IRF7

Summary

IRF7 (interferon regulatory factor 7, HGNC:6122) is a protein-coding gene on chromosome 11p15.5, encoding Interferon regulatory factor 7 (Q92985). Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses.

This gene encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. It has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. The encoded protein plays an important role in the innate immune response against DNA and RNA viruses.

Source: NCBI Gene 3665 — RefSeq curated summary.

At a glance

• Gene–disease (curated): immunodeficiency 39 (Strong, GenCC)
• GWAS associations: 7
• Clinical variants (ClinVar): 786 total
• Phenotypes (HPO): 4
• Transcription factor: yes — 37 downstream targets (CollecTRI)
• MANE Select transcript: NM_001572

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6122
Approved symbol	IRF7
Name	interferon regulatory factor 7
Location	11p15.5
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000185507
Ensembl biotype	protein_coding
OMIM	605047
Entrez	3665

Gene structure

Transcript identifiers

Ensembl transcripts: 26 — 16 protein_coding, 5 retained_intron, 4 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000330243, ENST00000348655, ENST00000397566, ENST00000397570, ENST00000469048, ENST00000525445, ENST00000525750, ENST00000527160, ENST00000528413, ENST00000531912, ENST00000532096, ENST00000532326, ENST00000532788, ENST00000533182, ENST00000533190, ENST00000647801, ENST00000649187, ENST00000858980, ENST00000858981, ENST00000858982, ENST00000858983, ENST00000935320, ENST00000971586, ENST00000971587, ENST00000971588, ENST00000971589

RefSeq mRNA: 3 — MANE Select: NM_001572 NM_001572, NM_004029, NM_004031

CCDS: CCDS7703, CCDS7704, CCDS7705

Canonical transcript exons

ENST00000525445 — 11 exons

Exon	Start	End
ENSE00001300929	614174	614399
ENSE00001699417	612555	612800
ENSE00002157180	615913	615950
ENSE00003493087	613951	614037
ENSE00003525166	615097	615259
ENSE00003550384	615345	615647
ENSE00003560526	613206	613595
ENSE00003602612	612999	613117
ENSE00003614481	614797	615007
ENSE00003615581	614476	614534
ENSE00003617760	613785	613865

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 97.86.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 33.5129 / max 7948.5529, expressed in 1748 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
117784	30.5266	1739
117783	2.9101	828
117781	0.0556	18
117782	0.0206	6

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	97.86	gold quality
blood	UBERON:0000178	96.91	gold quality
right lobe of liver	UBERON:0001114	95.46	gold quality
spleen	UBERON:0002106	95.40	gold quality
monocyte	CL:0000576	94.28	gold quality
leukocyte	CL:0000738	94.15	gold quality
lower esophagus mucosa	UBERON:0035834	93.76	gold quality
mucosa of transverse colon	UBERON:0004991	93.52	gold quality
apex of heart	UBERON:0002098	92.97	gold quality
lymph node	UBERON:0000029	91.66	gold quality
bone marrow	UBERON:0002371	91.33	gold quality
liver	UBERON:0002107	91.23	gold quality
bone marrow cell	CL:0002092	91.17	gold quality
sural nerve	UBERON:0015488	90.79	gold quality
vermiform appendix	UBERON:0001154	90.78	gold quality
left lobe of thyroid gland	UBERON:0001120	90.62	gold quality
small intestine Peyer’s patch	UBERON:0003454	90.58	gold quality
duodenum	UBERON:0002114	90.40	gold quality
small intestine	UBERON:0002108	90.14	gold quality
right lobe of thyroid gland	UBERON:0001119	90.07	gold quality
thyroid gland	UBERON:0002046	89.82	gold quality
upper lobe of left lung	UBERON:0008952	89.78	gold quality
omental fat pad	UBERON:0010414	89.35	gold quality
adenohypophysis	UBERON:0002196	89.34	gold quality
right lung	UBERON:0002167	89.10	gold quality
pituitary gland	UBERON:0000007	89.07	gold quality
body of stomach	UBERON:0001161	88.35	gold quality
prostate gland	UBERON:0002367	88.05	gold quality
metanephros cortex	UBERON:0010533	87.96	gold quality
saliva-secreting gland	UBERON:0001044	87.64	gold quality

Single-cell (SCXA)

Detected in 22 experiment(s), a significant marker in 22.

Experiment	Marker?	Max mean expression
E-CURD-126	yes	1425.87
E-MTAB-10432	yes	774.69
E-MTAB-6701	yes	752.99
E-MTAB-8410	yes	712.76
E-MTAB-9906	yes	706.11
E-ANND-5	yes	593.98
E-HCAD-1	yes	539.95
E-HCAD-6	yes	394.00
E-GEOD-130148	yes	388.76
E-HCAD-4	yes	73.83
E-HCAD-13	yes	21.78
E-CURD-112	yes	19.06
E-MTAB-9467	yes	17.83
E-MTAB-9067	yes	16.98
E-MTAB-8142	yes	16.48

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

37 targets.

