KCNJ18

Summary

KCNJ18 (potassium inwardly rectifying channel subfamily J member 18, HGNC:39080) is a protein-coding gene on chromosome 17p11.2, encoding Inward rectifier potassium channel 18 (B7U540). Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it.

This gene encodes a member of the inwardly rectifying potassium channel family. Transcription of this locus is regulated by thyroid hormone, and the encoded protein plays a role in resting membrane potential maintenance. Mutations in this locus have been associated with thyrotoxic hypokalemic periodic paralysis.

Source: NCBI Gene 100134444 — RefSeq curated summary.

At a glance

• Gene–disease (curated): thyrotoxic periodic paralysis, susceptibility to, 2 (Strong, GenCC)
• GWAS associations: 1
• Clinical variants (ClinVar): 15 total
• Phenotypes (HPO): 54
• MANE Select transcript: NM_001194958

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:39080
Approved symbol	KCNJ18
Name	potassium inwardly rectifying channel subfamily J member 18
Location	17p11.2
Locus type	gene with protein product
Status	Approved
Aliases	KIR2.6, TTPP2
Ensembl gene	ENSG00000260458
Ensembl biotype	protein_coding
OMIM	613236
Entrez	100134444

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000567955

RefSeq mRNA: 1 — MANE Select: NM_001194958 NM_001194958

CCDS: CCDS74015

Canonical transcript exons

ENST00000567955 — 3 exons

Exon	Start	End
ENSE00002608500	21702731	21704612
ENSE00003723436	21692523	21692714
ENSE00003741406	21695983	21696104

Expression profiles

Bgee: expression breadth broad, 18 present calls, max score 71.99.

Top tissues by expression

129 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skin of abdomen	UBERON:0001416	71.99	gold quality
zone of skin	UBERON:0000014	71.21	gold quality
skin of leg	UBERON:0001511	70.90	gold quality
tonsil	UBERON:0002372	46.01	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	44.63	gold quality
skeletal muscle tissue	UBERON:0001134	42.11	gold quality
lower esophagus mucosa	UBERON:0035834	41.45	silver quality
colonic epithelium	UBERON:0000397	41.30	gold quality
sural nerve	UBERON:0015488	38.29	gold quality
muscle tissue	UBERON:0002385	37.48	gold quality
apex of heart	UBERON:0002098	36.97	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
bone marrow cell	CL:0002092	36.16	gold quality
ganglionic eminence	UBERON:0004023	35.49	gold quality
granulocyte	CL:0000094	35.21	gold quality
right testis	UBERON:0004534	33.69	silver quality
bone marrow	UBERON:0002371	32.98	gold quality
prefrontal cortex	UBERON:0000451	32.85	gold quality
left testis	UBERON:0004533	32.68	silver quality
testis	UBERON:0000473	32.51	silver quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
esophagus mucosa	UBERON:0002469	32.08	silver quality
muscle of leg	UBERON:0001383	31.92	gold quality
gastrocnemius	UBERON:0001388	31.45	gold quality
cerebellum	UBERON:0002037	31.09	gold quality
cerebellar cortex	UBERON:0002129	30.87	gold quality
cerebellar hemisphere	UBERON:0002245	30.86	gold quality
right hemisphere of cerebellum	UBERON:0014890	30.06	gold quality
leukocyte	CL:0000738	29.93	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.64

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

25 targeting KCNJ18, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-515-5P	99.92	69.82	2343
HSA-MIR-519E-5P	99.92	69.62	2358
HSA-MIR-12119	99.87	68.35	1653
HSA-MIR-629-3P	99.85	67.99	1875
HSA-MIR-576-5P	99.84	70.46	2582
HSA-MIR-4713-5P	99.78	67.80	1794
HSA-MIR-518A-5P	99.70	69.01	2209
HSA-MIR-527	99.70	69.01	2209
HSA-MIR-4677-5P	99.70	70.09	1940
HSA-MIR-10393-5P	99.65	68.01	1368
HSA-MIR-4649-3P	99.56	66.90	1783
HSA-MIR-183-3P	99.41	69.41	1598
HSA-MIR-5011-3P	98.63	64.81	638
HSA-MIR-6784-3P	98.39	64.88	662
HSA-MIR-6867-3P	98.12	66.07	1305
HSA-MIR-6862-3P	97.92	64.86	531
HSA-MIR-296-5P	97.61	64.02	851
HSA-MIR-3121-5P	97.30	66.62	1146
HSA-MIR-4313	97.18	63.15	420
HSA-MIR-3194-5P	96.80	64.90	1027
HSA-MIR-6858-3P	96.37	64.41	771
HSA-MIR-548AD-3P	94.39	66.04	350
HSA-MIR-4707-5P	90.95	65.69	110

