ITGA5

Summary

ITGA5 (integrin subunit alpha 5, HGNC:6141) is a protein-coding gene on chromosome 12q13.13, encoding Integrin alpha-5 (P08648). Integrin alpha-5/beta-1 (ITGA5:ITGB1) is a receptor for fibronectin and fibrinogen.

The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha subunit and a beta subunit that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 5 subunit. This subunit associates with the beta 1 subunit to form a fibronectin receptor. This integrin may promote tumor invasion, and higher expression of this gene may be correlated with shorter survival time in lung cancer patients. Note that the integrin alpha 5 and integrin alpha V subunits are encoded by distinct genes.

Source: NCBI Gene 3678 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 8 total
• Druggable target: yes — 4 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_002205

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6141
Approved symbol	ITGA5
Name	integrin subunit alpha 5
Location	12q13.13
Locus type	gene with protein product
Status	Approved
Aliases	CD49e
Ensembl gene	ENSG00000161638
Ensembl biotype	protein_coding
OMIM	135620
Entrez	3678

Gene structure

Transcript identifiers

Ensembl transcripts: 22 — 11 protein_coding, 8 retained_intron, 2 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000293379, ENST00000435631, ENST00000547197, ENST00000547744, ENST00000549601, ENST00000550141, ENST00000551564, ENST00000551861, ENST00000552387, ENST00000552431, ENST00000552564, ENST00000552583, ENST00000553071, ENST00000854881, ENST00000854882, ENST00000854883, ENST00000945317, ENST00000945318, ENST00000945319, ENST00000945320, ENST00000945321, ENST00000945322

RefSeq mRNA: 1 — MANE Select: NM_002205 NM_002205

CCDS: CCDS8880

Canonical transcript exons

ENST00000293379 — 30 exons

Exon	Start	End
ENSE00001059349	54418981	54419266
ENSE00001059361	54411834	54411964
ENSE00001603066	54400846	54400995
ENSE00001633552	54403625	54403779
ENSE00001665738	54403187	54403324
ENSE00001669883	54399864	54399947
ENSE00001676911	54404430	54404475
ENSE00001773315	54404703	54404894
ENSE00003460042	54405664	54405716
ENSE00003485458	54409232	54409352
ENSE00003497766	54408756	54408801
ENSE00003522800	54405870	54405926
ENSE00003523397	54409485	54409597
ENSE00003543540	54398597	54398698
ENSE00003544451	54395261	54396376
ENSE00003545320	54408893	54408954
ENSE00003549244	54399645	54399758
ENSE00003550752	54402001	54402093
ENSE00003563859	54401585	54401665
ENSE00003578455	54403911	54403966
ENSE00003579970	54408110	54408235
ENSE00003592662	54401776	54401855
ENSE00003595777	54402983	54403050
ENSE00003600523	54397365	54397487
ENSE00003605450	54407649	54407692
ENSE00003630745	54402180	54402330
ENSE00003657108	54407832	54407876
ENSE00003678822	54405166	54405374
ENSE00003689333	54404145	54404246
ENSE00003690911	54401373	54401478

Expression profiles

Bgee: expression breadth ubiquitous, 272 present calls, max score 99.69.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 55.8877 / max 971.7456, expressed in 1730 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
131353	39.0300	1711
131354	14.3066	1631
131350	1.6545	173
131352	0.8966	403

Top tissues by expression

290 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
popliteal artery	UBERON:0002250	99.69	gold quality
tibial artery	UBERON:0007610	99.69	gold quality
aorta	UBERON:0000947	99.35	gold quality
saphenous vein	UBERON:0007318	99.22	gold quality
muscle layer of sigmoid colon	UBERON:0035805	99.12	gold quality
descending thoracic aorta	UBERON:0002345	99.10	gold quality
lower esophagus muscularis layer	UBERON:0035833	98.99	gold quality
lower esophagus	UBERON:0013473	98.97	gold quality
thoracic aorta	UBERON:0001515	98.93	gold quality
stromal cell of endometrium	CL:0002255	98.91	gold quality
ascending aorta	UBERON:0001496	98.90	gold quality
smooth muscle tissue	UBERON:0001135	98.60	gold quality
left uterine tube	UBERON:0001303	98.43	gold quality
upper lobe of left lung	UBERON:0008952	98.33	gold quality
right lung	UBERON:0002167	98.30	gold quality
colonic epithelium	UBERON:0000397	98.29	gold quality
left coronary artery	UBERON:0001626	98.21	gold quality
right coronary artery	UBERON:0001625	98.19	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	98.19	gold quality
coronary artery	UBERON:0001621	98.10	gold quality
upper lobe of lung	UBERON:0008948	98.10	gold quality
mucosa of stomach	UBERON:0001199	98.09	gold quality
body of uterus	UBERON:0009853	98.05	gold quality
lower esophagus mucosa	UBERON:0035834	98.00	gold quality
cauda epididymis	UBERON:0004360	97.95	gold quality
omental fat pad	UBERON:0010414	97.28	gold quality
peritoneum	UBERON:0002358	97.24	gold quality
right atrium auricular region	UBERON:0006631	97.16	gold quality
endocervix	UBERON:0000458	97.01	gold quality
prostate gland	UBERON:0002367	96.84	gold quality

Single-cell (SCXA)

Detected in 11 experiment(s), a significant marker in 9.

Experiment	Marker?	Max mean expression
E-MTAB-6678	yes	1617.72
E-MTAB-7008	yes	330.83
E-MTAB-8142	yes	132.40
E-MTAB-6701	yes	85.63
E-MTAB-8410	yes	25.49
E-GEOD-83139	yes	7.95
E-CURD-112	yes	7.94
E-MTAB-5061	yes	6.78
E-GEOD-110499	no	897.11
E-GEOD-124858	no	627.04
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AP1, CEBPB, DIDO1, ETS1, FOS, HIF1A, HOXD3, ITGB8, JUN, NCOA1, NFIC, PAX6, SP1, SP3, ZEB2

miRNA regulators (miRDB)

120 targeting ITGA5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-23B-5P	99.98	66.07	587
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-23A-5P	99.94	65.39	468
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-1343-3P	99.89	66.78	1815
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-3681-3P	99.88	70.46	2254
HSA-MIR-3065-3P	99.87	70.25	1407
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-30A-3P	99.87	69.74	2928
HSA-MIR-30D-3P	99.87	69.92	2917
HSA-MIR-30E-3P	99.87	69.68	2942
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-4728-5P	99.85	69.39	4718

Literature-anchored findings (GeneRIF, showing 40)

