IRF4

Summary

IRF4 (interferon regulatory factor 4, HGNC:6119) is a protein-coding gene on chromosome 6p25.3, encoding Interferon regulatory factor 4 (Q15306). Transcriptional activator.

The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene.

Source: NCBI Gene 3662 — RefSeq curated summary.

At a glance

• Gene–disease (curated): combined immunodeficiency (Definitive, ClinGen)
• GWAS associations: 124
• Clinical variants (ClinVar): 357 total — 4 pathogenic
• Phenotypes (HPO): 122
• Druggable target: yes
• Cancer driver (intOGen): activating (oncogene-like) across 5 cancer types
• Transcription factor: yes — 63 downstream targets (CollecTRI)
• MANE Select transcript: NM_002460

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6119
Approved symbol	IRF4
Name	interferon regulatory factor 4
Location	6p25.3
Locus type	gene with protein product
Status	Approved
Aliases	LSIRF
Ensembl gene	ENSG00000137265
Ensembl biotype	protein_coding
OMIM	601900
Entrez	3662

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 6 protein_coding, 3 retained_intron, 1 nonsense_mediated_decay

ENST00000380956, ENST00000468485, ENST00000469834, ENST00000493114, ENST00000495137, ENST00000696871, ENST00000696872, ENST00000696873, ENST00000866553, ENST00000866554

RefSeq mRNA: 2 — MANE Select: NM_002460 NM_001195286, NM_002460

CCDS: CCDS4469, CCDS93847

Canonical transcript exons

ENST00000380956 — 9 exons

Exon	Start	End
ENSE00001964366	401424	401777
ENSE00001990305	398828	398935
ENSE00001990986	405018	405130
ENSE00002181883	393098	393368
ENSE00003683112	395847	395935
ENSE00003692200	394821	395007
ENSE00003968728	391752	391809
ENSE00003968729	407455	411443
ENSE00003968731	397108	397252

Expression profiles

Bgee: expression breadth ubiquitous, 180 present calls, max score 86.75.

FANTOM5 (CAGE): breadth broad, TPM avg 27.2583 / max 3065.5483, expressed in 546 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
65395	27.2279	545
65396	0.0304	18

Top tissues by expression

284 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lymph node	UBERON:0000029	86.75	gold quality
endocervix	UBERON:0000458	86.38	gold quality
vermiform appendix	UBERON:0001154	85.97	gold quality
bone marrow cell	CL:0002092	85.21	gold quality
cartilage tissue	UBERON:0002418	84.85	gold quality
spleen	UBERON:0002106	84.02	gold quality
bone marrow	UBERON:0002371	84.01	gold quality
colonic epithelium	UBERON:0000397	83.46	gold quality
ectocervix	UBERON:0012249	82.84	gold quality
caecum	UBERON:0001153	81.64	gold quality
rectum	UBERON:0001052	81.34	gold quality
superficial temporal artery	UBERON:0001614	80.97	gold quality
ileal mucosa	UBERON:0000331	80.64	gold quality
tonsil	UBERON:0002372	79.85	gold quality
upper leg skin	UBERON:0004262	79.59	gold quality
epithelium of nasopharynx	UBERON:0001951	79.19	silver quality
type B pancreatic cell	CL:0000169	79.04	gold quality
olfactory bulb	UBERON:0002264	79.02	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.69	gold quality
pancreatic ductal cell	CL:0002079	78.00	silver quality
leukocyte	CL:0000738	77.86	gold quality
monocyte	CL:0000576	77.53	gold quality
granulocyte	CL:0000094	77.48	gold quality
mononuclear cell	CL:0000842	77.42	gold quality
mucosa of transverse colon	UBERON:0004991	77.22	gold quality
small intestine Peyer’s patch	UBERON:0003454	76.67	gold quality
buccal mucosa cell	CL:0002336	75.81	silver quality
small intestine	UBERON:0002108	75.42	gold quality
duodenum	UBERON:0002114	74.93	gold quality
uterine cervix	UBERON:0000002	74.78	gold quality

Single-cell (SCXA)

Detected in 10 experiment(s), a significant marker in 10.

Experiment	Marker?	Max mean expression
E-MTAB-9067	yes	818.85
E-HCAD-4	yes	59.34
E-CURD-112	yes	39.80
E-MTAB-8142	yes	19.33
E-CURD-122	yes	16.07
E-MTAB-9467	yes	14.89
E-CURD-46	yes	11.50
E-MTAB-6678	yes	6.47
E-CURD-88	yes	5.16
E-ANND-3	no	0.00

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

63 targets.

Target	Regulation
ACP5
AICDA	Activation
ALDH1A2	Activation
APOBEC3G	Activation
BCL6	Repression
CCL3	Activation
CCNB1	Unknown
CD68	Repression
CD74
CDKN1B
CIITA
CNTN2
CXCL9	Activation
DNMT1	Repression
FAIM
FCER2	Activation
FKBP4
HLA-E
IFIT3	Activation
IFNA1	Repression
IFNB1	Activation
IFNG	Activation
IKZF1	Unknown
IL10	Activation
IL12A	Activation
IL12B	Repression
IL13	Activation
IL15
IL17A	Activation
IL1B	Activation

JASPAR motifs

Motif	Name	Family
MA1419.1	IRF4	Interferon-regulatory factors
MA1419.2	IRF4	Interferon-regulatory factors