Literature-anchored findings (GeneRIF, showing 9)

• While sequencing candidate genes, we identified a previously unreported gene (not present in human sequence databases) that encodes an inwardly rectifying potassium (Kir) channel, Kir2.6. (PMID:20074522)
• Kir2.6 regulates the surface expression of Kir2.x inward rectifier potassium channels. (PMID:21209095)
• suggest that decreased outward K(+) current from hypofunction of Kir2.6 predisposes the sarcolemma to hypokalemia-induced paradoxical depolarization during attacks, which in turn leads to Na(+) channel inactivation and inexcitability of muscles (PMID:21665951)
• TPP and SPP have the same susceptible gene variant rs623011 and may share the pathogenic mechanism of reduced Kir current in skeletal muscle independent of thyroid hormone. (PMID:22910584)
• KCNJ18 alterations are seldom pathogenic (PMID:25882930)
• 3.1% of thyrotoxic periodic paralysis cases had KCNJ18 gene mutations in mainland Chinese patients. Patients with KCNJ18 mutation had shorter attack duration, higher prevalence of muscle soreness and weakness recurrence than patients without the mutation. (PMID:25885757)
• A novel KCNJ18 mutation, G169R, identified in the hypokalemic periodic paralysis patient demonstrated a significant functional defect in vitro. (PMID:27178871)
• Study describes the functional consequences of a single amino acid change in Kir2.6 channel. The D252N mutation down-regulates the Kir2.6 activity, decreasing the K+ current density ( approximately 34%) when compared to the wildtype channel; whereas the mutation R386C shows no significant changes from wildtype. (PMID:28131627)
• Single-nucleotide variant in KCNJ18 gene is associated with Thyrotoxic Periodic Paralysis. (PMID:31361309)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	kcnj12b	ENSDARG00000062618
danio_rerio	kcnj12a	ENSDARG00000104965
mus_musculus	Kcnj12	ENSMUSG00000042529
rattus_norvegicus	Kcnj12	ENSRNOG00000002303

Paralogs (15): KCNJ13 (ENSG00000115474), KCNJ5 (ENSG00000120457), KCNJ8 (ENSG00000121361), KCNJ2 (ENSG00000123700), KCNJ1 (ENSG00000151704), KCNJ16 (ENSG00000153822), KCNJ6 (ENSG00000157542), KCNJ15 (ENSG00000157551), KCNJ9 (ENSG00000162728), KCNJ3 (ENSG00000162989), KCNJ4 (ENSG00000168135), KCNJ10 (ENSG00000177807), KCNJ14 (ENSG00000182324), KCNJ12 (ENSG00000184185), KCNJ11 (ENSG00000187486)

Protein

Protein identifiers

Inward rectifier potassium channel 18 — B7U540 (reviewed: B7U540)

Alternative names: Inward rectifier K(+) channel Kir2.6, Potassium channel, inwardly rectifying subfamily J member 18

All UniProt accessions (1): B7U540

UniProt curated annotations — full annotation on UniProt →

Function. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium.

Subunit / interactions. Can form heteromeric channels with Kir2.1/KCNJ2. Can form heteromeric channels with Kir2.2/KCNJ12.

Subcellular location. Cell membrane. Endoplasmic reticulum.

Tissue specificity. Specifically expressed in skeletal muscle.

Post-translational modifications. Probably phosphorylated by PKC; decreases single-channel open probability.

