INAFM2
gene geneOn this page
Also known as OGU1
Summary
INAFM2 (InaF motif containing 2, HGNC:35165) is a protein-coding gene on chromosome 15q15.1, encoding Putative transmembrane protein INAFM2 (P0DMQ5).
Predicted to be located in membrane.
Source: NCBI Gene 100505573 — RefSeq curated summary.
At a glance
- GWAS associations: 4
- MANE Select transcript:
NM_001301268
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:35165 |
| Approved symbol | INAFM2 |
| Name | InaF motif containing 2 |
| Location | 15q15.1 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | OGU1 |
| Ensembl gene | ENSG00000259330 |
| Ensembl biotype | protein_coding |
| Entrez | 100505573 |
Gene structure
Transcript identifiers
Ensembl transcripts: 2 — 1 protein_coding_CDS_not_defined, 1 protein_coding
ENST00000560415, ENST00000638170
RefSeq mRNA: 1 — MANE Select: NM_001301268
NM_001301268
CCDS: CCDS86448
Canonical transcript exons
ENST00000638170 — 1 exons
| Exon | Start | End |
|---|---|---|
| ENSE00003807691 | 40323692 | 40326715 |
Expression profiles
Bgee: expression breadth ubiquitous, 230 present calls, max score 96.33.
FANTOM5 (CAGE): breadth ubiquitous, TPM avg 6.5507 / max 112.9415, expressed in 1680 samples.
FANTOM5 promoters (3 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 146091 | 4.4533 | 1536 |
| 146090 | 1.1950 | 614 |
| 207473 | 0.9023 | 580 |
Top tissues by expression
250 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| right coronary artery | UBERON:0001625 | 96.33 | gold quality |
| muscle layer of sigmoid colon | UBERON:0035805 | 94.39 | gold quality |
| monocyte | CL:0000576 | 94.23 | gold quality |
| leukocyte | CL:0000738 | 93.93 | gold quality |
| popliteal artery | UBERON:0002250 | 93.89 | gold quality |
| tibial artery | UBERON:0007610 | 93.89 | gold quality |
| left coronary artery | UBERON:0001626 | 93.53 | gold quality |
| descending thoracic aorta | UBERON:0002345 | 93.43 | gold quality |
| aorta | UBERON:0000947 | 93.41 | gold quality |
| coronary artery | UBERON:0001621 | 93.15 | gold quality |
| thoracic aorta | UBERON:0001515 | 92.89 | gold quality |
| ascending aorta | UBERON:0001496 | 92.85 | gold quality |
| cardiac muscle of right atrium | UBERON:0003379 | 92.59 | silver quality |
| mucosa of stomach | UBERON:0001199 | 92.51 | gold quality |
| right atrium auricular region | UBERON:0006631 | 91.78 | gold quality |
| esophagogastric junction muscularis propria | UBERON:0035841 | 91.55 | gold quality |
| cardiac atrium | UBERON:0002081 | 91.51 | gold quality |
| left uterine tube | UBERON:0001303 | 91.44 | gold quality |
| left ventricle myocardium | UBERON:0006566 | 90.91 | silver quality |
| lower esophagus muscularis layer | UBERON:0035833 | 90.58 | gold quality |
| lower esophagus | UBERON:0013473 | 90.55 | gold quality |
| right testis | UBERON:0004534 | 90.33 | gold quality |
| left lobe of thyroid gland | UBERON:0001120 | 90.03 | gold quality |
| heart | UBERON:0000948 | 89.92 | gold quality |
| left testis | UBERON:0004533 | 89.89 | gold quality |
| endothelial cell | CL:0000115 | 89.68 | silver quality |
| heart left ventricle | UBERON:0002084 | 89.68 | gold quality |
| right lobe of thyroid gland | UBERON:0001119 | 89.45 | gold quality |
| tibialis anterior | UBERON:0001385 | 89.43 | silver quality |
| myocardium | UBERON:0002349 | 89.37 | silver quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 8.23 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