• alternative pathway of pro-alpha(v) processing involving MT1-MMP: regulation of integrin functionality may be an important role of MT1-MMP in migrating tumor cells. (PMID:11741954)
• The PDZ domain of TIP-2/GIPC interacts with the C-terminus of the integrin alpha5 and alpha6 subunits. (PMID:11852236)
• role in mediating adhesion and migration of activated cycling CD34+ hematopoietic progenitor cells onto fibronectin (PMID:11877275)
• Integrin activation involves a conformational change in the alpha 1 helix of the beta subunit A-domain (PMID:11893752)
• results suggest that the inadequate trophoblastic invasion, induced by antiphospholipid antibodies, can be the result of decreased alpha1 integrin and VE-cadherin and increased alpha5 integrin and E-cadherin expression in the trophoblast (PMID:11937138)
• Central role of alpha5beta1 integrin in vascular development in mouse embryos and embryoid bodies. (PMID:12067900)
• TGF-beta1-stimulated osteoblasts require intracellular calcium signaling for enhanced alpha5 integrin expression (PMID:12081894)
• The alpha5beta1 integrin provides matrix survival signals for normal and osteoarthritic human articular chondrocytes in vitro. (PMID:12115183)
• results suggest that engagement of the alpha 5 beta 1 integrin promotes an NF-kappa B-dependent program of gene expression that coordinately regulates angiogenesis and inflammation (PMID:12138201)
• Expression of focal adhesion kinase and alpha5 and beta1 integrins in carcinomas and its clinical significance. (PMID:12174366)
• B. pertussis FHA up-regulates ICAM-1 expression on respiratory epithelial cells through interaction of its RGD site with host cell VLA-5 integrin, and that PT impairs this response (PMID:12220988)
• Elevated expression of IL-8 (and not PTHrP) by MDA-MET cells is a phenotypic change that may be related to their enhanced ability to metastasize to the skeleton. (PMID:12359771)
• integrin alpha5beta1 extracellular domain controls rhoA activity (PMID:12486108)
• Alterations in alpha5beta1 levels induced by TGF-beta are mediated at least in part through the induction of CTGF in glomerular mesangium (PMID:12595495)
• thymidine phosphorylase and 2-deoxyribose-induced focal adhesion kinase phosphorylation was blocked by the antibodies to integrins alpha 5 beta 1 and alpha v beta 3, directly linking their migration and signaling components (PMID:12639965)
• endostatin competes with fibronectin/RGD cyclic peptide to bind alpha 5 beta 1 integrin (PMID:12682293)
• identification of binding site in gamma C-domain of fibrinogen (PMID:12799374)
• alpha 5 beta 1 and alpha v beta 3 are both important but cell-specific fibrillin-1 receptors (PMID:12807887)
• VEGFR-1 secreted by endothelial cells interacts with the alpha 5 beta 1 integrin (PMID:12865438)
• visualized the head region of integrin alpha 5 beta 1 in an inactive (Ca2+-occupied) state, and in complex with a fragment of fibronectin containing the RGD and synergy recognition sequences (PMID:12871973)
• The structural conformation of this protein, complexed wigh integrin beta1, complexed with fibronectin, is examined. (PMID:12970173)
• Disulfide bonding patterns of the integrin alpha 5 chain are demonstrated; new insights into a second bond between the heavy and light chains of alpha 5 are described. (PMID:14596610)
• Hox D3 coordinately regulates the expression of integrin alpha5beta1 and integrin alphavbeta3 during angiogenesis in vivo. (PMID:14610084)
• Integrin alpha5beta1 and ADAM-17 interact in vitro and co-localize in migrating HeLa cells (PMID:14970227)
• beta1,4-N-acetylglucosaminyltransferase III inhibits the function of alpha5beta1 integrin (PMID:14998999)
• Role of alpha4, alpha5, and alphav integrin receptors–which are central to mediating interactions with these domains of FN–in regulating ssquamous cell carcinoma migration. (PMID:15051489)
• findings identify Glu-Pg as an adhesive ligand for integrins alphaMbeta2 and alpha5beta1 and suggest that alpha5beta1 may participate in the binding of soluble Glu-Pg and assist in its activation. (PMID:15090462)
• The marked decrease in integrin alpha5beta1 expressions was unique to aneurysmal aortic tissues and correlated to a decrease in density of smooth muscle cells (PMID:15100006)
• results indicate a new interaction partner for the alpha(v)beta(3) integrin, the TGFbetaIIR, in which TGFbeta1-induced responses are potentiated in the presence alpha(v)beta(3) ligands (PMID:15187087)
• Data show that squamous cell carcinoma cells escape suspension-induced, p53-mediated anoikis by forming multicellular aggregates that use fibronectin survival signals mediated by integrin alpha(v) and focal adhesion kinase. (PMID:15331608)
• integrin alpha5beta1 participates in the activation of both VEGFR-3 and its downstream PI3 kinase/Akt signaling pathway, which is essential for fibronectin-mediated lymphatic endothelial cell survival and proliferation. (PMID:15389531)
• The integrin, alpha 5 was expressed by prostate cancer cells in vitro and by prostate tumors in vivo, and their expression was elevated at sites of bone metastasis compared to original prostate tumor. (PMID:15500293)
• Insulin-like growth factor I controls adhesion strength mediated by alpha5beta1 integrins in tumor cells (PMID:15509657)
• Direct binding and regulation of alpha5beta1 by uPAR implies a modified “bent” integrin conformation can function in an alternative activation state with this and possibly other cis-acting membrane ligands. (PMID:15684035)
• Alpha5beta1 integrin is required for up-regulation of IL-1 beta-dependent airway smooth muscle secretory responses by fibronectin. (PMID:15699160)
• the alpha5 integrin subunit has a role in the induction of apoptosis triggered by FGFR2 activation in osteoblasts, and a Cbl-dependent mechanism is involved in the coordinated regulation of cell apoptosis induced by alpha5 integrin degradation (PMID:15728256)
• Alpha5beta1-mediated adhesion of Ntera2 neuronal cells to fibronectin decreased apoptosis in response to serum withdrawal. (PMID:15737747)
• integrin alpha5/beta1 exerts its tumor suppressor-like activity in colon cancer cells by inhibiting HER-2 signaling (PMID:15757908)
• findings suggest that only some P. aeruginosa strains can target Fn and their natural receptors alpha5beta1 integrins for adherence to A549 cells (PMID:15881415)
• alpha3, alpha5, and alpha6 beta1 integrins are expressed in ductal cells at 8 weeks, before glucagon- and insulin-immunoreactive cells bud off in fetal pancrea. (PMID:15983209)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	itga5	ENSDARG00000006353
mus_musculus	Itga5	ENSMUSG00000000555
rattus_norvegicus	Itga5	ENSRNOG00000057451
drosophila_melanogaster	if	FBGN0001250
drosophila_melanogaster	ItgaPS4	FBGN0034005
drosophila_melanogaster	ItgaPS5	FBGN0034880
drosophila_melanogaster	scb	FBGN0286785
caenorhabditis_elegans		WBGENE00003929

Paralogs (17): ITGAL (ENSG00000005844), ITGA3 (ENSG00000005884), ITGA2B (ENSG00000005961), ITGA8 (ENSG00000077943), ITGAE (ENSG00000083457), ITGA6 (ENSG00000091409), ITGA4 (ENSG00000115232), ITGA7 (ENSG00000135424), ITGA11 (ENSG00000137809), ITGAV (ENSG00000138448), ITGAX (ENSG00000140678), ITGA10 (ENSG00000143127), ITGA9 (ENSG00000144668), ITGAD (ENSG00000156886), ITGA2 (ENSG00000164171), ITGAM (ENSG00000169896), ITGA1 (ENSG00000213949)

Protein

Protein identifiers

Integrin alpha-5 — P08648 (reviewed: P08648)

Alternative names: CD49 antigen-like family member E, Fibronectin receptor subunit alpha, Integrin alpha-F, VLA-5

All UniProt accessions (4): B4E3F4, P08648, H0YHL9, H0YIV7

UniProt curated annotations — full annotation on UniProt →

Function. Integrin alpha-5/beta-1 (ITGA5:ITGB1) is a receptor for fibronectin and fibrinogen. It recognizes the sequence R-G-D in its ligands. ITGA5:ITGB1 binds to PLA2G2A via a site (site 2) which is distinct from the classical ligand-binding site (site 1) and this induces integrin conformational changes and enhanced ligand binding to site 1. ITGA5:ITGB1 acts as a receptor for fibrillin-1 (FBN1) and mediates R-G-D-dependent cell adhesion to FBN1. ITGA5:ITGB1 acts as a receptor for fibronectin (FN1) and mediates R-G-D-dependent cell adhesion to FN1. ITGA5:ITGB1 is a receptor for IL1B and binding is essential for IL1B signaling. ITGA5:ITGB3 is a receptor for soluble CD40LG and is required for CD40/CD40LG signaling. (Microbial infection) Integrin ITGA5:ITGB1 acts as a receptor for Human metapneumovirus. (Microbial infection) Integrin ITGA2:ITGB1 acts as a receptor for Human parvovirus B19. (Microbial infection) In case of HIV-1 infection, the interaction with extracellular viral Tat protein seems to enhance angiogenesis in Kaposi’s sarcoma lesions.