JASPAR matrix evidence (PMIDs): PMID:25896227

Upstream regulators (CollecTRI, top): BATF, BCL6, BCOR, CBX8, CEBPB, E2F1, FOXO1, IRF4, IRF5, KDM6B, MAF, MYC, NFATC1, NFKB1, NFKB, REL, RELA, SPI1, STAT4, STAT6

miRNA regulators (miRDB)

121 targeting IRF4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-433-3P	99.98	69.37	1203
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-6888-3P	99.97	65.95	1170
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505

Literature-anchored findings (GeneRIF, showing 40)

• Possible involvement of interferon regulatory factor 4 (IRF4) in a clinical subtype of adult T-cell leukemia. (PMID:11749693)
• review article summarizes recent studies on the regulation of IRF-4 and its function in activated T cells, human T cell lymphoma virus (HTLV-I)-infected T cells, and HTLV-I-induced adult T cell leukemia (PMID:11846984)
• Chronic IRF4 expression in human T cell leukemia virus-I-infected T lymphocytes is associated with a leukemic phenotype, driven through activation of the NF-kappa B and NF-AT pathways. (PMID:12218129)
• IRF-4 represents one of the lymphoid-specific components that control the ability of T lymphocytes to produce a distinctive array of cytokines (PMID:12374808)
• IRF-4, by modulating the efficiency of the Fas-mediated death signal, is a novel participant in the regulation of lymphoid cell apoptosis. (PMID:12566414)
• IRF-4 binds to PU.1 and downregulates CD68 expression in lymphoid cells (PMID:12676954)
• MUM1 appears to be a sensitive and specific immunohistochemical stain for melanocytic lesions and may prove to be a useful addition to the current panel of melanoma markers (PMID:12920225)
• in B cells, E47 and PU.1/IRF-4 interact with the E-box motifs and the EICE, respectively, and act synergistically in the activation of CIITA-PIII (PMID:15242870)
• IRF-4 as a potential player in human myeloid DC differentiation and is a target for the immunomodulatory activity of 1,25(OH)(2)D(3). (PMID:15829558)
• IRF4 protein provides a positive feedback signal for its own gene expression in dendritic cells (PMID:16272311)
• The sequence preference of IRF-4 was investigated by nuclear magnetic resonance and fluorescence antisotropy as an example of the indirect sequence recognition. (PMID:17150500)
• MUM1 expression dichotomizes follicular lymphoma (FL) into low-grade FL of CD10+/Bcl-6+/MUM1-/Ki-67low phenotype, and high-grade FL of CD10+/- /Bcl-6+/weak/MUM1+/ Ki-67high phenotype (PMID:17296585)
• Identifies MUM1 mRNA expression as an independent risk factor for poor survival in myeloma, particularly in patients without a deletion of 13q. (PMID:17690696)
• MUM1/IRF4 is expressed in most cases of classical Hodgkin’s lymphoma and shows that lack of this expression in a minority of cases may be a potential adverse prognostic factor (PMID:17768115)
• The variability in MUM1/IRF4 staining suggests a level of biologic complexity that is not adequately reflected in the current binary models of CLL pathobiology. (PMID:18231914)
• bortezomib down-regulation of PRDM1beta preceded decreased IRF4 and c-MYC expression (PMID:18235046)
• Interferon regulatory factor 4 is involved in Epstein-Barr virus-mediated transformation of human B lymphocytes. (PMID:18417578)
• IRF4 and SLC24A4 loci are associated with human hair color and skin pigmentation. (PMID:18483556)
• genetic abnormalities involving MUM1 are rare in diffuse large B-cell lymphoma (PMID:18815567)
• our results establish crucial roles for enhancer element CNS-9, and NFAT1 and IRF4 that bind to it, for IL-10 expression in differential T helper subsets. (PMID:18962896)
• IRF4 translocations are a novel recurrent genetic abnormality in peripheral T-cell lymphomas, especially cutaneous anaplastic large-cell lymphomas, as well as in previously reported neoplasms. (PMID:18987657)
• GC-enriched hsa-miR-125b down-regulates the expression of IRF4 and PRDM1/BLIMP1, and memory B cell-enriched hsa-miR-223 down-regulates the expression of LMO2. (PMID:19047678)
• We found 90 cases (40.5%) of Burkitt lymphoma with multiple myeloma 1 nuclear expression, suggesting a late germinal center stage of differentiation (PMID:19144381)
• Analysis of joint effects between eye and hair color with the IRF4 rs12203592 SNP did not reveal statistically significant p-interactions although NHL risk did decline with lighter hair color and presence of the variant IRF4 rs12203592 allele. (PMID:19396635)
• The expression of CD10, Bcl-6, MUM1/IRF4, Bcl-2, and FOXP1 was determined immunohistochemically from 88 samples of diffuse large B-cell lymphoma patients treated uniformly with R-CHOP (PMID:19448593)
• in patients with diffuse large B-cell lymphoma (DLBCL) treated with cyclophosphamide, vincristine, doxorubicin, and prednisolone the high expression of MUM1 was associated with worse overall survival (PMID:19656156)
• C/EBPbeta directly bound to the promoter region of IRF4, BLIMP1, and BCL2. (PMID:19717648)
• Stratification of diffuse large B-cell lymphoma with respect to combined expression profiles of CD10, Bcl-6 and MUM-1 revealed six groups showing significant differences in survival (PMID:19787248)
• IRF4 rs872071 influences Hodgkin lymphoma risk (PMID:19804451)
• IRF4 rearrangements define a subgroup of CD30-positive cutaneous large cell lymphoma and transformed myocosis fungoides cases (PMID:19812605)
• Studay of IRF gene can provide information on the mechanism of the sex effect and the role of immune surveillance in childhood acute lymphoblastic leukemia. (PMID:19897031)
• Studies illustrated tools for cut-off level determination with prognostic tumor-related biomarkers Bcl-2, Bcl-6, CD10, FOXP1, MUM1, and Cyclin E in DLBCL. (PMID:19925052)
• IRF4, another member in the IRF family of transcription factors overexpressed in a Tax-independent manner, negatively regulated TAK1-dependent IRF3 transcriptional activity. (PMID:19955181)
• IRF4 expression is not associated with gene rearrangement in cutaneous diffuse large B cell lymphoma, leg type (PMID:20054341)
• Variations in IRF4 gene is associated with interaction with CD38 and chronic lymphocytic leukaemia. (PMID:20090783)
• The 3’-untranslated region (UTR) of IRF4 is a susceptibility locus associated with a modest but highly significant increase in chronic lymphocytic leukaemia risk. (PMID:20123861)
• data clearly demonstrate the central function of IRF4 in the development of T helper 9 cells and underline the contribution of this T helper cell subset to the pathogenesis of asthma. (PMID:20674401)
• Support the clinical utility of FISH for IRF4 in the differential diagnosis of T-cell lymphoproliferative disorders in skin biopsies, with detection of a translocation favoring cutaneous anaplastic large cell lymphoma. (PMID:21169992)
• Data show that Mc1R, HERC2, IRF4, TYR and EXOC2 are ranked highest in hair color prediction analysis. (PMID:21197618)
• presented the IRF4 single nucleotide polymorphism rs12203592 as a risk locus for all 3 types of skin cancer (PMID:21270109)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	irf4a	ENSDARG00000006560
mus_musculus	Irf4	ENSMUSG00000021356
rattus_norvegicus	Irf4	ENSRNOG00000061070

