KATNAL1

Summary

KATNAL1 (katanin catalytic subunit A1 like 1, HGNC:28361) is a protein-coding gene on chromosome 13q12.3, encoding Katanin p60 ATPase-containing subunit A-like 1 (Q9BW62). Regulates microtubule dynamics in Sertoli cells, a process that is essential for spermiogenesis and male fertility.

Enables identical protein binding activity and microtubule severing ATPase activity. Involved in microtubule severing. Located in cytosol; microtubule cytoskeleton; and mitochondrion. Part of katanin complex.

Source: NCBI Gene 84056 — RefSeq curated summary.

At a glance

• GWAS associations: 8
• Clinical variants (ClinVar): 77 total
• MANE Select transcript: NM_032116

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28361
Approved symbol	KATNAL1
Name	katanin catalytic subunit A1 like 1
Location	13q12.3
Locus type	gene with protein product
Status	Approved
Aliases	MGC2599
Ensembl gene	ENSG00000102781
Ensembl biotype	protein_coding
OMIM	614764
Entrez	84056

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 13 protein_coding, 1 retained_intron

ENST00000380615, ENST00000380617, ENST00000414289, ENST00000441394, ENST00000480854, ENST00000908521, ENST00000908522, ENST00000908523, ENST00000908524, ENST00000908525, ENST00000931886, ENST00000931887, ENST00000961620, ENST00000961621

RefSeq mRNA: 2 — MANE Select: NM_032116 NM_001014380, NM_032116

CCDS: CCDS31956

Canonical transcript exons

ENST00000380615 — 11 exons

Exon	Start	End
ENSE00000679854	30280063	30280223
ENSE00000679860	30283616	30283791
ENSE00001360482	30307331	30307551
ENSE00001485635	30202630	30208738
ENSE00001591927	30240959	30241086
ENSE00001631493	30230468	30230594
ENSE00001691297	30210316	30210442
ENSE00001719116	30227412	30227546
ENSE00001799781	30231314	30231472
ENSE00001802288	30240460	30240565
ENSE00002189316	30255447	30255615

Expression profiles

Bgee: expression breadth ubiquitous, 249 present calls, max score 96.49.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 8.3032 / max 215.3042, expressed in 1696 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
136624	3.3984	1207
136625	1.8136	1125
136622	1.7048	852
136623	0.8065	490
136626	0.5799	341

Top tissues by expression

253 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	96.49	gold quality
oocyte	CL:0000023	95.46	gold quality
cardiac muscle of right atrium	UBERON:0003379	95.16	gold quality
left ventricle myocardium	UBERON:0006566	94.79	gold quality
sperm	CL:0000019	92.98	gold quality
Brodmann (1909) area 23	UBERON:0013554	92.92	gold quality
endothelial cell	CL:0000115	92.81	gold quality
calcaneal tendon	UBERON:0003701	91.90	gold quality
middle temporal gyrus	UBERON:0002771	91.51	gold quality
myocardium	UBERON:0002349	90.99	gold quality
heart right ventricle	UBERON:0002080	90.72	gold quality
corpus callosum	UBERON:0002336	89.36	gold quality
tendon	UBERON:0000043	89.33	gold quality
postcentral gyrus	UBERON:0002581	88.92	gold quality
superior frontal gyrus	UBERON:0002661	88.02	gold quality
parietal lobe	UBERON:0001872	87.89	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.45	gold quality
entorhinal cortex	UBERON:0002728	87.21	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.94	gold quality
Brodmann (1909) area 46	UBERON:0006483	86.78	gold quality
pons	UBERON:0000988	86.77	gold quality
saphenous vein	UBERON:0007318	86.73	gold quality
lateral nuclear group of thalamus	UBERON:0002736	86.36	gold quality
sural nerve	UBERON:0015488	85.96	gold quality
smooth muscle tissue	UBERON:0001135	85.83	gold quality
substantia nigra pars compacta	UBERON:0001965	85.44	gold quality
cortical plate	UBERON:0005343	85.26	gold quality
decidua	UBERON:0002450	85.13	gold quality
ventricular zone	UBERON:0003053	84.71	gold quality
parietal pleura	UBERON:0002400	84.68	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.46
E-CURD-10	no	239.46

