukin-12 receptor complex (GO:0042022), signaling receptor complex (GO:0043235), interleukin-23 receptor complex (GO:0072536), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Interleukin-12 family signaling	2

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytokine-mediated signaling pathway	3
positive regulation of adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains	2
T-helper 1 type immune response	2
cellular response to cytokine stimulus	2
cytokine binding	2
cytokine receptor activity	2
plasma membrane signaling receptor complex	2
positive regulation of leukocyte mediated cytotoxicity	1
T cell mediated cytotoxicity	1
regulation of T cell mediated cytotoxicity	1
positive regulation of T cell mediated immunity	1
regulation of defense response to virus by host	1
regulation of T-helper 1 type immune response	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
cell surface receptor signaling pathway	1
positive regulation of cytokine production	1
type II interferon production	1
regulation of type II interferon production	1
cellular response to interleukin-12	1
positive regulation of T cell proliferation	1
regulation of activated T cell proliferation	1
activated T cell proliferation	1
positive regulation of immune effector process	1
memory T cell differentiation	1
regulation of memory T cell differentiation	1
positive regulation of T cell differentiation	1
positive regulation of immune response	1
response to type II interferon	1
T-helper 17 type immune response	1
regulation of T-helper 17 type immune response	1
positive regulation of cell fate commitment	1
T-helper 17 cell lineage commitment	1
positive regulation of T-helper 17 cell differentiation	1

Protein interactions and networks

STRING

2141 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
IL12RB1	IL12RB2	Q99665	999
IL12RB1	IL23R	Q5VWK5	998
IL12RB1	TYK2	P29597	997
IL12RB1	JAK2	O60674	988
IL12RB1	IL27RA	Q6UWB1	960
IL12RB1	IL23A	Q9NPF7	916
IL12RB1	STAT4	Q14765	901
IL12RB1	IFNGR2	P38484	894
IL12RB1	IFNGR1	P15260	859
IL12RB1	IFNG	P01579	853
IL12RB1	IL18R1	Q13478	830
IL12RB1	TBX21	Q9UL17	802
IL12RB1	IL12B	P29460	798
IL12RB1	IL17A	Q16552	796
IL12RB1	STAT1	P42224	780

IntAct

14 interactions, top by confidence:

A	B	Type	Score
IL12RB1	IL23R	psi-mi:“MI:0915”(physical association)	0.400
IL12RB1	IL12A	psi-mi:“MI:0915”(physical association)	0.400
SNRPD3	IL12RB1	psi-mi:“MI:0915”(physical association)	0.370
IL12RB1	CFTR	psi-mi:“MI:0915”(physical association)	0.370
	IL12RB1	psi-mi:“MI:0914”(association)	0.350
IL12RB1	HSPA5	psi-mi:“MI:0914”(association)	0.350
IL12RB1	ZNF185	psi-mi:“MI:0914”(association)	0.350
BTRC	IL12RB1	psi-mi:“MI:0914”(association)	0.350
DCP2	VSIG8	psi-mi:“MI:0914”(association)	0.350
IL12RB1	PLAU	psi-mi:“MI:0914”(association)	0.350
KCMF1	CIT	psi-mi:“MI:0914”(association)	0.350
PRELP	IL12RB1	psi-mi:“MI:0914”(association)	0.350

BioGRID (104): TUBB4A (Affinity Capture-MS), TUBB3 (Affinity Capture-MS), TUBB8 (Affinity Capture-MS), HSPA5 (Affinity Capture-MS), TUBA4A (Affinity Capture-MS), TUBA1A (Affinity Capture-MS), CBWD1 (Affinity Capture-MS), TXNIP (Affinity Capture-MS), LOXL2 (Affinity Capture-MS), ISOC2 (Affinity Capture-MS), RAD51C (Affinity Capture-MS), CRELD2 (Affinity Capture-MS), TRMT44 (Affinity Capture-MS), TXNIP (Affinity Capture-MS), ISOC2 (Affinity Capture-MS)

ESM2 similar proteins: A5PJ93, A6NH21, A6QQ85, A8MVS5, B0FP48, E5RIL1, E9PY61, O75631, P0C6B2, P38574, P42701, P57785, Q08351, Q15904, Q561R0, Q5T7M4, Q63148, Q64280, Q6AZ51, Q6IEE6, Q6PRD1, Q6ZVW7, Q75VT8, Q7TN60, Q80YF6, Q864V4, Q867C0, Q8BH06, Q8BX43, Q8CHT6, Q8CJ26, Q8IZI9, Q8IZJ0, Q8K4C2, Q8K5A9, Q8N3T6, Q8N9H8, Q8NAC3, Q8NFR9, Q8R2Z0

Diamond homologs: P42701, Q60837, Q64487

SIGNOR signaling

5 interactions.