Paralogs (8): IRF6 (ENSG00000117595), IRF1 (ENSG00000125347), IRF3 (ENSG00000126456), IRF5 (ENSG00000128604), IRF8 (ENSG00000140968), IRF2 (ENSG00000168310), IRF7 (ENSG00000185507), IRF9 (ENSG00000213928)

Protein

Protein identifiers

Interferon regulatory factor 4 — Q15306 (reviewed: Q15306)

Alternative names: Lymphocyte-specific interferon regulatory factor, Multiple myeloma oncogene 1, NF-EM5

All UniProt accessions (4): Q15306, A0A8Q3WLL3, A0A8Q3WLQ3, F2Z3D5

UniProt curated annotations — full annotation on UniProt →

Function. Transcriptional activator. Binds to the interferon-stimulated response element (ISRE) of the MHC class I promoter. Binds the immunoglobulin lambda light chain enhancer, together with PU.1. Probably plays a role in ISRE-targeted signal transduction mechanisms specific to lymphoid cells. Involved in CD8(+) dendritic cell differentiation by forming a complex with the BATF-JUNB heterodimer in immune cells, leading to recognition of AICE sequence (5’-TGAnTCA/GAAA-3’), an immune-specific regulatory element, followed by cooperative binding of BATF and IRF4 and activation of genes.

Subunit / interactions. Interacts with the BATF-JUNB heterodimer. Interacts with BATF (via bZIP domain); the interaction is direct. Interacts with SPIB. Interacts with DEF6. Directly interacts with NLRP3 in the nucleus of Th2 cells; this interaction enhances IRF4 ability to bind to the IL4 promoter and is required for optimal IRF4-dependent IL4 transcription. Interacts with SPI1.

Subcellular location. Nucleus. Cytoplasm.

Tissue specificity. Lymphoid cells.

Post-translational modifications. Phosphorylation by ROCK2 regulates IL-17 and IL-21 production.

Disease relevance. Multiple myeloma (MM) [MIM:254500] A malignant tumor of plasma cells usually arising in the bone marrow and characterized by diffuse involvement of the skeletal system, hyperglobulinemia, Bence-Jones proteinuria and anemia. Complications of multiple myeloma are bone pain, hypercalcemia, renal failure and spinal cord compression. The aberrant antibodies that are produced lead to impaired humoral immunity and patients have a high prevalence of infection. Amyloidosis may develop in some patients. Multiple myeloma is part of a spectrum of diseases ranging from monoclonal gammopathy of unknown significance (MGUS) to plasma cell leukemia. The gene represented in this entry may be involved in disease pathogenesis. A chromosomal aberration involving IRF4 has been found in multiple myeloma. Translocation t(6;14)(p25;q32) with the IgH locus. Immunodeficiency 131 (IMD131) [MIM:621097] An immunologic disorder characterized by recurrent infections, including infections with opportunistic pathogens, and low IgM, IgG, and IgA serum levels, low plasma cell counts and abnormal T-cell subsets. IMD131 inheritance can be autosomal dominant or autosomal recessive. The disease is caused by variants affecting the gene represented in this entry.

Induction. Not induced by interferons.

Polymorphism. Genetic variants in IRF4 define the skin/hair/eye pigmentation variation locus 8 (SHEP8) [MIM:611724]. Hair, eye and skin pigmentation are among the most visible examples of human phenotypic variation, with a broad normal range that is subject to substantial geographic stratification. In the case of skin, individuals tend to have lighter pigmentation with increasing distance from the equator. By contrast, the majority of variation in human eye and hair color is found among individuals of European ancestry, with most other human populations fixed for brown eyes and black hair.