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F4

miRNA regulators (miRDB)

250 targeting KATNAL1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-4455	100.00	65.48	1587
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-559	99.95	72.28	3609

Literature-anchored findings (GeneRIF, showing 4)

• KL1-mediated microtubule severing is utilized to generate microtubule seeds within the poles and loss of this activity alters the normal balance of motor-generated forces that determine spindle length. (PMID:20519956)
• microdeletion 13q12.3 represents a novel clinically recognizable condition and that the microtubule severing gene KATNAL1 and the chromatin-associated gene HMGB1 are candidate genes for intellectual disability inherited in an autosomal dominant pattern. (PMID:24664804)
• KATNAL1 gene sequence variants are not associated with azoospermia. (PMID:24913027)
• Common genetic variation in KATNAL1 non-coding regions is involved in the susceptibility to severe phenotypes of male infertility. (PMID:35752927)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	katnal1	ENSDARG00000099156
mus_musculus	Katnal1	ENSMUSG00000041298
rattus_norvegicus	Katnal1	ENSRNOG00000047618
drosophila_melanogaster	Fign	FBGN0031519
drosophila_melanogaster	kat-60L1	FBGN0037375
drosophila_melanogaster	Kat60	FBGN0040208
caenorhabditis_elegans	mei-1	WBGENE00003183
caenorhabditis_elegans		WBGENE00017981

Paralogs (9): SPAST (ENSG00000021574), VPS4B (ENSG00000119541), FIGNL1 (ENSG00000132436), VPS4A (ENSG00000132612), ATAD1 (ENSG00000138138), KATNAL2 (ENSG00000167216), FIGN (ENSG00000182263), KATNA1 (ENSG00000186625), FIGNL2 (ENSG00000261308)

Protein

Protein identifiers

Katanin p60 ATPase-containing subunit A-like 1 — Q9BW62 (reviewed: Q9BW62)

Alternative names: p60 katanin-like 1

All UniProt accessions (3): Q9BW62, A2A3H2, Q5T558

UniProt curated annotations — full annotation on UniProt →

Function. Regulates microtubule dynamics in Sertoli cells, a process that is essential for spermiogenesis and male fertility. Severs microtubules in an ATP-dependent manner, promoting rapid reorganization of cellular microtubule arrays. Has microtubule-severing activity in vitro.

Subunit / interactions. Interacts with KATNB1 and KATNBL1.

Subcellular location. Cytoplasm. Cytoskeleton. Spindle pole. Spindle.

Tissue specificity. Expressed in testis, restricted to Sertoli cells (at protein level).

Similarity. Belongs to the AAA ATPase family. Katanin p60 subunit A1 subfamily. A-like 1 sub-subfamily.

RefSeq proteins (2): NP_001014402, NP_115492* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003593	AAA+_ATPase	Domain
IPR003959	ATPase_AAA_core	Domain
IPR003960	ATPase_AAA_CS	Conserved_site
IPR015415	Spast_Vps4_C	Domain
IPR027417	P-loop_NTPase	Homologous_superfamily
IPR028594	Katnal1_chordates	Family
IPR028596	KATNA1	Family
IPR041569	AAA_lid_3	Domain
IPR048611	KATNA1_MIT	Domain
IPR048612	KTNA1_AAA_dom	Domain
IPR050304	MT-severing_AAA_ATPase	Family

Pfam: PF00004, PF09336, PF17862, PF21126

Enzyme classification (BRENDA):

• EC 5.6.1.1 — microtubule-severing ATPase (BRENDA: 21 organisms, 29 substrates, 57 inhibitors, 16 Km, 12 kcat entries)

Substrate kinetics (BRENDA)

1 substrates with measured Km, best-characterized 1. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ATP	0.0003–2.94	16

UniProt features (34 total): helix 19, strand 6, compositionally biased region 3, modified residue 2, chain 1, region of interest 1, turn 1, binding site 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
6B5C	X-RAY DIFFRACTION	2.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BW62-F1	76.81	0.34