Disease relevance. Thyrotoxic periodic paralysis 2 (TTPP2) [MIM:613239] A sporadic muscular disorder characterized by episodic weakness and hypokalemia during a thyrotoxic state. It is clinically similar to hereditary hypokalemic periodic paralysis, except for the fact that hyperthyroidism is an absolute requirement for disease manifestation. The disease presents with recurrent episodes of acute muscular weakness of the four extremities that vary in severity from paresis to complete paralysis. Attacks are triggered by ingestion of a high carbohydrate load or strenuous physical activity followed by a period of rest. Thyrotoxic periodic paralysis can occur in association with any cause of hyperthyroidism, but is most commonly associated with Graves disease. Disease susceptibility is associated with variants affecting the gene represented in this entry.

Induction. Up-regulated by triiodothyronine.

Similarity. Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family. KCNJ12 subfamily.

RefSeq proteins (1): NP_001181887* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003272	K_chnl_inward-rec_Kir2.2	Family
IPR013518	K_chnl_inward-rec_Kir_cyto	Homologous_superfamily
IPR013673	K_chnl_inward-rec_Kir_N	Domain
IPR014756	Ig_E-set	Homologous_superfamily
IPR016449	K_chnl_inward-rec_Kir	Family
IPR040445	Kir_TM	Domain
IPR041647	IRK_C	Domain

Pfam: PF01007, PF08466, PF17655

Catalyzed reactions (Rhea), 1 shown:

• K(+)(in) = K(+)(out) (RHEA:29463)

UniProt features (32 total): sequence variant 14, sequence conflict 5, topological domain 4, transmembrane region 2, mutagenesis site 2, chain 1, compositionally biased region 1, intramembrane region 1, region of interest 1, short sequence motif 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-B7U540-F1	81.10	0.66

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Mutagenesis-validated functional residues (2):

Position	Phenotype
156	increased expression at the cell membrane.
354	decreases the single-channel open probability (po) without altering its conductance.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 137 (showing top): GOBP_POTASSIUM_ION_TRANSPORT, GOBP_MONOATOMIC_CATION_TRANSPORT, GOBP_IMPORT_INTO_CELL, GOBP_TRANSMEMBRANE_TRANSPORT, GOCC_TRANSPORTER_COMPLEX, GOCC_MEMBRANE_PROTEIN_COMPLEX, GOMF_VOLTAGE_GATED_MONOATOMIC_CATION_CHANNEL_ACTIVITY, GOMF_METAL_ION_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_GATED_CHANNEL_ACTIVITY, GOMF_PASSIVE_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_MONOATOMIC_CATION_TRANSMEMBRANE_TRANSPORTER_ACTIVITY, GOMF_VOLTAGE_GATED_POTASSIUM_CHANNEL_ACTIVITY, GOMF_POTASSIUM_CHANNEL_ACTIVITY, GOMF_INWARD_RECTIFIER_POTASSIUM_CHANNEL_ACTIVITY, GOMF_TRANSPORTER_ACTIVITY

GO Biological Process (5): regulation of monoatomic ion transmembrane transport (GO:0034765), potassium ion import across plasma membrane (GO:1990573), monoatomic ion transport (GO:0006811), potassium ion transport (GO:0006813), monoatomic ion transmembrane transport (GO:0034220)

GO Molecular Function (2): inward rectifier potassium channel activity (GO:0005242), protein binding (GO:0005515)

GO Cellular Component (4): endoplasmic reticulum (GO:0005783), plasma membrane (GO:0005886), monoatomic ion channel complex (GO:0034702), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
monoatomic ion transmembrane transport	1
regulation of transmembrane transport	1
regulation of monoatomic ion transport	1
potassium ion transmembrane transport	1
inorganic cation import across plasma membrane	1
transport	1
metal ion transport	1
monoatomic ion transport	1
transmembrane transport	1
voltage-gated potassium channel activity	1
ligand-gated monoatomic cation channel activity	1
binding	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1
membrane	1
cell periphery	1
transmembrane transporter complex	1
cellular anatomical structure	1