Similarity. Belongs to the IRF family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q15306-1	1	yes
Q15306-2	2

RefSeq proteins (2): NP_001182215, NP_002451* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001346	Interferon_reg_fact_DNA-bd_dom	Domain
IPR008984	SMAD_FHA_dom_sf	Homologous_superfamily
IPR017855	SMAD-like_dom_sf	Homologous_superfamily
IPR019471	Interferon_reg_factor-3	Domain
IPR019817	Interferon_reg_fac_CS	Conserved_site
IPR036388	WH-like_DNA-bd_sf	Homologous_superfamily
IPR036390	WH_DNA-bd_sf	Homologous_superfamily

Pfam: PF00605, PF10401

UniProt features (27 total): strand 7, helix 5, sequence conflict 3, sequence variant 3, turn 2, modified residue 2, mutagenesis site 2, chain 1, DNA-binding region 1, splice variant 1

Structure

Experimental structures (PDB)

19 structures.

PDB	Method	Resolution (Å)
6TD4	X-RAY DIFFRACTION	1.71
9VEH	X-RAY DIFFRACTION	2
9TOY	X-RAY DIFFRACTION	2.1
9VE3	X-RAY DIFFRACTION	2.1
9VE7	X-RAY DIFFRACTION	2.15
7OOT	X-RAY DIFFRACTION	2.25
7OGS	X-RAY DIFFRACTION	2.37
7RH2	X-RAY DIFFRACTION	2.47
9VE4	X-RAY DIFFRACTION	2.55
7O56	X-RAY DIFFRACTION	2.6
9VE6	X-RAY DIFFRACTION	2.8
9VE8	X-RAY DIFFRACTION	2.85
7JM4	X-RAY DIFFRACTION	2.95
21IK	X-RAY DIFFRACTION	2.99
9VE5	X-RAY DIFFRACTION	3.2
21IE	X-RAY DIFFRACTION	3.24
21IP	X-RAY DIFFRACTION	3.3
9VEA	X-RAY DIFFRACTION	3.6
2DLL	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15306-F1	72.48	0.47

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 447, 448

Mutagenesis-validated functional residues (2):

Position	Phenotype
98–99	loss of dna-binding transcription activator activity.
368	loss of dna-binding transcription activator activity.

Function

Pathways and Gene Ontology

Reactome pathways

17 pathways

ID	Pathway
R-HSA-6785807	Interleukin-4 and Interleukin-13 signaling
R-HSA-877300	Interferon gamma signaling
R-HSA-909733	Interferon alpha/beta signaling
R-HSA-9725371	Nuclear events stimulated by ALK signaling in cancer
R-HSA-9824585	Regulation of MITF-M-dependent genes involved in pigmentation
R-HSA-9976102	Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells)
R-HSA-1266738	Developmental Biology
R-HSA-1280215	Cytokine Signaling in Immune system
R-HSA-1643685	Disease
R-HSA-168256	Immune System
R-HSA-449147	Signaling by Interleukins
R-HSA-5663202	Diseases of signal transduction by growth factor receptors and second messengers
R-HSA-913531	Interferon Signaling
R-HSA-9700206	Signaling by ALK in cancer
R-HSA-9725370	Signaling by ALK fusions and activated point mutants
R-HSA-9730414	MITF-M-regulated melanocyte development
R-HSA-9856651	MITF-M-dependent gene expression

MSigDB gene sets: 802 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_CELL_ACTIVATION, FUNG_IL2_SIGNALING_2, GOBP_DENDRITIC_CELL_DIFFERENTIATION, BENPORATH_ES_WITH_H3K27ME3, GOBP_REGULATION_OF_ALPHA_BETA_T_CELL_ACTIVATION, MCLACHLAN_DENTAL_CARIES_UP, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, BROWNE_HCMV_INFECTION_8HR_UP, GOBP_T_CELL_ACTIVATION_INVOLVED_IN_IMMUNE_RESPONSE, GCANCTGNY_MYOD_Q6, GOBP_ALPHA_BETA_T_CELL_DIFFERENTIATION, GOBP_NEGATIVE_REGULATION_OF_TOLL_LIKE_RECEPTOR_SIGNALING_PATHWAY, SHAFFER_IRF4_TARGETS_IN_ACTIVATED_B_LYMPHOCYTE, GOBP_REGULATION_OF_T_HELPER_CELL_DIFFERENTIATION

GO Biological Process (18): immune system process (GO:0002376), chromatin remodeling (GO:0006338), regulation of transcription by RNA polymerase II (GO:0006357), positive regulation of interleukin-10 production (GO:0032733), positive regulation of interleukin-13 production (GO:0032736), positive regulation of interleukin-2 production (GO:0032743), positive regulation of interleukin-4 production (GO:0032753), negative regulation of toll-like receptor signaling pathway (GO:0034122), T cell activation (GO:0042110), defense response to protozoan (GO:0042832), myeloid dendritic cell differentiation (GO:0043011), regulation of T-helper cell differentiation (GO:0045622), positive regulation of DNA-templated transcription (GO:0045893), positive regulation of transcription by RNA polymerase II (GO:0045944), T-helper 17 cell lineage commitment (GO:0072540), positive regulation of cold-induced thermogenesis (GO:0120162), regulation of DNA-templated transcription (GO:0006355), positive regulation of multicellular organismal process (GO:0051240)