Subunit / interactions. Heterodimer of an alpha and a beta subunit. The alpha subunit is composed of a heavy and a light chain linked by a disulfide bond. ITGA5/Alpha-5 associates with ITGB1/beta-1. Interacts with NISCH. Interacts with HPS5. Interacts with RAB21 and COMP. Interacts with CIB1. ITGA5:ITGB1 interacts with CCN3. ITGA5:ITGB1 interacts with FBN1. ITGA5:ITGB1 interacts with IL1B. ITGA5:ITGB1 interacts with ACE2. ITGA5:ITGB1 interacts with SELP. Interacts with ANGPT2. ITGA5:ITGB1 interacts with IGFBP2. ITGA5:ITGB1 interacts with IGFBP1. (Microbial infection) Integrin ITGA5:ITGB1 interacts with human metapneumovirus fusion protein. (Microbial infection) Integrin ITGA5:ITGB1 interacts with human parvovirus B19 capsid proteins. (Microbial infection) Interacts with HIV-1 Tat. (Microbial infection) ITGA5:ITGB1 interacts with SARS coronavirus-2/SARS-CoV-2 spike protein.

Subcellular location. Cell membrane. Cell junction. Focal adhesion.

Tissue specificity. Expressed in placenta (at protein level).

Post-translational modifications. Proteolytic cleavage by PCSK5 mediates activation of the precursor.

Similarity. Belongs to the integrin alpha chain family.

RefSeq proteins (1): NP_002196* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000413	Integrin_alpha	Family
IPR013517	FG-GAP	Repeat
IPR013519	Int_alpha_beta-p	Repeat
IPR013649	Integrin_alpha_Ig-like_1	Domain
IPR018184	Integrin_alpha_C_CS	Conserved_site
IPR028994	Integrin_alpha_N	Homologous_superfamily
IPR032695	Integrin_dom_sf	Homologous_superfamily
IPR048285	Integrin_alpha_Ig-like_2	Domain
IPR048286	Integrin_alpha_Ig-like_3	Domain

Pfam: PF01839, PF08441, PF20805, PF20806

UniProt features (137 total): strand 57, binding site 22, glycosylation site 14, disulfide bond 10, repeat 7, turn 7, helix 6, chain 3, region of interest 2, topological domain 2, sequence conflict 2, signal peptide 1, short sequence motif 1, modified residue 1, transmembrane region 1, sequence variant 1

Structure

Experimental structures (PDB)

16 structures.

PDB	Method	Resolution (Å)
4WK0	X-RAY DIFFRACTION	1.78
4WJK	X-RAY DIFFRACTION	1.85
9HMH	X-RAY DIFFRACTION	1.92
4WK2	X-RAY DIFFRACTION	2.5
4WK4	X-RAY DIFFRACTION	2.5
9B9J	ELECTRON MICROSCOPY	2.6
9P6S	ELECTRON MICROSCOPY	2.61
9B9K	ELECTRON MICROSCOPY	2.7
9HMI	X-RAY DIFFRACTION	2.78
3VI3	X-RAY DIFFRACTION	2.9
3VI4	X-RAY DIFFRACTION	2.9
9DIA	ELECTRON MICROSCOPY	2.97
7NWL	ELECTRON MICROSCOPY	3.1
9CKV	ELECTRON MICROSCOPY	3.19
9EF2	ELECTRON MICROSCOPY	3.36
7NXD	ELECTRON MICROSCOPY	4.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P08648-F1	85.35	0.56

Antibody-complex structures (SAbDab): 5 — 3VI3, 3VI4, 7NWL, 9B9J, 9B9K

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (22): 262; 269; 280; 282; 284; 286; 288; 334; 336; 338; 340; 342 …

Post-translational modifications (1): 127

Disulfide bonds (10): 99–108, 156–176, 192–205, 513–522, 528–584, 645–651, 718–731, 849–957, 869–921, 911–916

Glycosylation sites (14): 84, 182, 297, 307, 316, 524, 530, 593, 609, 675, 712, 724, 773, 868

Function

Pathways and Gene Ontology

Reactome pathways

26 pathways

ID	Pathway
R-HSA-1566948	Elastic fibre formation
R-HSA-1566977	Fibronectin matrix formation
R-HSA-202733	Cell surface interactions at the vascular wall
R-HSA-216083	Integrin cell surface interactions
R-HSA-445144	Signal transduction by L1
R-HSA-8941332	RUNX2 regulates genes involved in cell migration
R-HSA-9634597	GPER1 signaling
R-HSA-9856532	Mechanical load activates signaling by PIEZO1 and integrins in osteocytes
R-HSA-9860927	Turbulent (oscillatory, disturbed) flow shear stress activates signaling by PIEZO1 and integrins in endothelial cells
R-HSA-109582	Hemostasis
R-HSA-1266738	Developmental Biology
R-HSA-1474244	Extracellular matrix organization
R-HSA-162582	Signal Transduction
R-HSA-212436	Generic Transcription Pathway
R-HSA-372790	Signaling by GPCR
R-HSA-373760	L1CAM interactions
R-HSA-388396	GPCR downstream signalling
R-HSA-418555	G alpha (s) signalling events
R-HSA-422475	Axon guidance
R-HSA-73857	RNA Polymerase II Transcription
R-HSA-74160	Gene expression (Transcription)
R-HSA-8878166	Transcriptional regulation by RUNX2
R-HSA-8953897	Cellular responses to stimuli
R-HSA-9675108	Nervous system development
R-HSA-9855142	Cellular responses to mechanical stimuli
R-HSA-9860931	Response of endothelial cells to shear stress

MSigDB gene sets: 430 (showing top): GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_MEMORY, GOBP_REGULATION_OF_CELLULAR_RESPONSE_TO_GROWTH_FACTOR_STIMULUS, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_COGNITION, GOBP_HETEROPHILIC_CELL_CELL_ADHESION, GOBP_VASCULAR_ENDOTHELIAL_GROWTH_FACTOR_SIGNALING_PATHWAY, GOBP_BEHAVIOR, GOBP_FORMATION_OF_PRIMARY_GERM_LAYER, CMYB_01, MODULE_45, BOYAULT_LIVER_CANCER_SUBCLASS_G2, GOBP_POSITIVE_REGULATION_OF_VASCULATURE_DEVELOPMENT, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN

GO Biological Process (30): angiogenesis (GO:0001525), autophagy (GO:0006914), cell-substrate junction assembly (GO:0007044), cell adhesion (GO:0007155), heterophilic cell-cell adhesion (GO:0007157), leukocyte cell-cell adhesion (GO:0007159), cell-matrix adhesion (GO:0007160), integrin-mediated signaling pathway (GO:0007229), female pregnancy (GO:0007565), memory (GO:0007613), negative regulation of autophagy (GO:0010507), positive regulation of cell-substrate adhesion (GO:0010811), response to muscle activity (GO:0014850), CD40 signaling pathway (GO:0023035), positive regulation of cell migration (GO:0030335), positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949), cell-substrate adhesion (GO:0031589), cell adhesion mediated by integrin (GO:0033627), cell-cell adhesion mediated by integrin (GO:0033631), heterotypic cell-cell adhesion (GO:0034113), wound healing, spreading of epidermal cells (GO:0035313), endodermal cell differentiation (GO:0035987), cell-cell adhesion (GO:0098609), positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748), positive regulation of sprouting angiogenesis (GO:1903672), negative regulation of anoikis (GO:2000811), formation of primary germ layer (GO:0001704), tissue development (GO:0009888), regulation of angiogenesis (GO:0045765), symbiont entry into host cell (GO:0046718)

GO Molecular Function (11): virus receptor activity (GO:0001618), epidermal growth factor receptor binding (GO:0005154), platelet-derived growth factor receptor binding (GO:0005161), integrin binding (GO:0005178), calcium ion binding (GO:0005509), signaling receptor activity (GO:0038023), vascular endothelial growth factor receptor 2 binding (GO:0043184), signaling receptor binding (GO:0005102), protein binding (GO:0005515), metal ion binding (GO:0046872), cell adhesion molecule binding (GO:0050839)