Protein interactions and networks

STRING

360 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KCNJ18	CACNA1S	Q13698	909
KCNJ18	KCNE3	Q9Y6H6	753
KCNJ18	SCN4A	P35499	723
KCNJ18	FOXL2NB	Q6ZUU3	571
KCNJ18	CLCN1	P35523	534
KCNJ18	NOTCH2NLR	A0A096LNW5	402
KCNJ18	RFPL1	O75677	397
KCNJ18	LYG2	Q86SG7	349
KCNJ18	CLEC2A	Q6UVW9	349
KCNJ18	TYW1B	Q6NUM6	349
KCNJ18	SPINK6	Q6UWN8	339
KCNJ18	DLG1	Q12959	330
KCNJ18	ZNF570	Q96NI8	325
KCNJ18	KCNH2	Q12809	305
KCNJ18	DEFB132	Q7Z7B7	305

IntAct

124 interactions, top by confidence:

A	B	Type	Score
KCNJ18	KCNJ2	psi-mi:“MI:0915”(physical association)	0.660
KCNJ2	KCNJ18	psi-mi:“MI:2364”(proximity)	0.660
DLG1	KCNJ18	psi-mi:“MI:0407”(direct interaction)	0.620
KCNJ18	DLG1	psi-mi:“MI:0407”(direct interaction)	0.620
KCNJ18	EMD	psi-mi:“MI:0915”(physical association)	0.560
KCNJ18	SYNJ2BP	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	PDZD2	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	DLG3	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	TIAM2	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	MAST2	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	ERBIN	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	SCRIB	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	PTPN3	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	MAGI3	psi-mi:“MI:0407”(direct interaction)	0.440
LIN7C	KCNJ18	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	DLG2	psi-mi:“MI:0407”(direct interaction)	0.440
APBA3	KCNJ18	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	MAST1	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	APBA2	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	MAGI2	psi-mi:“MI:0407”(direct interaction)	0.440
TJP1	KCNJ18	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	PICK1	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	SNX27	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	MPP2	psi-mi:“MI:0407”(direct interaction)	0.440
PDZRN4	KCNJ18	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	NHERF4	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	ARHGAP21	psi-mi:“MI:0407”(direct interaction)	0.440
KCNJ18	DLG4	psi-mi:“MI:0407”(direct interaction)	0.440
RAPGEF6	KCNJ18	psi-mi:“MI:0407”(direct interaction)	0.440

ESM2 similar proteins: B7U540, E1BNE9, F1MYR9, F1NHE9, O02670, O02822, O18839, O19182, O70617, P35561, P48050, P48051, P48542, P48543, P48544, P48545, P48548, P48549, P48550, P49656, P49658, P52185, P52186, P52187, P52188, P52189, P52190, P52191, P52192, P63250, P63251, P63252, P63253, P70673, P97794, Q14500, Q14654, Q15842, Q4TZY1, Q5NVJ6

Diamond homologs: B7U540, E1BN00, E1BNE9, F1MYR9, F1NHE9, O02670, O02822, O18839, O19182, O60928, O70339, O70596, O70617, O88335, O88932, P35560, P35561, P48048, P48050, P48051, P48542, P48543, P48544, P48545, P48548, P48549, P48550, P49655, P49656, P49658, P52185, P52186, P52187, P52188, P52189, P52190, P52191, P52192, P63250, P63251

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 81 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Ras activation upon Ca2+ influx through NMDA receptor	5	54.9×	1e-06
Unblocking of NMDA receptors, glutamate binding and activation	5	52.3×	1e-06
Negative regulation of NMDA receptor-mediated neuronal transmission	5	52.3×	1e-06
Long-term potentiation	5	45.8×	2e-06
Assembly and cell surface presentation of NMDA receptors	9	43.9×	4e-11
Neurexins and neuroligins	10	37.9×	2e-11
Protein-protein interactions at synapses	6	30.6×	1e-06
Neurotransmitter receptors and postsynaptic signal transmission	5	9.6×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
establishment or maintenance of epithelial cell apical/basal polarity	11	82.0×	2e-16
protein localization to synapse	6	58.9×	7e-08
receptor clustering	7	56.0×	7e-09
regulation of postsynaptic membrane neurotransmitter receptor levels	7	44.5×	3e-08
protein-containing complex assembly	9	13.1×	2e-06
cell-cell adhesion	10	13.0×	4e-07
chemical synaptic transmission	7	6.9×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