GO Molecular Function (11): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), DNA-binding transcription factor activity (GO:0003700), transcription coactivator activity (GO:0003713), sequence-specific DNA binding (GO:0043565), sequence-specific double-stranded DNA binding (GO:1990837), transcription cis-regulatory region binding (GO:0000976), cis-regulatory region sequence-specific DNA binding (GO:0000987), DNA binding (GO:0003677), protein binding (GO:0005515)

GO Cellular Component (7): chromatin (GO:0000785), nucleosome (GO:0000786), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-12 pathways:

Category	Pathways
Interferon Signaling	2
Cytokine Signaling in Immune system	2
Signaling by Interleukins	1
Signaling by ALK fusions and activated point mutants	1
MITF-M-dependent gene expression	1
Differentiation of T cells	1
Immune System	1
Disease	1
Diseases of signal transduction by growth factor receptors and second messengers	1
Signaling by ALK in cancer	1
Developmental Biology	1
MITF-M-regulated melanocyte development	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
positive regulation of cytokine production	4
regulation of DNA-templated transcription	3
RNA polymerase II transcription regulatory region sequence-specific DNA binding	3
transcription by RNA polymerase II	2
DNA-templated transcription	2
regulation of transcription by RNA polymerase II	2
positive regulation of DNA-templated transcription	2
chromatin	2
transcription cis-regulatory region binding	2
biological_process	1
chromatin organization	1
interleukin-10 production	1
regulation of interleukin-10 production	1
interleukin-13 production	1
regulation of interleukin-13 production	1
interleukin-2 production	1
regulation of interleukin-2 production	1
interleukin-4 production	1
regulation of interleukin-4 production	1
toll-like receptor signaling pathway	1
negative regulation of immune system process	1
negative regulation of signal transduction	1
regulation of toll-like receptor signaling pathway	1
lymphocyte activation	1
response to protozoan	1
defense response to other organism	1
myeloid dendritic cell activation	1
myeloid leukocyte differentiation	1
dendritic cell differentiation	1
T-helper cell differentiation	1
regulation of CD4-positive, alpha-beta T cell differentiation	1
regulation of immune response	1
positive regulation of RNA biosynthetic process	1
T-helper cell lineage commitment	1
T-helper 17 cell differentiation	1
positive regulation of multicellular organismal process	1
cold-induced thermogenesis	1
regulation of cold-induced thermogenesis	1
regulation of gene expression	1

Protein interactions and networks

STRING

3302 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
IRF4	SPI1	P17947	994
IRF4	BATF	Q16520	992
IRF4	MYD88	P78397	973
IRF4	PAX5	Q02548	945
IRF4	STAT3	P40763	939
IRF4	PRDM1	O75626	928
IRF4	STAT6	P42226	906
IRF4	FOXP3	Q9BZS1	886
IRF4	BCL6	P41182	881
IRF4	PPARGC1A	Q9UBK2	869
IRF4	TRAF6	Q9Y4K3	866
IRF4	SPIB	Q01892	864
IRF4	BACH2	Q9BYV9	851
IRF4	GATA3	P23771	845
IRF4	JUN	P05412	834

IntAct

46 interactions, top by confidence:

A	B	Type	Score
IRF4	GIPC2	psi-mi:“MI:0915”(physical association)	0.560
IRF4	TSEN54	psi-mi:“MI:0915”(physical association)	0.560
IRF4	ELP1	psi-mi:“MI:0914”(association)	0.500
IRF4	ELP1	psi-mi:“MI:0915”(physical association)	0.500
IRAK1	IRF4	psi-mi:“MI:0915”(physical association)	0.500
IRF4	TLK2	psi-mi:“MI:0915”(physical association)	0.500
YTHDC2	IRF4	psi-mi:“MI:0915”(physical association)	0.500
IRF4	IFI27	psi-mi:“MI:0915”(physical association)	0.400
FLOT2	IRF4	psi-mi:“MI:0915”(physical association)	0.400
IRF4	BCL6	psi-mi:“MI:0915”(physical association)	0.400
IRF4	HOXB13	psi-mi:“MI:0915”(physical association)	0.370
IRF4	BATF	psi-mi:“MI:0915”(physical association)	0.370
HOXC11	IRF4	psi-mi:“MI:0915”(physical association)	0.370
IRF4	ETV7	psi-mi:“MI:0915”(physical association)	0.370
IRF4	PROX1	psi-mi:“MI:0915”(physical association)	0.370
IRF4	SPIB	psi-mi:“MI:0915”(physical association)	0.370
IRF4	TRAF2	psi-mi:“MI:0915”(physical association)	0.370
CUL5	DDX3X	psi-mi:“MI:0914”(association)	0.350
	IRF4	psi-mi:“MI:0914”(association)	0.350
IRF4		psi-mi:“MI:0914”(association)	0.350
IRF4	ARID1A	psi-mi:“MI:2364”(proximity)	0.270
NPM1	SBNO1	psi-mi:“MI:2364”(proximity)	0.270
FBXW7	IRF4	psi-mi:“MI:2364”(proximity)	0.270
IRF4	SMAD4	psi-mi:“MI:2364”(proximity)	0.270
SMAD4	IRF4	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (102): TRAF2 (Two-hybrid), RIPK2 (Affinity Capture-Western), MYD88 (Affinity Capture-Western), TRAF6 (Affinity Capture-Western), RIPK2 (Co-localization), MYD88 (Co-localization), TRAF6 (Co-localization), IRF4 (Affinity Capture-Western), IRF4 (Affinity Capture-Western), USP4 (Affinity Capture-Western), IRF4 (Biochemical Activity), OTUD1 (Affinity Capture-Western), GIPC2 (Two-hybrid), TSEN54 (Two-hybrid), STAT6 (Reconstituted Complex)