GO Cellular Component (19): ruffle (GO:0001726), endoplasmic reticulum (GO:0005783), Golgi apparatus (GO:0005794), plasma membrane (GO:0005886), focal adhesion (GO:0005925), integrin complex (GO:0008305), external side of plasma membrane (GO:0009897), cell surface (GO:0009986), cytoplasmic vesicle (GO:0031410), integrin alpha5-beta1 complex (GO:0034674), postsynaptic membrane (GO:0045211), alphav-beta3 integrin-vitronectin complex (GO:0071062), glutamatergic synapse (GO:0098978), cell-cell junction (GO:0005911), membrane (GO:0016020), cell junction (GO:0030054), ruffle membrane (GO:0032587), synapse (GO:0045202), anchoring junction (GO:0070161)

Reactome top-level categories

Rollup of top-14 pathways:

Category	Pathways
Extracellular matrix organization	3
Hemostasis	1
L1CAM interactions	1
Transcriptional regulation by RUNX2	1
G alpha (s) signalling events	1
Cellular responses to mechanical stimuli	1
Response of endothelial cells to shear stress	1
RNA Polymerase II Transcription	1
Signal Transduction	1
Axon guidance	1
Signaling by GPCR	1
GPCR downstream signalling	1
Nervous system development	1
Gene expression (Transcription)	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cell-cell adhesion	4
cytoplasm	3
cellular anatomical structure	3
cell-substrate adhesion	2
cell surface receptor signaling pathway	2
cell adhesion	2
growth factor receptor binding	2
protein binding	2
endomembrane system	2
intracellular membrane-bounded organelle	2
cell junction	2
blood vessel morphogenesis	1
anatomical structure formation involved in morphogenesis	1
catabolic process	1
transmembrane transport	1
process utilizing autophagic mechanism	1
cell junction assembly	1
cell-substrate junction organization	1
cellular process	1
multi-organism reproductive process	1
multi-multicellular organism process	1
learning or memory	1
autophagy	1
negative regulation of catabolic process	1
regulation of autophagy	1
regulation of cell-substrate adhesion	1
positive regulation of cell adhesion	1
response to activity	1
cell migration	1
regulation of cell migration	1
positive regulation of cell motility	1
positive regulation of signal transduction	1
regulation of vascular endothelial growth factor receptor signaling pathway	1
vascular endothelial growth factor receptor signaling pathway	1
cell adhesion mediated by integrin	1
symbiont entry into host cell	1
exogenous protein binding	1
signaling receptor binding	1
protein-containing complex binding	1
cell adhesion molecule binding	1

Protein interactions and networks

STRING

2562 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ITGA5	ITGB1	P05556	999
ITGA5	FN1	P02751	998
ITGA5	ITGB3	P05106	981
ITGA5	ITGB2	P05107	922
ITGA5	VTN	P01141	920
ITGA5	ITGB7	P26010	874
ITGA5	ITGB5	P18084	874
ITGA5	COL1A1	P02452	838
ITGA5	ITGB4	P16144	819
ITGA5	VCAM1	P19320	819
ITGA5	NISCH	Q9Y2I1	803
ITGA5	CD151	P48509	768
ITGA5	COL6A1	P12109	764
ITGA5	CD44	P16070	754
ITGA5	CD9	P21926	751

IntAct

109 interactions, top by confidence:

A	B	Type	Score
ITGB1	ITGA5	psi-mi:“MI:0914”(association)	0.910
ITGB1	ITGA5	psi-mi:“MI:0915”(physical association)	0.910
ITGA5	ITGB1	psi-mi:“MI:0915”(physical association)	0.910
ITGA5	ITGB1	psi-mi:“MI:0914”(association)	0.910
ITGA5	FN1	psi-mi:“MI:0407”(direct interaction)	0.840
FN1	ITGA5	psi-mi:“MI:0403”(colocalization)	0.840
FN1	ITGB1	psi-mi:“MI:0915”(physical association)	0.750
FN1	ITGB3	psi-mi:“MI:0915”(physical association)	0.750
CD9	ADAM10	psi-mi:“MI:0914”(association)	0.750
FN1	ITGB1	psi-mi:“MI:0914”(association)	0.750
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
CX3CL1	ITGB3	psi-mi:“MI:0915”(physical association)	0.690
FGG	ITGB3	psi-mi:“MI:0915”(physical association)	0.660
SHARPIN	ITGA5	psi-mi:“MI:0915”(physical association)	0.600
ITGA5	SHARPIN	psi-mi:“MI:0915”(physical association)	0.600
SHARPIN	ITGA5	psi-mi:“MI:2364”(proximity)	0.600
ENG	ITGA5	psi-mi:“MI:0915”(physical association)	0.560
ITGA5	ENG	psi-mi:“MI:0915”(physical association)	0.560
ITGA5	ENG	psi-mi:“MI:0403”(colocalization)	0.560
ITGA5	Nrp1	psi-mi:“MI:0915”(physical association)	0.540
ITGA5	Nrp1	psi-mi:“MI:0407”(direct interaction)	0.540
CD81	C2orf72	psi-mi:“MI:0914”(association)	0.530

BioGRID (185): SEL1L (Affinity Capture-Western), ITGA5 (Affinity Capture-Western), ITGA5 (Affinity Capture-Western), ITGA5 (Affinity Capture-MS), ITGA5 (Co-fractionation), ITGA5 (Co-fractionation), ITGB1 (Co-fractionation), ITGB3 (Co-fractionation), LGALS3BP (Reconstituted Complex), ITGA5 (Biochemical Activity), ITGA5 (Affinity Capture-MS), ITGA5 (FRET), ITGA5 (Reconstituted Complex), ITGA5 (Reconstituted Complex), ITGA5 (Reconstituted Complex)

ESM2 similar proteins: A0JND9, E1BPW0, O14773, O18956, O35795, O55026, O75173, O75355, O75356, O75578, O89023, O93295, P08514, P08648, P11688, P17405, P49961, P55772, P56201, P79784, P97687, Q04519, Q0VD19, Q12794, Q32M88, Q49HH9, Q49KI5, Q5DRK1, Q5IS74, Q5MY95, Q5RFL1, Q5RFQ8, Q60HH1, Q6P3E7, Q6P6S9, Q717C1, Q717C2, Q7RTX0, Q8BFW6, Q8BNJ2

Diamond homologs: A2ARA8, O70362, P06756, P08514, P08648, P11688, P12080, P26008, P26009, P34446, P43406, P53708, P53711, P80108, P80109, P80746, Q06274, Q27977, Q61739, Q86AV9, Q8R2H5, Q9QUM0, A8X3A7, F1MMS9, O75578, P20701, P23229, P26006, P26007, P38570, Q00651, Q13683, Q13797, Q24247, Q60677, Q61738, Q63258, Q91687, Q9W1M8, P20702

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
DIDO1	“up-regulates quantity by expression”	ITGA5	“transcriptional regulation”
HOXD3	“up-regulates quantity by expression”	ITGA5	“transcriptional regulation”
ITGA5	“form complex”	“A5/b1 integrin”	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 90 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Integrin cell surface interactions	6	13.4×	2e-03
Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell	6	8.7×	6e-03

GO biological processes:

GO term	Partners	Fold	FDR
integrin-mediated signaling pathway	8	16.7×	2e-05
positive regulation of endothelial cell proliferation	5	15.0×	3e-03
cell-matrix adhesion	7	14.9×	1e-04
positive regulation of angiogenesis	6	9.0×	4e-03
positive regulation of ERK1 and ERK2 cascade	6	6.6×	9e-03
cell adhesion	13	6.3×	5e-05
angiogenesis	7	5.7×	9e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