Target	Regulation
ATF4	Activation
CCL19	Activation
CCL2	Activation
CCL3	Activation
CCL5	Unknown
CD80	Activation
CXCL10	Activation
CYSLTR2	Activation
FOXP3	Unknown
IFN1@
IFNA1	Activation
IFNA10	Activation
IFNA13	Activation
IFNA14	Activation
IFNA16	Activation
IFNA17	Activation
IFNA2	Activation
IFNA4	Activation
IFNA5	Activation
IFNA7	Activation
IFNA8	Activation
IFNB1	Activation
IFNL1	Unknown
IFNL2	Unknown
IFNL3	Unknown
IL12A	Activation
IL12B	Repression
IL27	Activation
IL33	Unknown
IRF3	Activation

JASPAR motifs

Motif	Name	Family
MA0772.1	IRF7	Interferon-regulatory factors
MA0772.2	IRF7	Interferon-regulatory factors

JASPAR matrix evidence (PMIDs): PMID:10938111

Upstream regulators (CollecTRI, top): ATF4, BRCA1, CREB1, DDIT3, FOXO3, IRF3, IRF9, KAT2B, NFKB1, PITX1, PTPN22, RELA, SPIB, STAT1, STAT2, TNFAIP3, YY1

Literature-anchored findings (GeneRIF, showing 40)

• The structure and function of IRF7 are reviewed (PMID:11846980)
• Stimulation of IRF-7 gene expression by tumor necrosis factor alpha: requirement for NFkappa B transcription factor and gene accessibility (PMID:11877397)
• Preferential binding sites for interferon regulatory factors 3 and 7 involved in interferon-A gene transcription (PMID:11884139)
• acetylation of lysine 92 negatively modulates IRF7 DNA binding (PMID:12374802)
• Interferon regulatory factor-7 synergizes with other transcription factors through multiple interactions with p300/CBP coactivators. (PMID:12604599)
• Interferon regulatory factor 7 regulates expression of Epstein-Barr virus latent membrane protein 1: a regulatory circuit. (PMID:12915551)
• LPS-TLR4 signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF. (PMID:14517278)
• herpes simplex virus ICP0 blocks interferon regulatory factor IRF7-mediated activation of interferon-stimulated genes; the RING finger domain of ICP0 is essential for this activity (PMID:14747533)
• LPS & HSV upregulate IRF-7 in plasmacytoid dendritic cells. This depends on NF-kappa B activation. Nuclear translocation of IRF-7 occurs rapidly in response to HSV. Activation of IRF-7 contributes to IFN-alpha production in virus-stimulated PDC. (PMID:15265881)
• IRF-5-and IRF-7-induced innate antiviral response results in a broad alteration of the transcriptional profile of cellular genes (PMID:15308637)
• TLR-mediated IFN-alpha induction requires the formation of a complex consisting of MyD88, TRAF6 and IRF7 as well as TRAF6-dependent ubiquitination. (PMID:15361868)
• there are two distinct mechanisms for the activation of the IRF7 promoter, by IFN and by virus infection (PMID:15664995)
• IRF5 and IRF7 are critical mediators of TLR7 signaling (PMID:15695821)
• LPS-induced B7.1 transcription in human monocytic cells may be regulated by JNK-mediated activation of the IRF-7 transcription factor. (PMID:16237059)
• IRF7 and LMP1 interact with each other, and this may relate to the mechanism whereby LMP1 exerts functional effects in B-lymphocytes (PMID:16778376)
• Transduction of active forms of IRF-3 or IRF-7 differentially modulate the apoptotic and antitumor properties of primary macrophages. (PMID:17079482)
• We show that BRCA1, signal transducer and activator of transcription (STAT)-1, and STAT2 are all required for the induction of IRF-7 following stimulation with IFN-gamma. (PMID:17374731)
• expression patterns of IRF3 & IRF7 in normal lymph nodes, reactive hyperplastic lymph nodes & pediatric lymphomas; the number of IRF7-positive cells was found to be elevated in the reactive hyperplastic lymph nodes and pediatric lymphoma (PMID:17393359)
• In addition to its defined role in type I interferon stimulation, IRF-7 plays a key role in modulating adaptive immune responses by inducing low molecular mass polypeptide-2 (LMP-2) expression, either directly or through induction of IRF-1. (PMID:17404045)
• Results report a novel immune evasion mechanism of KSHV vIRF3 to block cellular IRF7-mediated innate immunity in response to viral infection. (PMID:17522209)
• PI3K selectively controls type I IFN production by regulating IRF-7 nuclear translocation in human pDCs (PMID:18227218)
• Our analyses showed a prominent effect of the IRF-7 nonsynonymous SNPs on the risk of developing cirrhosis. (PMID:18397234)
• epigenetic inactivation of the IFN pathway plays a critical role in cellular immortalization, and the reactivation of IFN-regulated genes by transcription factors IRF5 and/or IRF7 is sufficient to induce cellular senescence (PMID:18505922)
• SUMO modification and RIG-I activation are an integral part of IRF3 and IRF7 activity that contributes to postactivation attenuation of IFN production (PMID:18635538)
• TRAF6 and its E3 ligase activity are required for LMP1-stimulated IRF7 ubiquitination. (PMID:18710948)
• This screening demonstrates that LF2 specifically interacts with the central inhibitory association domain of IRF7, and this interaction leads to inhibition of the dimerization of IRF7, which suppresses IFN-alpha production and IFN-mediated immunity. (PMID:18987133)
• efficient IRF7 activation required association with LMP1 CTAR2 in proximity to LMP1 CTAR2 mediated kinase activation sites (PMID:19017798)
• Altogether, these data further highlight the respective functions of IRF-3 and IRF-7 to program apoptotic, immune and anti-tumor responses. (PMID:19152337)
• transient binding of both IRF-3 and IRF-7, accompanied by CBP/p300 recruitment to the endogenous IFN-A gene promoters, is associated with transcriptional activation (PMID:19349300)
• IRF-1, IRF-7, type I IFNs, and STAT1 form a signaling feedback loop that is critical in regulating TRAIL expression in HIV-1-infected macrophages. (PMID:19404407)
• mRNA levels of primary Sjogren Syndrome patients were not up-regulated (PMID:19426920)
• Herpes simplex type 1 infection triggered an IRF-3 and IRF-7-dependent antiviral response. (PMID:19515829)
• In contrast, although expression of IRF-7 was higher in Gr II than in the other groups, there was no statistically significant difference (P > 0.05). (PMID:19858727)
• Smokers after infection with influenza is associated with reduced expression of IRF7 in nasal epithelial cells. (PMID:19880818)
• IRF7/PHRF1 variants in combination with systemic lupus erythematosus-associated autoantibodies result in higher serum levels of IFNalpha (PMID:20112359)
• IRF7 is activated upon Chlamydia pneumoniae infection and is crucial for type I interferon-beta expression (PMID:20154210)
• interferon regulatory factor 7C has dual roles in Epstein-Barr virus-mediated lymphocyte transformation (PMID:20209099)
• The authors show that BRLF1 expression decreased induction of IFN-beta, and reduced expression of IRF3 and IRF7. (PMID:20381110)
• A20 negatively regulates LMP1-stimulated IRF7 ubiquitination and activity in EBV latency. (PMID:20392859)
• IRF3 rather than IRF7 regulates poly (I-C)-induced type I IFN responses in human synoviocytes (PMID:20483755)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	irf7	ENSDARG00000045661
mus_musculus	Irf7	ENSMUSG00000025498
rattus_norvegicus	Irf7	ENSRNOG00000017414