ESM2 similar proteins: A0A8M9QN10, A2ARM1, A6QL70, E7F654, O08653, O15178, O43147, P20293, P23611, P33242, P50569, P56524, P59114, P79779, P87377, P97499, Q02556, Q04752, Q0VD00, Q15306, Q1LVK9, Q28HY0, Q2M1K5, Q32N92, Q4VC12, Q5U263, Q64287, Q6DHF9, Q6NZM9, Q6NZR5, Q6P1Z5, Q6ZUJ8, Q7Z3E5, Q80U12, Q80U38, Q8BGX1, Q8C2B3, Q8R151, Q96HM7, Q96SI1

Diamond homologs: A0FIN4, O14896, P10914, P14316, P15314, P23570, P23611, P23906, P56477, P70671, P97431, Q00978, Q02556, Q08DD6, Q13568, Q14653, Q15306, Q3SZP0, Q4JF28, Q58DJ0, Q61179, Q64287, Q764M6, Q8R4E0, Q90643, Q90871, Q90876, Q98925, Q92985, F5HF68, P70434

SIGNOR signaling

14 interactions.

A	Effect	B	Mechanism
ROCK2	up-regulates	IRF4	phosphorylation
KDM6B	“up-regulates quantity by expression”	IRF4	“transcriptional regulation”
IRF4	up-regulates	M2_polarization
IRF4	“down-regulates activity”	IRF5
IRF4	down-regulates	M1_polarization
IRF4	“up-regulates quantity by expression”	FCER2	“transcriptional regulation”
IRF4	“up-regulates quantity by expression”	IL4	“transcriptional regulation”
SRC	“up-regulates activity”	IRF4	phosphorylation
PELI3	“down-regulates activity”	IRF4	ubiquitination
IRF4	“down-regulates activity”	RIPK2	binding
NOD2	“up-regulates quantity by expression”	IRF4	“transcriptional regulation”
IRF4	“down-regulates quantity by repression”	CD68	“transcriptional regulation”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 26 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
negative regulation of cell growth	5	28.8×	2e-04
DNA damage response	6	12.8×	7e-04

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: activating (oncogene-like) across 5 cancer types — CLLSLL, DLBCLNOS, MLYM, NHL, PCM.

Clinical variants and AI predictions

ClinVar

357 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	4
Likely pathogenic	0
Uncertain significance	149
Likely benign	154
Benign	33

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
2762498	NM_002460.4(IRF4):c.1075T>C (p.Phe359Leu)	Pathogenic
2987365	NM_002460.4(IRF4):c.284C>G (p.Thr95Arg)	Pathogenic
3731311	IRF4, IVS8, 1213-2, A-G	Pathogenic
3731312	NM_002460.4(IRF4):c.292C>T (p.Arg98Trp)	Pathogenic

SpliceAI

1459 predictions. Top by Δscore:

Variant	Effect	Δscore
6:393348:G:GT	donor_gain	1.0000
6:393351:G:GT	donor_gain	1.0000
6:394816:A:AG	acceptor_gain	1.0000
6:394816:ACCAG:A	acceptor_gain	1.0000
6:394819:A:AG	acceptor_gain	1.0000
6:394819:AG:A	acceptor_gain	1.0000
6:394820:G:GG	acceptor_gain	1.0000
6:394820:GG:G	acceptor_gain	1.0000
6:394820:GGC:G	acceptor_gain	1.0000
6:394820:GGCT:G	acceptor_gain	1.0000
6:394820:GGCTT:G	acceptor_gain	1.0000
6:394968:TACA:T	donor_gain	1.0000
6:394969:ACAA:A	donor_gain	1.0000
6:394974:GT:G	donor_gain	1.0000
6:394982:G:GT	donor_gain	1.0000
6:394995:G:GT	donor_gain	1.0000
6:395005:AAGGT:A	donor_loss	1.0000
6:395006:AGGTA:A	donor_loss	1.0000
6:395007:GGTAG:G	donor_loss	1.0000
6:395008:G:C	donor_loss	1.0000
6:395008:G:GG	donor_gain	1.0000
6:395009:T:A	donor_loss	1.0000
6:395837:A:AG	acceptor_gain	1.0000
6:395838:A:G	acceptor_gain	1.0000
6:395841:AT:A	acceptor_gain	1.0000
6:395842:T:G	acceptor_gain	1.0000
6:395846:G:GA	acceptor_gain	1.0000
6:395846:GGA:G	acceptor_gain	1.0000
6:401418:TTGCA:T	acceptor_loss	1.0000
6:401419:TGCAG:T	acceptor_loss	1.0000