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (1): 248–255

Post-translational modifications (2): 1, 174

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 144 (showing top): GOBP_CYTOPLASMIC_MICROTUBULE_ORGANIZATION, BERTUCCI_MEDULLARY_VS_DUCTAL_BREAST_CANCER_DN, MODULE_255, MODULE_317, GOBP_MALE_GAMETE_GENERATION, GOCC_MICROTUBULE_ORGANIZING_CENTER, AACWWCAANK_UNKNOWN, SENESE_HDAC1_AND_HDAC2_TARGETS_DN, GOCC_CENTROSOME, DOUGLAS_BMI1_TARGETS_DN, GOBP_DEVELOPMENTAL_PROCESS_INVOLVED_IN_REPRODUCTION, LEF1_Q6, RFX1_02, GOCC_SPINDLE, GOCC_MITOTIC_SPINDLE

GO Biological Process (4): spermatogenesis (GO:0007283), cytoplasmic microtubule organization (GO:0031122), microtubule severing (GO:0051013), microtubule cytoskeleton organization (GO:0000226)

GO Molecular Function (8): ATP binding (GO:0005524), microtubule binding (GO:0008017), microtubule severing ATPase activity (GO:0008568), ATP hydrolysis activity (GO:0016887), identical protein binding (GO:0042802), nucleotide binding (GO:0000166), protein binding (GO:0005515), isomerase activity (GO:0016853)

GO Cellular Component (11): spindle pole (GO:0000922), cytoplasm (GO:0005737), mitochondrion (GO:0005739), centrosome (GO:0005813), spindle (GO:0005819), cytosol (GO:0005829), microtubule (GO:0005874), katanin complex (GO:0008352), microtubule cytoskeleton (GO:0015630), mitotic spindle (GO:0072686), cytoskeleton (GO:0005856)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
microtubule cytoskeleton organization	3
cellular anatomical structure	3
ATP-dependent activity	2
spindle	2
cytoplasm	2
microtubule organizing center	2
microtubule cytoskeleton	2
intracellular membraneless organelle	2
developmental process involved in reproduction	1
male gamete generation	1
supramolecular fiber organization	1
cytoskeleton organization	1
microtubule-based process	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
tubulin binding	1
polypeptide conformation or assembly isomerase activity	1
catalytic activity, acting on a protein	1
microtubule destabilizing activity	1
ribonucleoside triphosphate phosphatase activity	1
protein binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
catalytic activity	1
intracellular anatomical structure	1
intracellular membrane-bounded organelle	1
centriole	1
polymeric cytoskeletal fiber	1
microtubule associated complex	1
cytoskeleton	1

Protein interactions and networks

STRING

1801 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KATNAL1	KATNB1	Q9BVA0	758
KATNAL1	KATNBL1	Q9H079	577
KATNAL1	NAA35	Q5VZE5	459
KATNAL1	RELA	Q04206	406
KATNAL1	KATNIP	O60303	399
KATNAL1	KIF18A	Q8NI77	389
KATNAL1	TEX26	Q8N6G2	381
KATNAL1	USPL1	Q5W0Q7	365
KATNAL1	SSH2	Q76I76	365
KATNAL1	TUBGCP3	Q96CW5	354
KATNAL1	TNS1	Q9HBL0	353
KATNAL1	HTR2B	P41595	353
KATNAL1	HERC5	Q9UII4	353
KATNAL1	LUZP1	Q86V48	353
KATNAL1	ZNHIT2	Q9UHR6	353
KATNAL1	ARHGAP32	A7KAX9	353
KATNAL1	ENTHD1	Q8IYW4	353
KATNAL1	KIF15	Q9NS87	353
KATNAL1	PRDM10	Q9NQV6	353
KATNAL1	CNTNAP2	Q9UHC6	353

IntAct

124 interactions, top by confidence:

A	B	Type	Score
KATNAL1	KATNBL1	psi-mi:“MI:0915”(physical association)	0.880
KATNBL1	KATNAL1	psi-mi:“MI:0915”(physical association)	0.880
KATNAL1	CEP57L1	psi-mi:“MI:0915”(physical association)	0.720
KLC4	KATNAL1	psi-mi:“MI:0915”(physical association)	0.720
KATNAL1	AIRIM	psi-mi:“MI:0915”(physical association)	0.720
CEP57L1	KATNAL1	psi-mi:“MI:0915”(physical association)	0.720
KATNAL1	KLC4	psi-mi:“MI:0915”(physical association)	0.720
AIRIM	KATNAL1	psi-mi:“MI:0915”(physical association)	0.720
KATNAL1	COX17	psi-mi:“MI:0915”(physical association)	0.670
KATNAL1	KATNAL1	psi-mi:“MI:0915”(physical association)	0.670
COX17	KATNAL1	psi-mi:“MI:0915”(physical association)	0.670
PFDN1	PFDN6	psi-mi:“MI:0914”(association)	0.640
KATNAL1	CEP57L1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (50): KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KLC4 (Two-hybrid), CEP57L1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Affinity Capture-MS), KATNAL1 (Synthetic Lethality), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid), KATNAL1 (Two-hybrid)

ESM2 similar proteins: A0JMA9, A2VDN5, A8QFF6, A8XV40, A9RA82, B2RYN7, B3EX35, B3M301, B4QSF0, B4USW8, B5X3X5, B7NZ88, B7PXE3, F4IAE9, O14114, O15381, O16299, O59824, O75449, P34808, P54816, Q05AS3, Q0IIR9, Q1HGK7, Q3B8D5, Q4R407, Q5RDX4, Q5RII9, Q5U3S1, Q5XIK7, Q5ZK92, Q60QD1, Q6AZT2, Q6E0V2, Q6NW58, Q6P158, Q6PL18, Q719N1, Q8CDM1, Q8IYT4

Diamond homologs: A0JMA9, A2VDN5, A4IHT0, A8QFF6, A8XV40, A9RA82, B2RYN7, B3EX35, B3M301, B3P8A3, B4G437, B4HGG6, B4JII0, B4K799, B4M0H8, B4NBP4, B4PL32, B4QSF0, B4USW8, B5X3X5, B7NZ88, B7PXE3, D0FH76, D2VS83, F2Z6D2, F4JEX5, F6QV99, O05209, O16299, O28972, O43078, O61577, O75351, O75449, P25694, P34808, P39955, P40328, P46467, P52917

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

77 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	53
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2592 predictions. Top by Δscore:

Variant	Effect	Δscore
13:30208563:T:TA	donor_gain	1.0000
13:30208575:A:AC	donor_gain	1.0000
13:30208576:C:CC	donor_gain	1.0000
13:30208576:CTT:C	donor_gain	1.0000
13:30208578:T:TA	donor_gain	1.0000
13:30208607:G:C	donor_gain	1.0000
13:30208734:CATCC:C	acceptor_gain	1.0000
13:30208736:TCC:T	acceptor_gain	1.0000
13:30208737:CC:C	acceptor_gain	1.0000
13:30208737:CCC:C	acceptor_gain	1.0000
13:30208738:CC:C	acceptor_gain	1.0000
13:30209162:C:CA	donor_gain	1.0000
13:30227409:TACC:T	donor_loss	1.0000
13:30227411:C:CT	donor_loss	1.0000
13:30227544:CTC:C	acceptor_gain	1.0000
13:30227547:C:CC	acceptor_gain	1.0000
13:30227555:A:T	acceptor_gain	1.0000
13:30231307:CACT:C	donor_loss	1.0000
13:30231308:ACTC:A	donor_loss	1.0000
13:30231310:TCAC:T	donor_loss	1.0000
13:30231311:C:CG	donor_loss	1.0000
13:30231312:A:AC	donor_gain	1.0000
13:30231313:C:CC	donor_gain	1.0000
13:30231313:CCAT:C	donor_gain	1.0000
13:30231468:ACACC:A	acceptor_gain	1.0000
13:30231469:CACC:C	acceptor_gain	1.0000
13:30231469:CACCC:C	acceptor_gain	1.0000
13:30231470:ACC:A	acceptor_gain	1.0000
13:30231471:CC:C	acceptor_gain	1.0000
13:30231471:CCC:C	acceptor_gain	1.0000