Paralogs (8): IRF6 (ENSG00000117595), IRF1 (ENSG00000125347), IRF3 (ENSG00000126456), IRF5 (ENSG00000128604), IRF4 (ENSG00000137265), IRF8 (ENSG00000140968), IRF2 (ENSG00000168310), IRF9 (ENSG00000213928)

Protein

Protein identifiers

Interferon regulatory factor 7 — Q92985 (reviewed: Q92985)

All UniProt accessions (6): A0A3B3ISC0, A0A3B3ISS4, A0A3B3ITQ5, E9PIA7, Q92985, M9RSF4

UniProt curated annotations — full annotation on UniProt →

Function. Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses. Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters. Can efficiently activate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genes and mediate their induction via both the virus-activated, MyD88-independent pathway and the TLR-activated, MyD88-dependent pathway. Induces transcription of ubiquitin hydrolase USP25 mRNA in response to lipopolysaccharide (LPS) or viral infection in a type I IFN-dependent manner. Required during both the early and late phases of the IFN gene induction but is more critical for the late than for the early phase. Exists in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, becomes phosphorylated by IKBKE and TBK1 kinases. This induces a conformational change, leading to its dimerization and nuclear localization where along with other coactivators it can activate transcription of the type I IFN and ISG genes. Can also play a role in regulating adaptive immune responses by inducing PSMB9/LMP2 expression, either directly or through induction of IRF1. Binds to the Q promoter (Qp) of EBV nuclear antigen 1 a (EBNA1) and may play a role in the regulation of EBV latency. Can activate distinct gene expression programs in macrophages and regulate the anti-tumor properties of primary macrophages.

Subunit / interactions. Monomer. Homodimer; phosphorylation-induced. Heterodimer with IRF3. Interacts with TICAM1 and TICAM2. Interacts with MYD88 and TRAF6. Interacts with TRIM35. Interacts with NMI; the interaction is direct and leads to the inhibition of IRF7-mediated type I IFN production. Interacts with GBP4; preventing interaction between TRAF6 and IRF7, resulting in impaired TRAF6-mediated IRF7 ubiquitination. (Microbial infection) Interacts with Epstein-Barr virus LF2 and LMP1. (Microbial infection) Interacts with rotavirus A NSP1; this interaction leads to the proteasome-dependent degradation of IRF7. (Microbial infection) Interacts with human herpes virus 8/HHV-8 proteins ORF45 and vIRF-1. (Microbial infection) Interacts with human T-cell leukemia virus 1/HTLV-1 protein HBZ. (Microbial infection) Interacts with Seneca Valley virus protease 3C; this interaction is involved in the suppression of IRF7 expression and phosphorylation by the virus. (Microbial infection) Interacts with ebolavirus VP35; this interaction mediates the sumoylation of IRF7 and contributes to the viral inhibition of IFN-type I production. (Microbial infection) Interacts with severe fever with thrombocytopenia syndrome virus (SFTSV) NSs; this interaction sequesters IRF7 in NSs-induced cytoplasmic inclusion bodies. (Microbial infection) Interacts with herpes virus 8/HHV-8 protein vIRF-4; this interaction prevents IRF7 dimerization and subsequent activation. (Microbial infection) Interacts with human metapneumovirus protein M2-2; this interaction prevents IRF7 phosphorylation and subsequent TLR7/9-dependent IFN-alpha induction.

Subcellular location. Nucleus. Cytoplasm.

Tissue specificity. Expressed predominantly in spleen, thymus and peripheral blood leukocytes.