AlphaMissense

2976 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
6:393219:A:G	K23E	1.000
6:393223:T:A	L24H	1.000
6:393223:T:C	L24P	1.000
6:393225:C:A	R25S	1.000
6:393226:G:C	R25P	1.000
6:393231:T:A	W27R	1.000
6:393231:T:C	W27R	1.000
6:393232:G:C	W27S	1.000
6:393233:G:C	W27C	1.000
6:393233:G:T	W27C	1.000
6:393235:T:A	L28Q	1.000
6:393235:T:C	L28P	1.000
6:393235:T:G	L28R	1.000
6:393244:A:C	Q31P	1.000
6:393246:A:T	I32F	1.000
6:393261:T:G	Y37D	1.000
6:393267:G:A	G39R	1.000
6:393267:G:C	G39R	1.000
6:393267:G:T	G39W	1.000
6:393268:G:A	G39E	1.000
6:393271:T:A	L40Q	1.000
6:393271:T:C	L40P	1.000
6:393276:T:A	W42R	1.000
6:393276:T:C	W42R	1.000
6:393277:G:C	W42S	1.000
6:393278:G:C	W42C	1.000
6:393278:G:T	W42C	1.000
6:393300:T:C	F50L	1.000
6:393301:T:C	F50S	1.000
6:393302:C:A	F50L	1.000

dbSNP variants (sampled 300 via entrez): RS1000092865 (6:394311 A>C), RS1000192675 (6:411316 G>A), RS1000208382 (6:408314 C>A,T), RS1000240851 (6:408509 A>G), RS1000600432 (6:404399 A>G,T), RS1000698747 (6:393205 G>A,C,T), RS1001046936 (6:391769 T>C), RS1001111022 (6:393496 A>C,T), RS1001291801 (6:409711 A>G), RS1001378916 (6:392385 CCTCTCCCGCGCCCTCCCCGCCTCCG>C), RS1001397458 (6:408477 C>A), RS1001408776 (6:408752 G>A,C), RS1001627990 (6:393680 C>A,G), RS1001659057 (6:393884 C>T), RS1001661137 (6:409445 TAAAAA>T)

Disease associations

OMIM: gene MIM:601900 | disease phenotypes: MIM:621097

GenCC curated gene-disease

Disease	Classification	Inheritance
combined immunodeficiency	Strong	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
combined immunodeficiency	Definitive	AD

Mondo (2): immunodeficiency 131 (MONDO:0976229), combined immunodeficiency (MONDO:0015131)

Orphanet (0):

HPO phenotypes

122 total (30 of 122 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000238	Hydrocephalus
HP:0000265	Mastoiditis
HP:0000403	Recurrent otitis media
HP:0000509	Conjunctivitis
HP:0000520	Proptosis
HP:0000554	Uveitis
HP:0000716	Depression
HP:0000821	Hypothyroidism
HP:0000855	Insulin resistance
HP:0000964	Eczematoid dermatitis
HP:0000975	Hyperhidrosis
HP:0000988	Skin rash
HP:0001036	Parakeratosis
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001324	Muscle weakness
HP:0001336	Myoclonus
HP:0001369	Arthritis
HP:0001433	Hepatosplenomegaly
HP:0001508	Failure to thrive
HP:0001658	Myocardial infarction
HP:0001701	Pericarditis
HP:0001744	Splenomegaly
HP:0001880	Increased total eosinophil count
HP:0001903	Anemia
HP:0001943	Hypoglycemia
HP:0001945	Fever
HP:0001954	Recurrent fever

GWAS associations

124 associations (top):

Study	Trait	p-value
GCST000119_1	Freckles	4.000000e-18
GCST000190_5	Black vs. blond hair color	7.000000e-127
GCST000191_6	Black vs. red hair color	9.000000e-28
GCST000224_5	Chronic lymphocytic leukemia	2.000000e-20
GCST000612_28	Celiac disease	6.000000e-08
GCST000707_6	Hair color	2.000000e-28
GCST000708_3	Freckling	2.000000e-91
GCST000710_7	Eye color	2.000000e-15
GCST001116_7	Progressive supranuclear palsy	6.000000e-15
GCST001813_2	Hematology traits	4.000000e-06
GCST001932_2	Hair color	1.000000e-28
GCST001933_2	Sunburns	2.000000e-06
GCST001939_1	Tanning	3.000000e-23
GCST001940_1	Non-melanoma skin cancer	7.000000e-14
GCST001940_2	Non-melanoma skin cancer	5.000000e-08
GCST002073_14	Chronic lymphocytic leukemia	6.000000e-20
GCST002299_10	Chronic lymphocytic leukemia	3.000000e-16
GCST002318_152	Rheumatoid arthritis	2.000000e-10
GCST002318_153	Rheumatoid arthritis	1.000000e-07
GCST002738_14	Psoriasis	3.000000e-07
GCST002785_1	Facial pigmentation	2.000000e-27
GCST002874_23	Psoriasis	6.000000e-06
GCST002906_5	Skin colour saturation	3.000000e-09
GCST003021_2	Brown vs. non-brown hair color	5.000000e-08
GCST003022_2	Light vs. dark hair color	3.000000e-12
GCST003023_1	Blond vs non-blond hair color	1.000000e-13
GCST003043_171	Inflammatory bowel disease	6.000000e-09
GCST003044_106	Crohn’s disease	1.000000e-09
GCST003327_2	Squamous cell carcinoma	8.000000e-97
GCST003468_6	Chronic lymphocytic leukemia	9.000000e-22

EFO canonical traits (27, from GWAS)