A	Effect	B	Mechanism
IL12B	up-regulates	IL12RB1	binding
IL12RB1	“form complex”	“Interleukin-23 receptor-ligand complex”	binding
IL12A	up-regulates	IL12RB1	binding
IL23A	up-regulates	IL12RB1	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

678 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	62
Likely pathogenic	16
Uncertain significance	270
Likely benign	228
Benign	34

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1075342	NM_005535.3(IL12RB1):c.1495C>T (p.Gln499Ter)	Pathogenic
1076653	NM_005535.3(IL12RB1):c.1456C>T (p.Arg486Ter)	Pathogenic
1321308	NM_005535.3(IL12RB1):c.369dup (p.Glu124fs)	Pathogenic
1375086	NM_005535.3(IL12RB1):c.635G>A (p.Arg212Gln)	Pathogenic
1405092	NM_005535.3(IL12RB1):c.493C>T (p.Gln165Ter)	Pathogenic
1452269	NM_005535.3(IL12RB1):c.1398G>A (p.Trp466Ter)	Pathogenic
1455005	NM_005535.3(IL12RB1):c.790C>T (p.Gln264Ter)	Pathogenic
1456084	NC_000019.9:g.(?18177332)(18177527_?)del	Pathogenic
1456856	NM_005535.3(IL12RB1):c.699del (p.Glu234fs)	Pathogenic
1456899	NM_005535.3(IL12RB1):c.942C>A (p.Tyr314Ter)	Pathogenic
1526194	NM_005535.3(IL12RB1):c.1561C>T (p.Arg521Ter)	Pathogenic
155909	NM_005535.3(IL12RB1):c.1061CCA[1] (p.Thr355del)	Pathogenic
1687504	NM_005535.3(IL12RB1):c.1238_1239del (p.Cys413fs)	Pathogenic
2015497	NM_005535.3(IL12RB1):c.1690dup (p.Val564fs)	Pathogenic
2094134	NM_005535.3(IL12RB1):c.395_398dup (p.Tyr134fs)	Pathogenic
2097232	NM_005535.3(IL12RB1):c.1327+1del	Pathogenic
2098924	NM_005535.3(IL12RB1):c.304C>T (p.Gln102Ter)	Pathogenic
2138260	NM_005535.3(IL12RB1):c.64+2T>G	Pathogenic
2425363	NC_000019.9:g.(?18171912)(18177527_?)del	Pathogenic
2736848	NM_005535.3(IL12RB1):c.1386_1387del (p.Ser463fs)	Pathogenic
2736850	NM_005535.3(IL12RB1):c.64+1G>T	Pathogenic
2786378	NM_005535.3(IL12RB1):c.1897G>T (p.Glu633Ter)	Pathogenic
2812854	NM_005535.3(IL12RB1):c.1791+1G>C	Pathogenic
2908739	NM_005535.3(IL12RB1):c.946del (p.Val316fs)	Pathogenic
3353142	NM_005535.3(IL12RB1):c.1624C>T (p.Gln542Ter)	Pathogenic
3613722	NM_005535.3(IL12RB1):c.1207C>T (p.Arg403Ter)	Pathogenic
3696660	NM_005535.3(IL12RB1):c.1593G>A (p.Trp531Ter)	Pathogenic
3703921	NM_005535.3(IL12RB1):c.1879G>T (p.Glu627Ter)	Pathogenic
3712614	NM_005535.3(IL12RB1):c.1202G>A (p.Trp401Ter)	Pathogenic
3723486	NM_005535.3(IL12RB1):c.853C>T (p.Gln285Ter)	Pathogenic

SpliceAI

3103 predictions. Top by Δscore:

Variant	Effect	Δscore
19:18060081:CAAGT:C	acceptor_gain	1.0000
19:18060085:TCT:T	acceptor_loss	1.0000
19:18060086:C:CC	acceptor_gain	1.0000
19:18060086:CT:C	acceptor_loss	1.0000
19:18061193:CGGCC:C	acceptor_gain	1.0000
19:18061194:GGCCC:G	acceptor_loss	1.0000
19:18061195:GCCC:G	acceptor_loss	1.0000
19:18061196:CC:C	acceptor_gain	1.0000
19:18061196:CCCT:C	acceptor_loss	1.0000
19:18061197:CC:C	acceptor_gain	1.0000
19:18061197:CCT:C	acceptor_loss	1.0000
19:18061198:CTGG:C	acceptor_loss	1.0000
19:18061199:T:C	acceptor_loss	1.0000
19:18066698:C:CC	acceptor_gain	1.0000
19:18068522:GGTTG:G	acceptor_gain	1.0000
19:18068524:TTG:T	acceptor_gain	1.0000
19:18068525:TG:T	acceptor_gain	1.0000
19:18068526:GC:G	acceptor_loss	1.0000
19:18068527:C:CC	acceptor_gain	1.0000
19:18069540:CATTA:C	donor_loss	1.0000
19:18069541:ATTAC:A	donor_loss	1.0000
19:18069542:TTAC:T	donor_loss	1.0000
19:18069543:TA:T	donor_loss	1.0000
19:18069544:A:AC	donor_gain	1.0000
19:18069544:AC:A	donor_gain	1.0000
19:18069544:ACCC:A	donor_loss	1.0000
19:18069545:C:CC	donor_gain	1.0000
19:18069545:CC:C	donor_gain	1.0000
19:18069548:ATT:A	donor_gain	1.0000
19:18069709:TGGTT:T	acceptor_gain	1.0000

AlphaMissense

4280 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:18082197:C:A	W64C	0.997
19:18082197:C:G	W64C	0.997
19:18075774:C:A	W225C	0.991
19:18075774:C:G	W225C	0.991
19:18066627:C:A	W466C	0.989
19:18066627:C:G	W466C	0.989
19:18077588:C:A	W159C	0.988
19:18077588:C:G	W159C	0.988
19:18082199:A:G	W64R	0.986
19:18082199:A:T	W64R	0.986
19:18062231:G:C	S555R	0.985
19:18062231:G:T	S555R	0.985
19:18062233:T:G	S555R	0.985
19:18075776:A:G	W225R	0.984
19:18075776:A:T	W225R	0.984
19:18077522:C:A	W181C	0.982
19:18077522:C:G	W181C	0.982
19:18066629:A:G	W466R	0.981
19:18066629:A:T	W466R	0.981
19:18080945:A:C	F99C	0.980
19:18077590:A:G	W159R	0.978
19:18077590:A:T	W159R	0.978
19:18080944:G:C	F99L	0.977
19:18080944:G:T	F99L	0.977
19:18080946:A:G	F99L	0.977
19:18082204:C:G	C62S	0.977
19:18082205:A:T	C62S	0.977
19:18080899:C:A	W114C	0.976
19:18080899:C:G	W114C	0.976
19:18063932:C:G	R521P	0.975

dbSNP variants (sampled 300 via entrez): RS1000093999 (19:18096425 C>A,T), RS1000108044 (19:18097237 G>A), RS1000179495 (19:18058831 G>A), RS1000363632 (19:18075121 G>A), RS1000479714 (19:18075507 C>G,T), RS1000514398 (19:18064075 A>G), RS1000593405 (19:18080388 G>A,C), RS1000871640 (19:18090785 G>A,C), RS1000894117 (19:18084233 GTCCATCCATCCACGTATTCATCCA>G), RS1000950402 (19:18090607 C>A,G,T), RS1001000397 (19:18079609 A>G), RS1001005168 (19:18096498 T>C), RS1001088386 (19:18084241 A>T), RS1001440913 (19:18062826 T>G), RS1001466430 (19:18090999 C>T)

Disease associations

OMIM: gene MIM:601604 | disease phenotypes: MIM:614891, MIM:209950

GenCC curated gene-disease

Disease	Classification	Inheritance
Mendelian susceptibility to mycobacterial diseases due to complete IL12RB1 deficiency	Strong	Autosomal recessive

Mondo (2): Mendelian susceptibility to mycobacterial diseases due to complete IL12RB1 deficiency (MONDO:0013955), immunodeficiency 27A (MONDO:0008856)