Post-translational modifications. Acetylation inhibits its DNA-binding ability and activity. In response to a viral infection, phosphorylated on Ser-477 and Ser-479 by TBK1 and IKBKE1. Phosphorylation, and subsequent activation is inhibited by vaccinia virus protein E3. In TLR7- and TLR9-mediated signaling pathway, phosphorylated by IRAK1. TRAF6-mediated ubiquitination is required for IRF7 activation. TRIM35 mediates IRF7 ‘Lys-48’-linked polyubiquitination and subsequent proteasomal degradation. Ubiquitinated by UBE3C, leading to its degradation. Sumoylated by TRIM28, which inhibits its transactivation activity. (Microbial infection) Cleaved and inactivated by the protease 3C of enterovirus 71 allowing the virus to disrupt the host type I interferon production. (Microbial infection) Cleaved and inactivated by the protease 3C of human enterovirus 68D (EV68) allowing the virus to disrupt the host type I interferon production. ‘Lys-48’-linked polyubiquitination and subsequent proteasomal degradation is NMI-dependent in response to Sendai virus infection. ‘Lys-63’-linked ubiquitination by NEURL3 promotes IRF7 activation.

Disease relevance. Immunodeficiency 39, susceptibility to viral infections (IMD39) [MIM:616345] An autosomal recessive primary immunodeficiency causing severe, life-threatening acute respiratory distress upon infection with certain viruses, mainly H1N1 influenza A, SARS-CoV-2 and RSV. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. In the absence of viral infection, maintained as a monomer in an autoinhibited state and phosphorylation disrupts this autoinhibition leading to the liberation of the DNA-binding and dimerization activities and its nuclear localization where it can activate type I IFN and ISG genes.

Induction. By type I interferon (IFN) and viruses.

Miscellaneous. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Similarity. Belongs to the IRF family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q92985-1	A	yes
Q92985-2	B, Beta
Q92985-3	C, Gamma
Q92985-4	D, H

RefSeq proteins (3): NP_001563, NP_004020, NP_004022 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001346	Interferon_reg_fact_DNA-bd_dom	Domain
IPR008984	SMAD_FHA_dom_sf	Homologous_superfamily
IPR017855	SMAD-like_dom_sf	Homologous_superfamily
IPR019471	Interferon_reg_factor-3	Domain
IPR019817	Interferon_reg_fac_CS	Conserved_site
IPR036388	WH-like_DNA-bd_sf	Homologous_superfamily
IPR036390	WH_DNA-bd_sf	Homologous_superfamily

Pfam: PF00605, PF10401

UniProt features (61 total): sequence variant 15, mutagenesis site 13, modified residue 9, region of interest 4, splice variant 4, helix 4, strand 4, cross-link 3, site 2, chain 1, DNA-binding region 1, compositionally biased region 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2O61	X-RAY DIFFRACTION	2.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q92985-F1	70.10	0.32

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 167–168 ((microbial infection) cleavage; by viral ev68 protease 3c); 189–190 ((microbial infection) cleavage; by viral ev 71 protease 3c and ev68 protease 3c)

Post-translational modifications (12): 471, 472, 475, 477, 479, 483, 484, 487, 375, 444, 446, 92

Mutagenesis-validated functional residues (13):

Position	Phenotype
90	loss of acetylation, increased dna-binding and activity; when associated with r-93.
92	loss of acetylation, dna-binding and activity.
93	loss of acetylation, increased dna-binding and activity; when associated with t-90.
151	no effect on cleavage by enterovirus 71.
167	complete loss of inactivation of ifn-i production; when associated with r-189.
167	no effect on cleavage by enterovirus 71.
185	no effect on cleavage by enterovirus 71.
188	no effect on cleavage by enterovirus 71.
189	complete loss of cleavage by enterovirus 71.
189	complete loss of inactivation of ifn-i production; when associated with a-167.
215	no effect on cleavage by enterovirus 71.
375	loss of neurl3-mediated ubiquitination.
477–479	complete loss of tbk1 and ikke phosphorylation.

Function

Pathways and Gene Ontology

Reactome pathways

29 pathways

ID	Pathway
R-HSA-3134963	DEx/H-box helicases activate type I IFN and inflammatory cytokines production
R-HSA-877300	Interferon gamma signaling
R-HSA-9013973	TICAM1-dependent activation of IRF3/IRF7
R-HSA-909733	Interferon alpha/beta signaling
R-HSA-918233	TRAF3-dependent IRF activation pathway
R-HSA-933541	TRAF6 mediated IRF7 activation
R-HSA-936964	Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE)
R-HSA-9705671	SARS-CoV-2 activates/modulates innate and adaptive immune responses
R-HSA-975110	TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
R-HSA-1280215	Cytokine Signaling in Immune system
R-HSA-1643685	Disease
R-HSA-166016	Toll Like Receptor 4 (TLR4) Cascade
R-HSA-166166	MyD88-independent TLR4 cascade
R-HSA-168138	Toll Like Receptor 9 (TLR9) Cascade
R-HSA-168164	Toll Like Receptor 3 (TLR3) Cascade
R-HSA-168181	Toll Like Receptor 7/8 (TLR7/8) Cascade
R-HSA-168249	Innate Immune System
R-HSA-168256	Immune System
R-HSA-168898	Toll-like Receptor Cascades
R-HSA-168928	DDX58/IFIH1-mediated induction of interferon-alpha/beta
R-HSA-1834949	Cytosolic sensors of pathogen-associated DNA
R-HSA-5663205	Infectious disease
R-HSA-913531	Interferon Signaling
R-HSA-937061	TRIF (TICAM1)-mediated TLR4 signaling
R-HSA-9679506	SARS-CoV Infections
R-HSA-9694516	SARS-CoV-2 Infection
R-HSA-9705683	SARS-CoV-2-host interactions
R-HSA-975155	MyD88 dependent cascade initiated on endosome
R-HSA-9824446	Viral Infection Pathways