EFO ID	Trait name
EFO:0003963	freckles
EFO:0003924	hair color
EFO:0003949	eye color
EFO:0005128	albumin:globulin ratio measurement
EFO:0004279	suntan
EFO:1001927	cutaneous squamous cell carcinoma
EFO:0007906	synophrys measurement
EFO:0004587	lymphocyte count
EFO:1001017	limited scleroderma
EFO:0005939	parental genotype effect measurement
EFO:0007017	peanut allergy measurement
EFO:0009180	rosacea severity measurement
EFO:0009260	non-melanoma skin carcinoma
EFO:0009597	feeling nervous measurement
EFO:0009764	eye colour measurement
EFO:0004632	nevus count
EFO:0004847	age at onset
EFO:0009933	Thyroid preparation use measurement
EFO:0010176	keratinocyte carcinoma
EFO:0007796	parental longevity
EFO:0009762	healthspan
EFO:0009749	age at first sexual intercourse measurement
EFO:0004842	eosinophil count
EFO:0007991	eosinophil percentage of leukocytes
EFO:0007993	lymphocyte percentage of leukocytes
EFO:0007989	monocyte percentage of leukocytes
EFO:0007990	neutrophil percentage of leukocytes

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6196090 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

16 potent at pChembl≥5 of 30 total, top 16 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.89	Kd	1280	nM	CHEMBL6175555
5.58	IC50	2630	nM	CHEMBL6175555
5.45	IC50	3520	nM	CHEMBL6164434
5.44	IC50	3650	nM	CHEMBL6159796
5.42	IC50	3790	nM	CHEMBL6166186
5.41	IC50	3880	nM	CHEMBL6149386
5.31	IC50	4860	nM	CHEMBL6171328
5.30	IC50	5050	nM	CHEMBL6168877
5.26	IC50	5430	nM	CHEMBL6170496
5.25	IC50	5620	nM	CHEMBL6170471
5.16	IC50	6950	nM	CHEMBL6160837
5.15	IC50	7060	nM	CHEMBL6173690
5.12	IC50	7610	nM	CHEMBL6166632
5.09	IC50	8100	nM	CHEMBL6173166
5.03	IC50	9370	nM	CHEMBL6174008
5.01	IC50	9650	nM	CHEMBL6133925

CTD chemical–gene interactions

45 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects cotreatment, decreases methylation, increases expression	3
Benzo(a)pyrene	affects methylation, decreases expression, increases methylation	3
Dexamethasone	decreases expression, affects cotreatment, increases expression	2
Tetradecanoylphorbol Acetate	affects cotreatment, decreases reaction, increases expression, decreases expression	2
afuresertib	affects cotreatment, decreases expression	1
2-methyl-4-isothiazolin-3-one	increases expression	1
ethyl-p-hydroxybenzoate	decreases expression	1
arsenite	increases methylation	1
pyrrolidine dithiocarbamic acid	decreases reaction, increases expression, affects cotreatment	1
S-(1,2-dichlorovinyl)cysteine	decreases reaction, increases expression	1
CGP 52608	affects binding, increases reaction	1
pomalidomide	affects cotreatment, decreases expression	1
abrine	increases expression	1
ON 01910	affects expression	1
bisphenol S	increases expression, affects cotreatment	1
(+)-JQ1 compound	decreases expression	1
3-(5-(4-(cyclopentyloxy)-2-hydroxybenzoyl)-2-((3-hydroxy-1,2-benzisoxazol-6-yl)methoxy)phenyl)propionic acid	increases reaction, decreases expression	1
Bortezomib	decreases expression, increases reaction	1
Arsenic Trioxide	affects methylation	1
Fulvestrant	affects cotreatment, decreases methylation	1
Acetaminophen	decreases expression	1
Arsenic	increases methylation	1
Benzoates	decreases expression	1
Catechin	decreases expression	1
Ethyl Methanesulfonate	decreases expression	1
Flavonoids	decreases expression	1
Hydroxychloroquine	affects cotreatment, decreases expression	1
Indomethacin	affects cotreatment, increases expression	1
Lipopolysaccharides	increases expression, decreases reaction	1
Methotrexate	affects cotreatment, decreases expression	1

ChEMBL screening assays

3 unique, capped per target: 3 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL6124999	Binding	Binding affinity to IRF4 (unknown origin) assessed as dissociation constant by SPR analysis	Design, synthesis and biological evaluation of bisnoralcohol derivatives as novel IRF4 inhibitors for the treatment of multiple myeloma. — Eur J Med Chem

Cellosaurus cell lines

7 cell lines: 4 cancer cell line, 3 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A3F9	SEES3-1V human IRF4, clone1	Embryonic stem cell	Male
CVCL_A3G0	SEES3-1V human IRF4, clone2	Embryonic stem cell	Male
CVCL_A3G1	SEES3-1V human IRF4, clone3	Embryonic stem cell	Male
CVCL_B8IP	Abcam HCT 116 IRF4 KO	Cancer cell line	Male
CVCL_B8XJ	Abcam MCF-7 IRF4 KO	Cancer cell line	Female
CVCL_B9KZ	Abcam A-549 IRF4 KO	Cancer cell line	Male
CVCL_D3X9	ARSI	Cancer cell line	Female

Clinical trials (associated diseases)

4 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02737384	PHASE2	TERMINATED	Hematopoietic Stem Cells Transplantation in Children With Combined Immunodeficiency (CID)
NCT02915406	Not specified	NO_LONGER_AVAILABLE	cliniMACs HUD for T Cell Depletion
NCT04902807	Not specified	RECRUITING	Conception of a Diagnosis, Prognosis and Therapeutic Decision Tool for Patients With Autoimmunity and Inflammation
NCT06659588	Not specified	RECRUITING	Study of Populations at Risk of Developing Chronic Hepatitis Linked to Chronic Enteric Virus Infection in Patients With Primary Immunodeficiency and Secondary Humoral Deficiency