Orphanet (3): Mendelian susceptibility to mycobacterial diseases due to complete IL12RB1 deficiency (Orphanet:319552), Autosomal recessive mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR1 deficiency (Orphanet:319569), Mendelian susceptibility to mycobacterial diseases due to complete IFNgammaR1 deficiency (Orphanet:99898)

HPO phenotypes

58 total (30 of 58 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000820	Abnormality of the thyroid gland
HP:0000939	Osteoporosis
HP:0000952	Jaundice
HP:0000953	Hyperpigmentation of the skin
HP:0000989	Pruritus
HP:0001114	Xanthelasma
HP:0001262	Excessive daytime somnolence
HP:0001278	Orthostatic hypotension
HP:0001394	Cirrhosis
HP:0001395	Hepatic fibrosis
HP:0001399	Hepatic failure
HP:0001402	Hepatocellular carcinoma
HP:0001409	Portal hypertension
HP:0001541	Ascites
HP:0001744	Splenomegaly
HP:0002040	Esophageal varix
HP:0002090	Pneumonia
HP:0002240	Hepatomegaly
HP:0002360	Sleep disturbance
HP:0002480	Hepatic encephalopathy
HP:0002570	Steatorrhea
HP:0002608	Celiac disease
HP:0002613	Biliary cirrhosis
HP:0002719	Recurrent infections
HP:0002721	Immunodeficiency
HP:0002742	Recurrent Klebsiella infections
HP:0002840	Lymphadenitis
HP:0002841	Recurrent fungal infections
HP:0002908	Conjugated hyperbilirubinemia

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST001918_4	Pulmonary function in asthmatics	9.000000e-06
GCST008550_33	Mental health study participation (completed survey)	4.000000e-08
GCST009131_23	Systemic sclerosis	5.000000e-10
GCST009876_4	Systemic sclerosis	4.000000e-11
GCST90020029_17	Waist circumference adjusted for body mass index	4.000000e-08

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0003892	pulmonary function measurement
EFO:0010130	health study participation
EFO:0007789	BMI-adjusted waist circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4523226 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: catalytic receptor — IL-12 receptor family

CTD chemical–gene interactions

30 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation	2
Tetradecanoylphorbol Acetate	affects cotreatment, decreases reaction, increases expression	2
GSK-J4	decreases expression	1
bisphenol F	decreases methylation	1
fulvic acid	affects cotreatment, decreases reaction, increases expression	1
bisphenol A	decreases methylation	1
benzo(e)pyrene	increases methylation	1
4-hydroxy-2-nonenal	decreases expression	1
3,3-dimethylallyl pyrophosphate	increases expression	1
di-n-butylphosphoric acid	affects expression	1
bisphenol S	decreases methylation	1
(+)-JQ1 compound	decreases expression	1
Calcimycin	affects cotreatment, decreases reaction, increases expression	1
Resveratrol	decreases expression, affects cotreatment	1
Acetaminophen	decreases expression	1
Arsenic	affects methylation	1
Butyrates	decreases expression	1
Cholera Toxin	decreases expression	1
Cisplatin	increases expression	1
Copper	affects cotreatment, decreases expression	1
Dexamethasone	decreases expression	1
Ethyl Methanesulfonate	increases expression	1
Formaldehyde	increases expression	1
Methapyrilene	increases methylation	1
Methyl Methanesulfonate	increases expression	1
Nickel	increases expression	1
Dinoprostone	decreases expression	1
Aflatoxin B1	affects methylation, increases methylation	1
Antirheumatic Agents	decreases expression	1
Cadmium Chloride	increases expression	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4418004	Binding	Binding affinity to human recombinant interleukin-12 receptor beta1 by SPR assay	Oral peptide inhibitors of interleukin-23 receptor and their use to treat inflammatory bowel diseases

Cellosaurus cell lines

4 cell lines: 3 transformed cell line, 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A8CH	HEK-Blue IL-23	Transformed cell line	Female
CVCL_E4JC	Genomeditech HEK-293 H_IL23 Reporter	Transformed cell line	Female
CVCL_E7RR	iLite IL-23 Assay Ready Cells	Cancer cell line	Female
CVCL_UF31	HEK-Blue IL-12	Transformed cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.