15 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	4
Likely benign	4
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

2871 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:21703375:A:C	S197R	1.000
17:21703377:C:A	S197R	1.000
17:21703377:C:G	S197R	1.000
17:21703730:C:T	S315F	1.000
17:21703753:T:A	W323R	1.000
17:21703753:T:C	W323R	1.000
17:21702926:T:A	V47D	0.999
17:21702938:G:T	G51V	0.999
17:21703024:T:A	W80R	0.999
17:21703024:T:C	W80R	0.999
17:21703026:G:C	W80C	0.999
17:21703026:G:T	W80C	0.999
17:21703333:A:G	K183E	0.999
17:21703335:G:C	K183N	0.999
17:21703335:G:T	K183N	0.999
17:21703372:T:C	F196L	0.999
17:21703373:T:C	F196S	0.999
17:21703374:C:A	F196L	0.999
17:21703374:C:G	F196L	0.999
17:21703376:G:T	S197I	0.999
17:21703385:C:A	A200D	0.999
17:21703423:T:A	W213R	0.999
17:21703423:T:C	W213R	0.999
17:21703437:C:A	N217K	0.999
17:21703437:C:G	N217K	0.999
17:21703474:G:C	A230P	0.999
17:21703481:T:C	L232P	0.999
17:21703586:C:A	P267H	0.999
17:21703618:A:C	S278R	0.999
17:21703620:C:A	S278R	0.999

dbSNP variants (sampled 300 via entrez): RS1156247125 (17:21698083 T>C), RS1156341541 (17:21697564 G>A), RS1156569781 (17:21698853 C>T), RS1156629119 (17:21699532 T>C), RS1156688536 (17:21690718 T>C), RS1156829900 (17:21700813 A>G,T), RS1156875046 (17:21700072 C>T), RS1156897738 (17:21691819 G>A), RS1157008943 (17:21703853 G>A,T), RS1157086747 (17:21694974 CCCATCCATCCATCCCATTCGTCTAT>C), RS1157092491 (17:21703318 G>A), RS1157108823 (17:21695509 CCAGCTATT>C), RS1157225332 (17:21697066 A>G), RS1157369803 (17:21704789 G>T), RS1157391673 (17:21696266 C>T)

Disease associations

OMIM: gene MIM:613236 | disease phenotypes: MIM:613239

GenCC curated gene-disease

Disease	Classification	Inheritance
thyrotoxic periodic paralysis, susceptibility to, 2	Strong	Autosomal dominant

Mondo (1): thyrotoxic periodic paralysis, susceptibility to, 2 (MONDO:0013193)

Orphanet (1): Thyrotoxic periodic paralysis (Orphanet:79102)

HPO phenotypes

54 total (30 of 54 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000016	Urinary retention
HP:0000597	Ophthalmoparesis
HP:0000836	Hyperthyroidism
HP:0000853	Goiter
HP:0000975	Hyperhidrosis
HP:0001265	Hyporeflexia
HP:0001284	Areflexia
HP:0001337	Tremor
HP:0001347	Hyperreflexia
HP:0001513	Obesity
HP:0001649	Tachycardia
HP:0001657	Prolonged QT interval
HP:0001663	Ventricular fibrillation
HP:0001824	Weight loss
HP:0001962	Palpitations
HP:0002019	Constipation
HP:0002153	Hyperkalemia
HP:0002203	Respiratory paralysis
HP:0002445	Tetraplegia
HP:0002486	Myotonia
HP:0002900	Hypokalemia
HP:0002917	Hypomagnesemia
HP:0003134	Abnormality of peripheral nerve conduction
HP:0003201	Rhabdomyolysis
HP:0003394	Muscle spasm
HP:0003457	EMG abnormality
HP:0003470	Paralysis
HP:0003552	Muscle stiffness
HP:0003596	Middle age onset

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005951_14	Body mass index	5.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

2 total (human), top 2 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
abrine	increases expression	1
Formaldehyde	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.