88 targeting INAFM2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-126-5P | 100.00 | 72.71 | 3180 |
| HSA-LET-7F-2-3P | 99.98 | 70.98 | 2588 |
| HSA-MIR-1185-1-3P | 99.98 | 71.04 | 2593 |
| HSA-MIR-1185-2-3P | 99.98 | 71.04 | 2593 |
| HSA-MIR-3148 | 99.97 | 75.06 | 6478 |
| HSA-MIR-3688-3P | 99.97 | 72.02 | 2834 |
| HSA-MIR-3658 | 99.96 | 73.87 | 4379 |
| HSA-MIR-205-3P | 99.92 | 69.92 | 3165 |
| HSA-MIR-6508-5P | 99.92 | 70.67 | 2465 |
| HSA-MIR-9902 | 99.89 | 69.15 | 2250 |
| HSA-MIR-548E-5P | 99.89 | 72.73 | 4486 |
| HSA-MIR-8062 | 99.88 | 68.43 | 995 |
| HSA-MIR-5582-3P | 99.86 | 72.48 | 4221 |
| HSA-MIR-8067 | 99.86 | 69.59 | 2260 |
| HSA-MIR-1323 | 99.83 | 69.89 | 2471 |
| HSA-MIR-944 | 99.82 | 70.85 | 3042 |
| HSA-MIR-4694-3P | 99.79 | 69.53 | 2640 |
| HSA-MIR-3150A-3P | 99.76 | 64.44 | 1640 |
| HSA-MIR-6763-5P | 99.76 | 64.68 | 1767 |
| HSA-MIR-548O-3P | 99.74 | 69.30 | 2228 |
| HSA-MIR-132-3P | 99.73 | 70.56 | 1424 |
| HSA-MIR-212-3P | 99.73 | 70.65 | 1424 |
| HSA-MIR-6505-5P | 99.73 | 69.25 | 1595 |
| HSA-MIR-3934-5P | 99.67 | 64.04 | 846 |
| HSA-MIR-3175 | 99.65 | 66.30 | 2031 |
| HSA-MIR-10393-5P | 99.65 | 68.01 | 1368 |
| HSA-MIR-4261 | 99.59 | 70.30 | 3415 |
| HSA-MIR-7106-5P | 99.53 | 67.47 | 3574 |
| HSA-MIR-186-3P | 99.51 | 66.24 | 1685 |
| HSA-MIR-1275 | 99.47 | 67.90 | 2749 |
Literature-anchored findings (GeneRIF, showing 1)
- Interactive associations of the INAFM2 rs67839313 variant and egg consumption with type 2 diabetes mellitus and fasting blood glucose in a Chinese population: A family-based study. (PMID:33333222)
Cross-species orthologs
2 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| mus_musculus | Inafm2 | ENSMUSG00000074918 |
| rattus_norvegicus | Inafm2 | ENSRNOG00000066025 |
Protein
Protein identifiers
Putative transmembrane protein INAFM2 — P0DMQ5 (reviewed: P0DMQ5)
Alternative names: InaF-motif-containing protein 2, Osteogenesis up-regulated transcript 1
All UniProt accessions (1): P0DMQ5
UniProt curated annotations — full annotation on UniProt →
Subcellular location. Membrane.
RefSeq proteins (1): NP_001288197* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR029162 | InaF-motif | Conserved_site |
Pfam: PF15018
UniProt features (7 total): compositionally biased region 3, region of interest 2, chain 1, transmembrane region 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-P0DMQ5-F1 | 59.30 | 0.02 |
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 34 (showing top):
TRAYNOR_RETT_SYNDROM_DN, KINSEY_TARGETS_OF_EWSR1_FLII_FUSION_DN, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_DN, GAVIN_FOXP3_TARGETS_CLUSTER_P7, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_DN, WHITFIELD_CELL_CYCLE_G1_S, LI_INDUCED_T_TO_NATURAL_KILLER_DN, MIR5582_3P, MIR126_5P, MIR4261, MIR205_3P, MIR147B_5P, MIR212_3P, MIR132_3P, MIR593_3P
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (1): membrane (GO:0016020)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
68 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| INAFM2 | NTN5 | Q8WTR8 | 398 |
| INAFM2 | CCDC85A | Q96PX6 | 398 |
| INAFM2 | DISP2 | A7MBM2 | 378 |
| INAFM2 | SINHCAF | Q9NP50 | 375 |
| INAFM2 | C12orf75 | Q8TAD7 | 371 |
| INAFM2 | ATP8B2 | P98198 | 370 |
| INAFM2 | ASB3 | Q9Y575 | 365 |
| INAFM2 | NTN3 | O00634 | 350 |
| INAFM2 | CORO2A | Q92828 | 310 |
| INAFM2 | PLEKHG7 | Q6ZR37 | 305 |
| INAFM2 | ARAP1 | Q96P48 | 272 |
| INAFM2 | KANSL1 | Q7Z3B3 | 268 |
| INAFM2 | FOXN3 | O00409 | 254 |
| INAFM2 | GRK4 | P32298 | 245 |
| INAFM2 | PDS5B | Q9NTI5 | 217 |