MSigDB gene sets: 573 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, REACTOME_DDX58_IFIH1_MEDIATED_INDUCTION_OF_INTERFERON_ALPHA_BETA, KOBAYASHI_EGFR_SIGNALING_24HR_UP, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_POSITIVE_REGULATION_OF_TYPE_I_INTERFERON_PRODUCTION, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_RESPONSE_TO_PEPTIDE, GOBP_REGULATION_OF_LEUKOCYTE_APOPTOTIC_PROCESS, GOBP_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOZGIT_ESR1_TARGETS_DN, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GRAESSMANN_RESPONSE_TO_MC_AND_SERUM_DEPRIVATION_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GOBP_RESPONSE_TO_TYPE_I_INTERFERON, GOBP_POSITIVE_REGULATION_OF_CYTOKINE_PRODUCTION

GO Biological Process (29): negative regulation of transcription by RNA polymerase II (GO:0000122), immune system process (GO:0002376), cytoplasmic pattern recognition receptor signaling pathway (GO:0002753), regulation of adaptive immune response (GO:0002819), regulation of transcription by RNA polymerase II (GO:0006357), DNA damage response (GO:0006974), response to virus (GO:0009615), immunoglobulin mediated immune response (GO:0016064), establishment of viral latency (GO:0019043), regulation of type I interferon production (GO:0032479), positive regulation of type I interferon production (GO:0032481), positive regulation of interferon-alpha production (GO:0032727), positive regulation of interferon-beta production (GO:0032728), regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124), regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127), MDA-5 signaling pathway (GO:0039530), innate immune response (GO:0045087), regulation of monocyte differentiation (GO:0045655), positive regulation of DNA-templated transcription (GO:0045893), positive regulation of transcription by RNA polymerase II (GO:0045944), regulation of immune response (GO:0050776), defense response to virus (GO:0051607), type I interferon-mediated signaling pathway (GO:0060337), positive regulation of type I interferon-mediated signaling pathway (GO:0060340), negative regulation of macrophage apoptotic process (GO:2000110), regulation of DNA-templated transcription (GO:0006355), signal transduction (GO:0007165), regulation of gene expression (GO:0010468), positive regulation of innate immune response (GO:0045089)

GO Molecular Function (8): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA binding (GO:0003677), sequence-specific double-stranded DNA binding (GO:1990837), transcription cis-regulatory region binding (GO:0000976), cis-regulatory region sequence-specific DNA binding (GO:0000987), DNA-binding transcription factor activity (GO:0003700), protein binding (GO:0005515)

GO Cellular Component (6): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), endosome membrane (GO:0010008)

Reactome top-level categories

Rollup of top-11 pathways:

Category	Pathways
Toll-like Receptor Cascades	4
Interferon Signaling	2
DDX58/IFIH1-mediated induction of interferon-alpha/beta	2
Immune System	2
Innate Immune System	2
Cytosolic sensors of pathogen-associated DNA	1
Toll Like Receptor 3 (TLR3) Cascade	1
TRIF (TICAM1)-mediated TLR4 signaling	1
SARS-CoV-2-host interactions	1
MyD88 dependent cascade initiated on endosome	1
Toll Like Receptor 4 (TLR4) Cascade	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
regulation of transcription by RNA polymerase II	3
transcription by RNA polymerase II	3
regulation of DNA-templated transcription	3
positive regulation of cytokine production	2
type I interferon production	2
positive regulation of type I interferon production	2
regulation of toll-like receptor signaling pathway	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
transcription cis-regulatory region binding	2
negative regulation of DNA-templated transcription	1
biological_process	1
pattern recognition receptor signaling pathway	1
intracellular receptor signaling pathway	1
adaptive immune response	1
regulation of immune response	1
cellular response to stress	1
response to other organism	1
B cell mediated immunity	1
viral process	1
viral latency	1
regulation of cytokine production	1
regulation of type I interferon production	1
interferon-alpha production	1
regulation of interferon-alpha production	1
interferon-beta production	1
regulation of interferon-beta production	1
MyD88-dependent toll-like receptor signaling pathway	1
MyD88-independent toll-like receptor signaling pathway	1
cytoplasmic pattern recognition receptor signaling pathway	1
immune response	1
defense response to symbiont	1
regulation of myeloid leukocyte differentiation	1
monocyte differentiation	1
DNA-templated transcription	1
positive regulation of RNA biosynthetic process	1
positive regulation of DNA-templated transcription	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1

Protein interactions and networks

STRING

3134 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
IRF7	MYD88	P78397	998
IRF7	TRAF6	Q9Y4K3	992
IRF7	JUN	P05412	989
IRF7	IRF3	Q14653	988
IRF7	TRAF3	Q13114	987
IRF7	IRAK1	P51617	979
IRF7	IRAK4	Q9NWZ3	964
IRF7	RIGI	O95786	949
IRF7	TLR9	Q9NR96	939
IRF7	IFNB1	P01574	935
IRF7	STAT2	P52630	922
IRF7	TLR7	Q9NYK1	920
IRF7	CHUK	O15111	916
IRF7	IFNA13	P01562	911
IRF7	TLR3	O15455	897

IntAct

44 interactions, top by confidence:

A	B	Type	Score
PIK3CA	PIK3R2	psi-mi:“MI:0914”(association)	0.900
IRF7	TRMT61B	psi-mi:“MI:0915”(physical association)	0.620
BICP0	IRF7	psi-mi:“MI:0915”(physical association)	0.560
BICP0	IRF7	psi-mi:“MI:0403”(colocalization)	0.560
TBK1	IRF7	psi-mi:“MI:0915”(physical association)	0.510
IRF7	TBK1	psi-mi:“MI:0915”(physical association)	0.510
IRF7	ORF45	psi-mi:“MI:0915”(physical association)	0.510
ORF45	IRF7	psi-mi:“MI:0915”(physical association)	0.510
IRF7	AIP	psi-mi:“MI:0914”(association)	0.500
IRF7	AIP	psi-mi:“MI:0915”(physical association)	0.500
LTN1	IRF7	psi-mi:“MI:0915”(physical association)	0.500
ARAF	IRF7	psi-mi:“MI:0915”(physical association)	0.500
IRAK1	IRF7	psi-mi:“MI:0915”(physical association)	0.500
TLK2	IRF7	psi-mi:“MI:0915”(physical association)	0.500
IRF7	CCDC47	psi-mi:“MI:0915”(physical association)	0.500
PALD1	IRF7	psi-mi:“MI:0915”(physical association)	0.500
CHUK	IRF7	psi-mi:“MI:0217”(phosphorylation reaction)	0.440
CHUK	P/V	psi-mi:“MI:0217”(phosphorylation reaction)	0.440
CHUK	P	psi-mi:“MI:0217”(phosphorylation reaction)	0.440
IRF7	Dlg4	psi-mi:“MI:0407”(direct interaction)	0.440
IRF7	MAFB	psi-mi:“MI:0915”(physical association)	0.400
IRF7	TRAF6	psi-mi:“MI:0915”(physical association)	0.400
IRF7	P/V	psi-mi:“MI:0915”(physical association)	0.400
P/V	IRF7	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (154): IRF7 (Two-hybrid), IRF7 (Affinity Capture-Western), TRAF6 (Affinity Capture-Western), IRF7 (Affinity Capture-Western), IRF7 (Affinity Capture-Western), IRF7 (Affinity Capture-Western), SOCS1 (Affinity Capture-Western), SOCS3 (Affinity Capture-Western), SOCS1 (Co-localization), SOCS3 (Co-localization), IRF7 (Biochemical Activity), IRF7 (Biochemical Activity), OTUD1 (Affinity Capture-Western), CAD (Affinity Capture-MS), CCT2 (Affinity Capture-MS)

ESM2 similar proteins: A1YF56, A2AEV7, A6NCS4, A7Y7W2, D3ZJK7, E1BEA8, F1MUS9, O15534, O35973, O43435, O43638, O60248, O75333, O77728, O94983, O95935, O95947, P22736, P46099, P51666, P56261, P57082, P70325, P70327, Q03484, Q0V8F0, Q15744, Q497V6, Q5DTT2, Q61660, Q61663, Q63HR2, Q64731, Q66JL1, Q6PZD9, Q6ZQN5, Q80Y50, Q810F8, Q861Q9, Q8AV66

Diamond homologs: A0FIN4, O14896, P10914, P14316, P15314, P23570, P23611, P23906, P56477, P97431, Q00978, Q02556, Q08DD6, Q13568, Q15306, Q3SZP0, Q58DJ0, Q61179, Q64287, Q8R4E0, Q90871, Q90876, Q92985, Q98925, P70434, P70671, Q764M6, Q90643, Q14653, Q4JF28, F5HF68

SIGNOR signaling

17 interactions.

A	Effect	B	Mechanism
CHUK	up-regulates	IRF7	phosphorylation
IRF7	“up-regulates quantity by expression”	IFNA1	“transcriptional regulation”
STAT1	“up-regulates quantity by expression”	IRF7	“transcriptional regulation”
TRIM59	“down-regulates activity”	IRF7
“Host translation inhibitor nsp1”	“down-regulates activity”	IRF7
IRF7	“up-regulates quantity by expression”	Interferon-type-I	“transcriptional regulation”
LF2	“down-regulates activity”	IRF7	binding
BZLF1	“down-regulates activity”	IRF7	binding
BRLF1	“down-regulates quantity by repression”	IRF7	“transcriptional regulation”
UBE2I	“down-regulates activity”	IRF7	sumoylation
LMP1	“down-regulates activity”	IRF7	sumoylation
TBK1	“up-regulates activity”	IRF7	phosphorylation
IRAK1	“up-regulates activity”	IRF7	phosphorylation
TRIM21	“down-regulates quantity by destabilization”	IRF7	ubiquitination
TRAF6	“up-regulates activity”	IRF7	ubiquitination
IKBKE	up-regulates	IRF7	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 31 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
SARS-CoV-2 activates/modulates innate and adaptive immune responses	6	25.5×	3e-05
PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling	5	23.0×	1e-04
PIP3 activates AKT signaling	5	15.9×	4e-04

GO biological processes:

GO term	Partners	Fold	FDR
toll-like receptor 4 signaling pathway	5	109.7×	3e-07
positive regulation of type I interferon production	5	87.8×	4e-07
positive regulation of canonical NF-kappaB signal transduction	7	21.2×	3e-06
DNA damage response	5	11.2×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

786 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	459
Likely benign	273
Benign	27

Top pathogenic / likely-pathogenic (0)