8 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	5
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2979 predictions. Top by Δscore:

Variant	Effect	Δscore
12:54397359:GCTGA:G	donor_loss	1.0000
12:54397360:CTGAC:C	donor_loss	1.0000
12:54397361:TGA:T	donor_loss	1.0000
12:54397362:GACCT:G	donor_loss	1.0000
12:54397364:C:T	donor_loss	1.0000
12:54397484:CCAC:C	acceptor_gain	1.0000
12:54397485:CAC:C	acceptor_gain	1.0000
12:54397485:CACC:C	acceptor_gain	1.0000
12:54397486:AC:A	acceptor_gain	1.0000
12:54397487:CC:C	acceptor_gain	1.0000
12:54397488:C:CC	acceptor_gain	1.0000
12:54397489:T:C	acceptor_loss	1.0000
12:54398592:CTCA:C	donor_loss	1.0000
12:54398593:TCAC:T	donor_loss	1.0000
12:54398594:CACCT:C	donor_loss	1.0000
12:54398595:A:AC	donor_gain	1.0000
12:54398595:ACC:A	donor_loss	1.0000
12:54398596:C:CC	donor_gain	1.0000
12:54398596:CCTGA:C	donor_gain	1.0000
12:54398694:TCCCG:T	acceptor_gain	1.0000
12:54398695:CCCG:C	acceptor_gain	1.0000
12:54398695:CCCGC:C	acceptor_gain	1.0000
12:54398696:CCG:C	acceptor_gain	1.0000
12:54398696:CCGC:C	acceptor_gain	1.0000
12:54398697:CG:C	acceptor_gain	1.0000
12:54398697:CGCTG:C	acceptor_gain	1.0000
12:54398698:GCTGT:G	acceptor_loss	1.0000
12:54398699:C:CC	acceptor_gain	1.0000
12:54398699:CT:C	acceptor_loss	1.0000
12:54399944:CCAA:C	acceptor_gain	1.0000

AlphaMissense

6765 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:54403013:C:G	C651S	1.000
12:54403014:A:T	C651S	1.000
12:54402022:G:C	N735K	0.999
12:54402022:G:T	N735K	0.999
12:54402035:C:G	C731S	0.999
12:54402036:A:T	C731S	0.999
12:54402235:A:G	L693P	0.999
12:54402267:A:C	N682K	0.999
12:54402267:A:T	N682K	0.999
12:54403012:A:C	C651W	0.999
12:54403013:C:T	C651Y	0.999
12:54403014:A:G	C651R	0.999
12:54403031:C:A	C645F	0.999
12:54403031:C:G	C645S	0.999
12:54403031:C:T	C645Y	0.999
12:54403032:A:G	C645R	0.999
12:54403032:A:T	C645S	0.999
12:54403043:A:G	I641T	0.999
12:54408923:G:C	C205W	0.999
12:54409240:C:G	C192S	0.999
12:54409240:C:T	C192Y	0.999
12:54409241:A:G	C192R	0.999
12:54409241:A:T	C192S	0.999
12:54409287:G:C	C176W	0.999
12:54409288:C:T	C176Y	0.999
12:54409289:A:G	C176R	0.999
12:54409329:C:A	W162C	0.999
12:54409329:C:G	W162C	0.999
12:54409347:G:C	C156W	0.999
12:54409348:C:T	C156Y	0.999

dbSNP variants (sampled 300 via entrez): RS1000212357 (12:54411113 C>T), RS1000214590 (12:54420616 A>G), RS1000378670 (12:54414220 C>T), RS1000676153 (12:54415108 A>G), RS1000791619 (12:54400232 G>A,C), RS1000895178 (12:54413896 G>A), RS1000935905 (12:54415356 G>A), RS1001132557 (12:54416227 G>A,T), RS1001160000 (12:54399941 G>A,C), RS1001313982 (12:54408668 CCACTGCACTCCAGCCTGGGTGA>C), RS1001541609 (12:54409227 C>T), RS1001566451 (12:54402766 C>A), RS1001643742 (12:54396227 C>T), RS1001718300 (12:54410422 T>G), RS1001807409 (12:54395462 G>A)

Disease associations

OMIM: gene MIM:135620 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005962_20	Waist-to-hip ratio adjusted for BMI x sex x age interaction (4df test)	7.000000e-13

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008007	age at assessment
EFO:0008343	sex interaction measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (9): CHEMBL2095226 (PROTEIN COMPLEX), CHEMBL2111425 (PROTEIN COMPLEX GROUP), CHEMBL3430893 (PROTEIN COMPLEX), CHEMBL3885595 (PROTEIN COMPLEX), CHEMBL3955 (SINGLE PROTEIN), CHEMBL6066568 (PROTEIN COMPLEX), CHEMBL6066569 (PROTEIN COMPLEX), CHEMBL6066570 (PROTEIN COMPLEX), CHEMBL6066571 (PROTEIN COMPLEX)

Molecules with ChEMBL bioactivity

4 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 47,209 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL894	BUPROPION	4	36,982
CHEMBL429876	CILENGITIDE	3	10,123
CHEMBL3319236	GLPG-0187	1	96
CHEMBL4241824	GSK-3008348 FREE BASE	1	8

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: catalytic receptor — Integrins

Most potent curated ligand interactions (1 total), top 1:

Ligand	Action	Affinity	Parameter
volociximab	Binding	9.49	pKd

Binding affinities (BindingDB)