IntAct
0 interactions, top by confidence:
BioGRID (1): INAFM2 (Cross-Linking-MS (XL-MS))
ESM2 similar proteins: A0A1B0GUA5, A0A1B0GVQ0, A0A286YF18, A0JNN8, A2VDX9, A5PK62, A6NGB7, A9CBA0, O09800, P04488, P06480, P06764, P07646, P0C171, P0DJK0, P0DJK1, P0DMQ5, P13291, P22389, P36342, P46695, P98162, Q08102, Q1RMT9, Q2HJ59, Q3TYP4, Q5BIR3, Q5EAA5, Q5JTB6, Q5NRQ0, Q6F5E0, Q6VUC0, Q6VUP9, Q703F0, Q765Z5, Q867A9, Q867D0, Q89448, Q8MJW9, Q8TEF2
Diamond homologs: C9JVW0, P0DMQ5
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
951 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 15:40324177:C:A | A41D | 1.000 |
| 15:40324213:T:A | L53H | 1.000 |
| 15:40324152:T:A | W33R | 0.999 |
| 15:40324152:T:C | W33R | 0.999 |
| 15:40324154:G:C | W33C | 0.999 |
| 15:40324154:G:T | W33C | 0.999 |
| 15:40324165:C:A | A37D | 0.999 |
| 15:40324179:T:C | Y42H | 0.999 |
| 15:40324201:C:A | A49D | 0.999 |
| 15:40324204:C:A | A50D | 0.999 |
| 15:40324238:G:C | W61C | 0.999 |
| 15:40324238:G:T | W61C | 0.999 |
| 15:40324162:T:A | L36H | 0.998 |
| 15:40324186:T:C | L44P | 0.998 |
| 15:40324191:G:A | V46M | 0.998 |
| 15:40324192:T:A | V46E | 0.998 |
| 15:40324198:T:C | L48P | 0.998 |
| 15:40324213:T:C | L53P | 0.998 |
| 15:40324216:C:A | A54D | 0.998 |
| 15:40324162:T:C | L36P | 0.997 |
| 15:40324170:G:A | V39M | 0.997 |
| 15:40324186:T:A | L44H | 0.997 |
| 15:40324203:G:C | A50P | 0.997 |
| 15:40324207:T:A | I51N | 0.997 |
| 15:40324213:T:G | L53R | 0.997 |
| 15:40324224:T:C | Y57H | 0.997 |
| 15:40324227:A:C | S58R | 0.997 |
| 15:40324229:C:A | S58R | 0.997 |
| 15:40324229:C:G | S58R | 0.997 |
| 15:40324236:T:A | W61R | 0.997 |
dbSNP variants (sampled 300 via entrez): RS1000261708 (15:40324461 C>T), RS1000469695 (15:40324643 A>G), RS1001042099 (15:40325876 C>T), RS1001056028 (15:40322417 A>C), RS1001261185 (15:40325671 T>G), RS1002263677 (15:40326818 G>C,T), RS1003447197 (15:40323931 G>A,T), RS1003499520 (15:40323723 G>T), RS1003554589 (15:40321709 C>A,T), RS1004004631 (15:40323944 GGGGCCGCCGGGAACCGAGGGCGCC>G), RS1004152747 (15:40323179 G>C), RS1004419405 (15:40322956 C>G), RS1004510482 (15:40324330 C>T), RS1004561386 (15:40324161 C>G,T), RS1005020129 (15:40324972 T>G)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
4 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST003400_19 | Type 2 diabetes | 2.000000e-08 |
| GCST003400_56 | Type 2 diabetes | 2.000000e-10 |
| GCST007847_9 | Type 2 diabetes | 4.000000e-14 |
| GCST010118_103 | Type 2 diabetes | 2.000000e-20 |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
15 total (human), top 15 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| Valproic Acid | affects cotreatment, increases expression, affects expression | 4 |
| Phenylmercuric Acetate | affects cotreatment, increases expression | 2 |
| triphenyl phosphate | affects expression | 1 |
| bisphenol A | decreases expression | 1 |
| trichostatin A | increases expression | 1 |
| di-n-butylphosphoric acid | affects expression | 1 |
| 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | affects cotreatment, increases expression | 1 |
| abrine | increases expression | 1 |
| dorsomorphin | affects cotreatment, increases expression | 1 |
| Cadmium | decreases expression | 1 |
| Doxorubicin | affects expression | 1 |
| Triclosan | decreases expression | 1 |
| Antirheumatic Agents | decreases expression | 1 |
| Okadaic Acid | increases expression | 1 |
| Lactic Acid | decreases expression | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.