SpliceAI

1187 predictions. Top by Δscore:

Variant	Effect	Δscore
11:612994:CTCA:C	donor_loss	1.0000
11:612995:TCA:T	donor_loss	1.0000
11:612996:CAC:C	donor_loss	1.0000
11:612998:CCTTC:C	donor_loss	1.0000
11:613113:CAGCT:C	acceptor_gain	1.0000
11:613116:CT:C	acceptor_gain	1.0000
11:613118:C:A	acceptor_loss	1.0000
11:613118:C:CC	acceptor_gain	1.0000
11:613202:TGAC:T	donor_loss	1.0000
11:613203:GAC:G	donor_loss	1.0000
11:613594:CT:C	acceptor_gain	1.0000
11:613596:C:CC	acceptor_gain	1.0000
11:614794:CACC:C	donor_loss	1.0000
11:614795:A:T	donor_loss	1.0000
11:612796:TCCAG:T	acceptor_gain	0.9900
11:612797:CCAG:C	acceptor_gain	0.9900
11:612797:CCAGC:C	acceptor_gain	0.9900
11:612798:CAG:C	acceptor_gain	0.9900
11:612798:CAGC:C	acceptor_gain	0.9900
11:612799:AGCT:A	acceptor_loss	0.9900
11:612800:GCT:G	acceptor_loss	0.9900
11:612801:C:CC	acceptor_gain	0.9900
11:612805:C:CT	acceptor_gain	0.9900
11:612805:C:T	acceptor_gain	0.9900
11:612806:A:T	acceptor_gain	0.9900
11:612997:A:AC	donor_gain	0.9900
11:612998:C:CC	donor_gain	0.9900
11:613114:AGCT:A	acceptor_gain	0.9900
11:613117:TC:T	acceptor_loss	0.9900
11:613200:A:AC	donor_gain	0.9900

AlphaMissense

3210 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:614907:A:G	F95S	0.999
11:614915:T:A	K92N	0.998
11:614915:T:G	K92N	0.998
11:614916:T:A	K92I	0.998
11:615161:A:G	F40S	0.998
11:614876:G:C	F105L	0.997
11:614876:G:T	F105L	0.997
11:614877:A:G	F105S	0.997
11:614878:A:G	F105L	0.997
11:615100:G:C	F60L	0.997
11:615100:G:T	F60L	0.997
11:615102:A:G	F60L	0.997
11:615150:A:G	W44R	0.997
11:615150:A:T	W44R	0.997
11:613054:A:G	F434S	0.996
11:614831:C:A	K120N	0.996
11:614831:C:G	K120N	0.996
11:615002:C:A	W63C	0.996
11:615002:C:G	W63C	0.996
11:615148:C:A	W44C	0.996
11:615148:C:G	W44C	0.996
11:615160:G:C	F40L	0.996
11:615160:G:T	F40L	0.996
11:615162:A:G	F40L	0.996
11:614916:T:G	K92T	0.995
11:614918:C:A	W91C	0.995
11:614918:C:G	W91C	0.995
11:615004:A:G	W63R	0.995
11:615004:A:T	W63R	0.995
11:615101:A:G	F60S	0.995

dbSNP variants (sampled 300 via entrez): RS1000036067 (11:612527 A>G), RS1000394613 (11:612502 C>G), RS1001441736 (11:613516 G>A,C), RS1001455400 (11:615902 G>A,T), RS1001651375 (11:615469 C>T), RS1001809339 (11:614473 T>G), RS1001888306 (11:616060 G>C), RS1002491176 (11:616980 T>A), RS1002868924 (11:616735 T>C), RS1002882535 (11:613390 C>CCGCAGCAGTTCCTCCGTGTAG), RS1003671200 (11:612468 A>C,G), RS1004888989 (11:615721 C>T), RS1005264708 (11:615519 C>A,G,T), RS1005405358 (11:615840 C>G,T), RS1006081214 (11:614106 C>T)

Disease associations

OMIM: gene MIM:605047 | disease phenotypes: MIM:616345

GenCC curated gene-disease

Disease	Classification	Inheritance
immunodeficiency 39	Strong	Autosomal recessive

Mondo (2): immunodeficiency 39 (MONDO:0014597), autism spectrum disorder (MONDO:0005258)

Orphanet (2): Predisposition to severe viral infection due to IRF7 deficiency (Orphanet:574918), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

4 total (4 of 4 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0002721	Immunodeficiency
HP:0011463	Childhood onset
HP:0034249	Severe influenza infection

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST002069_16	Systemic lupus erythematosus and Systemic sclerosis	8.000000e-06
GCST003155_11	Systemic lupus erythematosus	9.000000e-10
GCST003156_6	Systemic lupus erythematosus	5.000000e-13
GCST003622_51	Systemic lupus erythematosus	9.000000e-11
GCST005752_136	Systemic lupus erythematosus	9.000000e-21
GCST007400_31	Systemic lupus erythematosus	1.000000e-16
GCST009131_16	Systemic sclerosis	2.000000e-08