51 measured of 75 human assays (75 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
(3S)-3-[3-bromo-5-(trifluoromethyl)phenyl]-3-[[2-[[5-[(5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino]pyridine-3-carbonyl]amino]acetyl]amino]propanoic acid	IC50	0.3 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-chloro-5-(difluoromethyl)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido]propanoic acid	IC50	0.5 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-bromo-5-methyl-phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	0.5 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-bromo-5-chloro-phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido]propanoic acid	IC50	0.6 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-(3-bromo-5-chloro-phenyl)-3-[[2-[[5-[(5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino]pyridine-3-carbonyl]amino]acetyl]amino]propanoic acid	IC50	0.6 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-bromo-5-fluoro-phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	0.6 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-(3,5-dibromophenyl)-3-[[2-[[5-[(5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino]pyridine-3-carbonyl]amino]acetyl]amino]propanoic acid	IC50	0.6 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-bromo-5-(difluoromethyl)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido]propanoic acid	IC50	0.7 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-chloro-5-(trifluoromethyl)phenyl]3-[[2-[[5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino]pyridine-3-carbonyl]amino]acetyl]amino]propanoic acid	IC50	0.7 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
CHEMBL4794201	IC50	0.7 nM
(3S)-3-(3-bromo-5-(trifluoromethyl)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	0.8 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-chloro-5-(trifluoromethyl)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido]propanoic acid	IC50	0.8 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-(3,5-dibromophenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	1 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3,5-bis(trifluoromethyl)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido]propanoic acid	IC50	1 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3,5-dichloro-phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	1 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-[3-chloro-5-(trifluoromethoxy)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	1 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
(3S)-3-(3-bromo-5-(trifluoromethoxy)phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	1 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
CHEMBL4741135	IC50	1 nM
CHEMBL4749110	IC50	1.4 nM
CHEMBL4756339	IC50	1.6 nM
(3S)-3-[3-chloro-5-methyl-phenyl)-3-(2-(3-hydroxy-5-((5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino)benzamido)acetamido)propanoic acid	IC50	2 nM	US-10035778: Meta-azacyclic amino benzoic acid derivatives as pan integrin antagonists
3-[3-[4-(1H-benzimidazol-2-ylamino)butyl]-2-oxoimidazolidin-1-yl]-3-[3-(trifluoromethyl)phenyl]propanoic acid	IC50	376 nM	US-10118929: Nonanoic and decanoic acid derivatives and uses thereof
3-[2-oxo-3-[4-(pyridin-2-ylamino)butyl]imidazolidin-1-yl]-3-[3-(trifluoromethyl)phenyl]propanoic acid	IC50	394 nM	US-10118929: Nonanoic and decanoic acid derivatives and uses thereof
(2S)-3-[4-(3-aminopropanoylamino)phenyl]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-3-[4-(4-aminobutanoylamino)phenyl]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[[2-(diaminomethylideneamino)acetyl]amino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[6-(diaminomethylideneamino)hexanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
5-[[6-[[(2S)-1-[4-[(2S)-2-[[1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-2-carboxyethyl]anilino]-4-(diaminomethylideneamino)-1-oxobutan-2-yl]amino]-6-oxohexyl]sulfamoyl]-2-[3-(diethylamino)-6-diethylazaniumylidenexanthen-9-yl]benzenesulfonate	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
5-[2-[2-[2-[3-[[(2S)-1-[4-[(2S)-2-[[1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-2-carboxyethyl]anilino]-4-(diaminomethylideneamino)-1-oxobutan-2-yl]amino]-3-oxopropoxy]ethoxy]ethoxy]ethoxysulfamoyl]-2-[6-(diethylamino)-3-diethylazaniumylidene-4,4a-dihydroxanthen-9-yl]benzenesulfonate	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[4-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)butanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
US10131658, Compound 93	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[5-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)pentanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[[(2R)-5-(diaminomethylideneamino)-2-[6-(methylamino)hexanoylamino]pentanoyl]amino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[4-[(3,5-dimethyl-2-pyridinyl)amino]butanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-3-[4-[4-[[amino(phenyl)methylidene]amino]butanoylamino]phenyl]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[5-(4,5-dihydro-1H-imidazol-2-ylamino)pentanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[5-(pyridin-2-ylamino)pentanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[5-(1,4,5,6-tetrahydropyrimidin-2-ylamino)pentanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)piperidine-2-carbonyl]amino]-3-[4-[5-(diaminomethylideneamino)pentanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)piperidine-2-carbonyl]amino]-3-[4-[4-(diaminomethylideneamino)butanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[[4-(diaminomethylideneamino)benzoyl]amino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[4-[(5-methyl-2-pyridinyl)amino]butanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-3-[4-[4-(diaminomethylideneamino)butanoylamino]phenyl]-2-[[(2S)-1-(3,5-dimethylphenyl)sulfonylpyrrolidine-2-carbonyl]amino]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[[4-(diaminomethylideneamino)cyclohexanecarbonyl]amino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[4-[(6-methyl-2-pyridinyl)amino]butanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]-3-[4-[4-(4,5-dihydro-1H-imidazol-2-ylamino)butanoylamino]phenyl]propanoic acid	IC50	505 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
3-[3-[4-(1,4-dihydroisoquinolin-3-ylamino)butyl]-2-oxoimidazolidin-1-yl]-3-[3-(trifluoromethyl)phenyl]propanoic acid	IC50	622 nM	US-10118929: Nonanoic and decanoic acid derivatives and uses thereof
(2S)-3-[4-[(2-aminoacetyl)amino]phenyl]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	IC50	5500 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods
(2S)-3-[4-(5-aminopentanoylamino)phenyl]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	IC50	5500 nM	US-10131658: Anti-alphavbeta1 integrin compounds and methods

ChEMBL bioactivities

749 potent at pChembl≥5 of 770 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.00	IC50	0.1	nM	CHEMBL565693
9.89	IC50	0.13	nM	CILENGITIDE
9.89	IC50	0.13	nM	CHEMBL5790863
9.74	IC50	0.18	nM	CHEMBL338439
9.70	IC50	0.2	nM	CHEMBL5914164
9.70	Ki	0.2	nM	CHEMBL3676424
9.59	Kd	0.257	nM	GSK-3008348 FREE BASE
9.59	Kd	0.26	nM	GSK-3008348 FREE BASE
9.52	IC50	0.3	nM	CHEMBL5786200
9.52	IC50	0.3	nM	CHEMBL5766697
9.52	IC50	0.3	nM	CHEMBL5920684
9.52	IC50	0.3	nM	CHEMBL5748399
9.52	IC50	0.3	nM	CHEMBL1077192
9.41	IC50	0.39	nM	CHEMBL126071
9.41	IC50	0.39	nM	CHEMBL3319235
9.40	IC50	0.4	nM	CHEMBL5781301
9.40	IC50	0.4	nM	CHEMBL5964326
9.40	IC50	0.4	nM	CHEMBL5974146
9.40	IC50	0.4	nM	CHEMBL5802710
9.40	IC50	0.4	nM	CHEMBL5889173
9.40	IC50	0.4	nM	CHEMBL5790208
9.40	IC50	0.4	nM	CHEMBL5951981
9.40	IC50	0.4	nM	CHEMBL5914164
9.40	Ki	0.4	nM	CHEMBL5874702
9.30	IC50	0.5	nM	CHEMBL5964326
9.30	IC50	0.5	nM	CHEMBL5790208
9.30	IC50	0.5	nM	CHEMBL5975238
9.30	IC50	0.5	nM	CHEMBL5802710
9.30	IC50	0.5	nM	CHEMBL5786200
9.30	IC50	0.5	nM	CHEMBL5770209
9.27	IC50	0.54	nM	CHEMBL396014
9.26	IC50	0.55	nM	CHEMBL241835
9.26	IC50	0.55	nM	CHEMBL390398
9.22	IC50	0.6	nM	CHEMBL5802710
9.22	IC50	0.6	nM	CHEMBL5889173
9.22	IC50	0.6	nM	CHEMBL5951981
9.22	IC50	0.6	nM	CHEMBL5914164
9.22	IC50	0.6	nM	CHEMBL5974146
9.22	IC50	0.6	nM	CHEMBL5920684
9.22	IC50	0.6	nM	CHEMBL5819051
9.22	IC50	0.6	nM	CHEMBL5802648
9.17	IC50	0.67	nM	CHEMBL2418221
9.15	IC50	0.7	nM	CHEMBL4794201
9.15	IC50	0.7	nM	CHEMBL5974146
9.15	IC50	0.7	nM	CHEMBL5920684
9.15	IC50	0.7	nM	CHEMBL5790208
9.15	IC50	0.7	nM	CHEMBL5914164
9.15	IC50	0.7	nM	CHEMBL5980310
9.15	IC50	0.7	nM	CHEMBL1077191
9.10	IC50	0.8	nM	CHEMBL241834