AlphaMissense

3230 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
13:30227447:C:A	R371M	1.000
13:30227447:C:G	R371T	1.000
13:30227482:A:C	N359K	1.000
13:30227482:A:T	N359K	1.000
13:30230482:A:G	L333P	1.000
13:30231414:G:T	A262D	1.000
13:30231420:G:T	A260D	1.000
13:30231421:C:G	A260P	1.000
13:30231426:G:T	A258D	1.000
13:30231441:C:T	G253D	1.000
13:30231447:C:T	G251D	1.000
13:30231448:C:G	G251R	1.000
13:30231456:C:T	G248E	1.000
13:30231457:C:G	G248R	1.000
13:30231457:C:T	G248R	1.000
13:30208714:T:A	R433S	0.999
13:30208714:T:G	R433S	0.999
13:30208715:C:A	R433I	0.999
13:30208715:C:G	R433T	0.999
13:30208733:G:T	A427D	0.999
13:30208734:C:G	A427P	0.999
13:30210318:G:C	C424W	0.999
13:30210319:C:T	C424Y	0.999
13:30210320:A:G	C424R	0.999
13:30210335:C:G	D419H	0.999
13:30210340:C:T	G417D	0.999
13:30210343:G:A	S416F	0.999
13:30210409:A:G	L394P	0.999
13:30210421:A:G	L390P	0.999
13:30210424:A:G	L389P	0.999

dbSNP variants (sampled 300 via entrez): RS1000004775 (13:30291555 T>A,C), RS1000048459 (13:30307105 C>G,T), RS1000068611 (13:30292060 C>T), RS1000101530 (13:30259123 A>G), RS1000123604 (13:30238841 A>C), RS1000144902 (13:30307252 G>A), RS1000148475 (13:30203698 T>C), RS1000176643 (13:30301490 A>G), RS1000226157 (13:30294495 T>C), RS1000289953 (13:30260080 CCTAACTGGGAGGTACCCCCCAGCAGG>C), RS1000307998 (13:30265911 C>CG), RS1000314931 (13:30260346 A>C,G), RS1000381371 (13:30266283 T>C,G), RS1000395723 (13:30285615 G>A,T), RS1000407452 (13:30241259 C>T)

Disease associations

OMIM: gene MIM:614764 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

8 associations (top):

Study	Trait	p-value
GCST001343_1	Fat distribution (HIV)	3.000000e-06
GCST001613_15	Antineutrophil cytoplasmic antibody-associated vasculitis	4.000000e-06
GCST003983_32	Male-pattern baldness	2.000000e-09
GCST004267_6	Blood osmolality (transformed sodium)	5.000000e-06
GCST008114_32	Type 2 diabetes	2.000000e-07
GCST010002_182	Refractive error	1.000000e-11
GCST011771_1	Rapid response to perioperative phenylephrine (change in mean arterial pressure)	2.000000e-08
GCST012490_501	Femur bone mineral density x serum urate levels interaction	3.000000e-08

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004341	body fat distribution
EFO:0006943	blood pressure change measurement
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

37 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, decreases expression, increases abundance, increases expression	2
potassium chromate(VI)	affects cotreatment, decreases expression	2
Tretinoin	decreases expression, increases expression	2
triphenyl phosphate	affects expression	1
lead acetate	increases expression	1
testosterone undecanoate	increases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
chromium hexavalent ion	decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	decreases expression	1
Bortezomib	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Fulvestrant	increases methylation	1
Acetaminophen	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Benzo(a)pyrene	increases methylation	1
Cisplatin	increases expression	1
Coumestrol	affects cotreatment, increases expression	1
Drugs, Chinese Herbal	increases expression	1
Estradiol	affects cotreatment, increases expression	1
Lipopolysaccharides	affects response to substance, increases expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Naphthoquinones	increases expression	1
Quercetin	increases expression	1
Rotenone	decreases expression	1
Valproic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.