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

87 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, decreases expression, affects expression, increases methylation	6
(+)-JQ1 compound	increases expression	4
sodium arsenite	affects cotreatment, increases expression	3
Tretinoin	affects expression, increases expression	3
tofacitinib	decreases expression	2
Decitabine	increases expression, increases reaction	2
Acetaminophen	increases expression	2
Vehicle Emissions	increases abundance, affects cotreatment, increases expression, decreases expression	2
Benzo(a)pyrene	increases expression, increases methylation	2
Estradiol	affects cotreatment, decreases expression, increases expression	2
Poly I-C	affects reaction, increases expression, decreases reaction, increases secretion	2
Tetrachlorodibenzodioxin	affects cotreatment, decreases expression, increases expression	2
PAM2-CSK4	increases expression	1
2,4-dichlorophenol	increases methylation	1
alpha phellandrene	increases expression	1
triphenyl phosphate	affects expression	1
geraniol	increases expression	1
hydroxyhydroquinone	decreases expression	1
beta-lapachone	increases expression	1
sulforaphane	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
nickel chloride	decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
tamibarotene	increases expression	1
chromium hexavalent ion	decreases reaction, increases expression, increases reaction, affects reaction	1
perfluoro-n-nonanoic acid	increases expression	1
JHW 015	decreases reaction, increases phosphorylation	1
monomethylarsonous acid	decreases expression	1
pinostrobin	increases expression	1
AG 1879	decreases reaction, increases expression	1

Cellosaurus cell lines

10 cell lines: 7 cancer cell line, 3 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A3G8	SEES3-1V human IRF7, clone1	Embryonic stem cell	Male
CVCL_A3G9	SEES3-1V human IRF7, clone2	Embryonic stem cell	Male
CVCL_A3H0	SEES3-1V human IRF7, clone3	Embryonic stem cell	Male
CVCL_B1G3	Abcam A-549 IRF7 KO 2	Cancer cell line	Male
CVCL_B1UQ	Abcam HeLa IRF7 KO	Cancer cell line	Female
CVCL_B2NL	Abcam A-549 IRF7 KO 1	Cancer cell line	Male
CVCL_E8F7	THP1-Dual KO-IRF7	Cancer cell line	Male
CVCL_ST00	HAP1 IRF7 (-) 1	Cancer cell line	Male
CVCL_ST01	HAP1 IRF7 (-) 2	Cancer cell line	Male
CVCL_ST02	HAP1 IRF7 (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00391261	PHASE4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT01028820	PHASE4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01333865	PHASE4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	PHASE4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	PHASE4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02096952	PHASE4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02235467	PHASE4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02940574	PHASE4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	PHASE4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	PHASE4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	PHASE4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	PHASE4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	PHASE4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	PHASE4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	PHASE4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	PHASE4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	PHASE4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	PHASE4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	PHASE4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	PHASE4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	PHASE4	NOT_YET_RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT01302964	PHASE3	COMPLETED	Mirtazapine Treatment of Anxiety in Children and Adolescents With Pervasive Developmental Disorders
NCT01706523	PHASE3	TERMINATED	Open Label Extension Study of STX209 (Arbaclofen) in Autism Spectrum Disorders
NCT01825798	PHASE3	COMPLETED	Treatment of Overweight Induced by Antipsychotic Medication in Young People With Autism Spectrum Disorders (ASD)
NCT01972074	PHASE3	COMPLETED	Behavioral and Neural Response to Memantine in Adolescents With Autism Spectrum Disorder
NCT02985749	PHASE3	COMPLETED	A Study of Oxytocin for the Treatment of Social Impairment in Individuals With High Functioning Autism Spectrum Disorder
NCT03197922	PHASE3	COMPLETED	Treatment of Encopresis in Children With Autism Spectrum Disorders
NCT03504917	PHASE3	TERMINATED	A Study of Balovaptan in Adults With Autism Spectrum Disorder With a 2-Year Open-Label Extension
NCT03553875	PHASE3	TERMINATED	Memantine for the Treatment of Social Deficits in Youth With Disorders of Impaired Social Interactions
NCT03640156	PHASE3	COMPLETED	Modulating Socially Adaptive Mirror System Functioning in Autism by Oxytocin
NCT03715153	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children Aged From 2 to Less Than 7 Years Old With Autism Spectrum Disorder.
NCT03715166	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children and Adolescents Aged From 7 to Less Than 18 Years Old With Autism Spectrum Disorder
NCT04233502	PHASE3	WITHDRAWN	Efficacy and Safety of Slenyto for Insomnia in Children With ASD
NCT04578756	PHASE3	COMPLETED	Open-Label, Flexible-dose Study to Evaluate the Long-Term Safety and Tolerability of Cariprazine in the Treatment of Pediatric Participants With Schizophrenia, Bipolar I Disorder, or Autism Spectrum Disorder
NCT04623398	PHASE3	COMPLETED	Effect of Lithium in Patients With Autism Spectrum Disorder and Phelan-McDermid Syndrome (SHANK3 Haploinsufficiency)
NCT04725383	PHASE3	TERMINATED	Amitriptyline for Repetitive Behaviors in Autism Spectrum Disorders
NCT05212493	PHASE3	COMPLETED	The Effects of Medical Cannabis in Children With Autistic Spectrum Disorder
NCT05361707	PHASE3	UNKNOWN	Evaluating the Effects of Tasimelteon in Individuals With Autism Spectrum Disorder (ASD) and Sleep Disturbances
NCT05439616	PHASE3	COMPLETED	Study of Cariprazine Oral Capsules or Solution to Assess Adverse Events and Change in Irritability Due to Autism Spectrum Disorder (ASD) in Participants Aged 5-17 Years With ASD
NCT06229210	PHASE3	RECRUITING	Safety and Tolerability Trial of Lumateperone in Pediatric Patients With Schizophrenia, Bipolar Disorder or Autism Spectrum Disorder