PubChem BioAssay actives

539 with measured affinity, of 754 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[(2S,5R,8S,11S)-5-benzyl-11-[3-(diaminomethylideneamino)propyl]-7-methyl-3,6,9,12,15-pentaoxo-8-propan-2-yl-1,4,7,10,13-pentazacyclopentadec-2-yl]acetic acid	393160: Displacement of [125I]echistatin from integrin alphaVbeta5 receptor in human placenta by microplate scintillation counter	ic50	0.0001	uM
(2S)-3-[3-amino-4-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propoxy]phenyl]-2-[[3-(trifluoromethyl)phenyl]sulfonylamino]propanoic acid	464341: Inhibition of human Integrin alpha5beta3 receptors expressed in HOP cells assessed as cell attachment after 30 mins by colorimetric assay	ic50	0.0001	uM
(2S)-3-[[(5S,8S)-7-phenylmethoxycarbonyl-8-[(pyridin-2-ylamino)methyl]-1-oxa-2,7-diazaspiro[4.4]non-2-ene-3-carbonyl]amino]-2-[(2,4,6-trimethylphenyl)sulfonylamino]propanoic acid	242034: Inhibition of alpha5-beta1 integrin receptor in ELISA	ic50	0.0002	uM
(2S)-3-[3-[[2-[2-[2-(2-methoxyethoxy)ethoxy]ethoxy]acetyl]amino]-4-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propoxy]phenyl]-2-[[3-(trifluoromethyl)phenyl]sulfonylamino]propanoic acid	464341: Inhibition of human Integrin alpha5beta3 receptors expressed in HOP cells assessed as cell attachment after 30 mins by colorimetric assay	ic50	0.0003	uM
(3S)-3-[3-(3,5-dimethylpyrazol-1-yl)phenyl]-4-[(3R)-3-[2-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)ethyl]pyrrolidin-1-yl]butanoic acid	1400449: Binding affinity to human integrin alpha8beta1 by liquid scintillation counting	kd	0.0003	uM
(2S)-3-[[(5S,8S)-7-butoxycarbonyl-8-[[(5-ethenyl-1H-imidazol-2-yl)amino]methyl]-1-oxa-2,7-diazaspiro[4.4]non-2-ene-3-carbonyl]amino]-2-[(2,4,6-trimethylphenyl)sulfonylamino]propanoic acid	1177802: Antagonist activity at alpha5beta1 integrin receptor (unknown origin) by cell-free ELISA	ic50	0.0004	uM
(2S)-3-[[(5S,8S)-8-[(1H-benzimidazol-2-ylamino)methyl]-7-butoxycarbonyl-1-oxa-2,7-diazaspiro[4.4]non-2-ene-3-carbonyl]amino]-2-[(2,4,6-trimethylphenyl)sulfonylamino]propanoic acid	242034: Inhibition of alpha5-beta1 integrin receptor in ELISA	ic50	0.0004	uM
(2S)-3-[[2-[(3R,5S)-5-[[(4-methoxy-2-pyridinyl)amino]methyl]-1-phenylmethoxycarbonylpyrrolidin-3-yl]oxyacetyl]amino]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0005	uM
(2S)-3-[[2-[(3R,5S)-1-(3,3-dimethylbutanoyl)-5-[[(4-methoxy-2-pyridinyl)amino]methyl]pyrrolidin-3-yl]oxyacetyl]amino]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0006	uM
(2S)-3-[[2-[(3R,5S)-1-(3,3-dimethylbutanoyl)-5-[[(4-methoxy-2-pyridinyl)amino]methyl]pyrrolidin-3-yl]oxyacetyl]amino]-2-[(1-methylcyclohexanecarbonyl)amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0006	uM
(2S)-3-[[2-[[3-[5-(adamantane-1-carbonylamino)pentanoylamino]-5-(diaminomethylideneamino)benzoyl]amino]acetyl]amino]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	1698263: Inhibition of alpha5beta1 integrin (unknown origin) by solid phase binding assay	ic50	0.0007	uM
(2S)-3-[3-[[2-[2-[2-[2-[2-[2-(2-aminoethoxy)ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]acetyl]amino]-4-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propoxy]phenyl]-2-[[3-(trifluoromethyl)phenyl]sulfonylamino]propanoic acid	464341: Inhibition of human Integrin alpha5beta3 receptors expressed in HOP cells assessed as cell attachment after 30 mins by colorimetric assay	ic50	0.0007	uM
(2S)-1-[(2S,3R)-2-[[(2S)-2-[[2-[[(2S)-2-[(2-aminoacetyl)amino]-5-(diaminomethylideneamino)pentanoyl]amino]acetyl]amino]-3-carboxypropanoyl]amino]-3-hydroxybutanoyl]pyrrolidine-2-carboxylic acid	1686201: Antagonist activity at alpha5beta1 in human K562 cells assessed as reduction in cell adhesion to fibronectin pre-incubated for 30 mins before fibronectin and further incubated for 1 hr by nitrophenyl-N-acetyl-beta-D-glucosaminide substrate based chromogenic assay	ic50	0.0007	uM
(2S)-3-[[2-[[3-[4-(adamantane-1-carbonylamino)butanoylamino]-5-(diaminomethylideneamino)benzoyl]amino]acetyl]amino]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	1698263: Inhibition of alpha5beta1 integrin (unknown origin) by solid phase binding assay	ic50	0.0008	uM
(2S)-3-[[2-[(3R,5S)-5-[[(4-methoxy-2-pyridinyl)amino]methyl]-1-phenylmethoxycarbonylpyrrolidin-3-yl]oxyacetyl]amino]-2-[(1-methylcyclohexanecarbonyl)amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0008	uM
(2S)-3-[[2-[(3R,5S)-1-(3,3-dimethylbutanoyl)-5-[[(4-methoxy-2-pyridinyl)amino]methyl]pyrrolidin-3-yl]oxyacetyl]amino]-2-[(2,4,6-trimethylphenyl)sulfonylamino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0009	uM
3-[4-[4-[[(4-methoxy-2-pyridinyl)amino]methyl]piperidin-1-yl]phenyl]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	452727: Inhibition of integrin alpha5beta1 receptor by ELISA	ic50	0.0009	uM
(2S)-2-[(2-ethyl-4-fluoro-6-methylbenzoyl)amino]-3-[4-[4-[(pyridin-2-ylamino)methyl]piperidin-1-yl]phenyl]propanoic acid	452727: Inhibition of integrin alpha5beta1 receptor by ELISA	ic50	0.0009	uM
2-[(1R,3S,9S,11S,14R)-9-[3-(diaminomethylideneamino)propyl]-4,7,10,18-tetraoxo-2,5,8,19-tetrazatricyclo[9.6.2.014,19]nonadecan-3-yl]acetic acid	393160: Displacement of [125I]echistatin from integrin alphaVbeta5 receptor in human placenta by microplate scintillation counter	ic50	0.0009	uM
(2S)-3-[[2-[[3-[[5-(1-adamantylamino)-5-oxopentanoyl]amino]-5-(diaminomethylideneamino)benzoyl]amino]acetyl]amino]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	1698263: Inhibition of alpha5beta1 integrin (unknown origin) by solid phase binding assay	ic50	0.0010	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[4-[2-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)ethoxy]phenyl]propanoic acid	662389: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2-chloro-6-fluorobenzoyl)amino]-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2,6-dimethylbenzoyl)amino]-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(3,5-dimethyl-1,2-oxazole-4-carbonyl)amino]-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(3,5-dichloropyridine-4-carbonyl)amino]-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[4-[2-(1-methyl-3,4-dihydro-2H-pyrido[2,3-b]pyrazin-6-yl)ethoxy]phenyl]propanoic acid	662389: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-3-[4-[2-(6-amino-2-pyridinyl)ethoxy]phenyl]-2-[(2,6-dichlorobenzoyl)amino]propanoic acid	662389: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[5-[2-[6-(methylamino)-2-pyridinyl]ethoxy]-2-pyridinyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[4-[2-(3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazin-6-yl)ethoxy]phenyl]propanoic acid	662389: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[4-[3-(5,6,7,8-tetrahydro-1,8-naphthyridin-2-yl)propyl]phenyl]propanoic acid	662389: Binding affinity to integrin alpha5beta1	ic50	0.0010	uM
(2S)-3-[[2-[(3R,5S)-5-[[(4-methoxy-2-pyridinyl)amino]methyl]-1-phenylmethoxycarbonylpyrrolidin-3-yl]oxyacetyl]amino]-2-[(2,4,6-trimethylphenyl)sulfonylamino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0011	uM
(2S)-3-[[2-[[3-[3-(adamantane-1-carbonylamino)propanoylamino]-5-(diaminomethylideneamino)benzoyl]amino]acetyl]amino]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	1698263: Inhibition of alpha5beta1 integrin (unknown origin) by solid phase binding assay	ic50	0.0014	uM
(2S)-3-[[2-[(3R,5S)-1-(3,3-dimethylbutanoyl)-5-[(pyridin-2-ylamino)methyl]pyrrolidin-3-yl]oxyacetyl]amino]-2-[(1-methylcyclohexanecarbonyl)amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0014	uM
(2S)-3-[[(5S,8S)-8-[(1H-benzimidazol-2-ylamino)methyl]-7-methoxycarbonyl-1-oxa-2,7-diazaspiro[4.4]non-2-ene-3-carbonyl]amino]-2-[(2,4,6-trimethylphenyl)sulfonylamino]propanoic acid	242034: Inhibition of alpha5-beta1 integrin receptor in ELISA	ic50	0.0014	uM
(2S)-3-[4-[4-[[(4-methyl-2-pyridinyl)amino]methyl]triazol-1-yl]phenyl]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	454891: Binding affinity to integrin alpha5beta1 receptor by ELISA	ic50	0.0015	uM
(3S)-3-(3-bromo-5-chloro-2-hydroxyphenyl)-3-[[2-[[5-[(5-hydroxy-1,4,5,6-tetrahydropyrimidin-2-yl)amino]pyridine-3-carbonyl]amino]acetyl]amino]propanoic acid	1177806: Antagonist activity at alphavbeta5 integrin receptor in HEK293 cells after 4 hrs using p-nitrophenyl phosphate by colorimetry	ic50	0.0015	uM
(2S)-3-[[2-[(3R,5S)-1-(3,3-dimethylbutanoyl)-5-[(pyridin-2-ylamino)methyl]pyrrolidin-3-yl]oxyacetyl]amino]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0016	uM
(2S)-3-[[2-[[3-[[2-(adamantane-1-carbonylamino)acetyl]amino]-5-(diaminomethylideneamino)benzoyl]amino]acetyl]amino]-2-[[(2S)-1-(benzenesulfonyl)pyrrolidine-2-carbonyl]amino]propanoic acid	1698263: Inhibition of alpha5beta1 integrin (unknown origin) by solid phase binding assay	ic50	0.0016	uM
2-[(2,6-dimethylbenzoyl)amino]-3-[4-[4-[(pyridin-2-ylamino)methyl]piperidin-1-yl]phenyl]propanoic acid	452727: Inhibition of integrin alpha5beta1 receptor by ELISA	ic50	0.0016	uM
(2S)-3-[[2-[(3S,5R)-1-(3,3-dimethylbutanoyl)-5-[(pyridin-2-ylamino)methyl]pyrrolidin-3-yl]oxyacetyl]amino]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	454891: Binding affinity to integrin alpha5beta1 receptor by ELISA	ic50	0.0016	uM
(2S)-3-[4-[4-[[(4-methyl-2-pyridinyl)amino]methyl]-2-oxopyrrolidin-1-yl]phenyl]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	454891: Binding affinity to integrin alpha5beta1 receptor by ELISA	ic50	0.0016	uM
(2S)-2-[(1-methylcyclohexanecarbonyl)amino]-3-[[2-[(3R,5S)-1-phenylmethoxycarbonyl-5-[(pyridin-2-ylamino)methyl]pyrrolidin-3-yl]oxyacetyl]amino]propanoic acid	296644: Inhibition of integrin alpha-5-beta-1 receptor by ELISA	ic50	0.0017	uM
2-[(12R,15S,18S,24S)-15-benzyl-12-carbamoyl-24-[3-(diaminomethylideneamino)propyl]-13-methyl-14,17,20,23,26-pentaoxo-8,13,16,19,22,25-hexazatetracyclo[25.4.0.02,7.06,10]hentriaconta-1(31),2,4,6,9,27,29-heptaen-18-yl]acetic acid	1576815: Inhibition of human fibronectin binding to human integrin alpha5beta1 incubated for 1 hr by ELISA	ic50	0.0019	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[5-[3-[6-(methylamino)-2-pyridinyl]propyl]thiophen-2-yl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0020	uM
(2S)-2-[(2,6-dichlorobenzoyl)amino]-3-[3-fluoro-4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0020	uM
(2S)-2-[(2-chloro-4-fluorobenzoyl)amino]-3-[4-[2-[6-(methylamino)-2-pyridinyl]ethoxy]phenyl]propanoic acid	662307: Binding affinity to integrin alpha5beta1	ic50	0.0020	uM
2-[(2-ethyl-4-fluoro-6-methylbenzoyl)amino]-3-[4-[4-[(pyridin-2-ylamino)methyl]piperidin-1-yl]phenyl]propanoic acid	452727: Inhibition of integrin alpha5beta1 receptor by ELISA	ic50	0.0020	uM
3-[4-[4-[(pyridin-2-ylamino)methyl]piperidin-1-yl]phenyl]-2-[(2,4,6-trimethylbenzoyl)amino]propanoic acid	452727: Inhibition of integrin alpha5beta1 receptor by ELISA	ic50	0.0021	uM

CTD chemical–gene interactions

120 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects cotreatment, increases methylation, decreases expression	5
sodium arsenite	affects methylation, affects cotreatment, decreases expression, increases abundance, increases expression	4
Cadmium Chloride	increases expression, decreases reaction, increases abundance, increases palmitoylation, decreases expression	4
Arsenic	affects cotreatment, decreases expression, decreases ubiquitination, increases abundance, increases expression	3
Cadmium	increases expression, decreases reaction, increases abundance, increases palmitoylation, decreases expression	3
Tetrachlorodibenzodioxin	affects cotreatment, decreases expression, increases expression	3
Tobacco Smoke Pollution	affects expression, increases expression	3
bisphenol S	increases expression, affects cotreatment, decreases expression	2
Resveratrol	decreases reaction, increases phosphorylation, increases reaction, decreases expression, affects binding	2
Copper	affects binding, increases expression, increases phosphorylation, increases reaction	2
Estradiol	increases expression, affects cotreatment	2
Progesterone	affects cotreatment, increases expression	2
Valproic Acid	affects reaction, decreases expression	2
aristolochic acid I	increases expression	1
FR900359	increases phosphorylation	1
bisphenol F	increases expression	1
peracetylated N-azidoacetylmannosamine	decreases expression	1
triphenyl phosphate	affects expression	1
carbendazim	decreases expression	1
glycidyl methacrylate	increases expression	1
lead acetate	increases expression	1
sodium arsenate	increases expression, increases abundance	1
titanium dioxide	affects binding, increases expression	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, increases expression, affects localization	1
decabromobiphenyl ether	decreases expression	1
tris(2-butoxyethyl) phosphate	affects expression	1
cobaltous chloride	increases expression	1
2-bromopalmitate	decreases reaction, increases abundance, increases palmitoylation	1
perfluorooctanoic acid	affects cotreatment, decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1

ChEMBL screening assays

153 unique, capped per target: 129 binding, 24 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1039861	Binding	Inhibition of alpha5beta1 integrin-mediated cell adhesion in human K562 cells on fibronectin coated plate after 30 mins	Antiangiogenic effect of dual/selective alpha(5)beta(1)/alpha(v)beta(3) integrin antagonists designed on partially modified retro-inverso cyclotetrapeptide mimetics. — J Med Chem
CHEMBL2033064	Functional	Antagonist activity at integrin alpha5beta1 in human K562 cells assessed as inhibition of cell adhesion	Structure-activity relationship of a series of non peptidic RGD integrin antagonists targeting α5β1: part 2. — Bioorg Med Chem Lett

Cellosaurus cell lines

10 cell lines: 10 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1X1	Abcam A-549 ITGA5 KO	Cancer cell line	Male
CVCL_D2BC	Abcam HCT 116 ITGA5 KO	Cancer cell line	Male
CVCL_D2NJ	Abcam THP-1 ITGA5 KO	Cancer cell line	Male
CVCL_D7SM	Ubigene A-549 ITGA5 KO	Cancer cell line	Male
CVCL_E0FH	Ubigene HeLa ITGA5 KO	Cancer cell line	Female
CVCL_E5E0	LIU-LSC-1 ITGA5 KO1	Cancer cell line	Male
CVCL_E5E1	LIU-LSC-1 ITGA5 KO2	Cancer cell line	Male
CVCL_ST29	HAP1 ITGA5 (-) 1	Cancer cell line	Male
CVCL_ST30	HAP1 ITGA5 (-) 2	Cancer cell line	Male
CVCL_WY38	SNU-16alpha5	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.