KCNN2

Summary

KCNN2 (potassium calcium-activated channel subfamily N member 2, HGNC:6291) is a protein-coding gene on chromosome 5q22.3, encoding Small conductance calcium-activated potassium channel protein 2 (Q9H2S1). Small conductance calcium-activated potassium channel that mediates the voltage-independent transmembrane transfer of potassium across the cell membrane through a constitutive interaction with calmodulin which binds the intracellular calcium allowing its opening.

Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants.

Source: NCBI Gene 3781 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neurodevelopmental disorder with or without variable movement or behavioral abnormalities (Strong, GenCC)
• GWAS associations: 19
• Clinical variants (ClinVar): 229 total — 9 pathogenic, 9 likely-pathogenic
• GTEx eGene: eQTL in 19 tissues, sQTL in 0 (q < 0.05)
• Phenotypes (HPO): 42
• ChEMBL bioactivity: 1 clinical-phase molecule tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.07 (LoF-tolerant), LOEUF 0.66 (unconstrained)
• MANE Select transcript: NM_021614

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:6291
Approved symbol	KCNN2
Name	potassium calcium-activated channel subfamily N member 2
Location	5q22.3
Locus type	gene with protein product
Status	Approved
Aliases	KCa2.2, hSK2
Ensembl gene	ENSG00000080709
Ensembl biotype	protein_coding
OMIM	605879
Entrez	3781

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 7 protein_coding, 2 nonsense_mediated_decay, 2 retained_intron, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000673685

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 3: 3, TSL 4: 1, TSL 5: 3

ENST00000673685, ENST00000503706, ENST00000505491, ENST00000506812, ENST00000507750, ENST00000512097, ENST00000512927, ENST00000631899, ENST00000632892, ENST00001009196, ENST00001119137, ENST00001132202

RefSeq mRNA: 3 — MANE Select: NM_021614 NM_001372233, NM_021614, NM_170775

CCDS: CCDS4114, CCDS43352, CCDS93760

Canonical transcript exons

ENST00000673685 — 8 exons

Exon	Start	End
ENSE00002081251	114495895	114496496
ENSE00002244471	114404438	114404856
ENSE00003583331	114487050	114487177
ENSE00003615502	114493403	114493472
ENSE00003682832	114463049	114463190
ENSE00003687001	114473054	114473164
ENSE00003691261	114363906	114364001
ENSE00003896520	114362070	114363261

Expression profiles

Bgee: expression breadth ubiquitous, 213 present calls, max score 94.98.

FANTOM5 (CAGE): breadth broad, TPM avg 3.7998 / max 99.6345, expressed in 524 samples.

Highest expression (Bgee): secondary oocyte, oocyte, adrenal gland, adrenal gland cortex, adrenal cortex.

Genetic regulation across tissues (GTEx eQTL / sQTL)

KCNN2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 19 tissues and its splicing (sQTL) in 0 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

19 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Esophagus Muscularis	eqtl	6.2e-13	-0.29	5:114146926:A:G
Muscle Skeletal	eqtl	9.8e-13	+0.23	5:114001957:A:G
Adipose Visceral Omentum	eqtl	3.4e-07	-0.30	5:114318900:C:A
Breast Mammary Tissue	eqtl	1.6e-04	-0.24	5:114318900:C:A
Lung	eqtl	1.7e-04	-0.20	5:114320064:A:G
Liver	eqtl	2.2e-03	+0.18	5:114387922:G:C
Spleen	eqtl	4.8e-03	-0.35	5:114461747:T:C
Cells EBV-transformed lymphocytes	eqtl	5.4e-03	-0.29	5:114421342:G:A
Minor Salivary Gland	eqtl	6.1e-03	-0.39	5:114352475:A:ATAAAGTAATATGTTACTTTTTTCT
Stomach	eqtl	6.6e-03	-0.34	5:114228308:T:C
Heart Atrial Appendage	eqtl	1.0e-02	+0.15	5:114357353:C:G
Skin Sun Exposed Lower leg	eqtl	1.3e-02	+0.26	5:113790450:G:T
Adipose Subcutaneous	eqtl	1.3e-02	-0.17	5:114255361:G:A
Pancreas	eqtl	1.7e-02	+1.00	5:114848317:C:T
Skin Not Sun Exposed Suprapubic	eqtl	1.8e-02	-0.32	5:114334457:A:G
Colon Sigmoid	eqtl	2.9e-02	-0.19	5:113409900:A:T
Brain Cortex	eqtl	3.3e-02	+0.31	5:113471467:C:T
Artery Coronary	eqtl	3.9e-02	-0.27	5:114319038:G:A
Esophagus Gastroesophageal Junction	eqtl	4.6e-02	-0.59	5:113806313:T:A

FANTOM5 promoters

9 alternative TSS:

Promoter ID	TPM avg	Samples expressed
58031	2.2162	439
58033	0.5464	251
58032	0.3580	190
58034	0.2851	163
58030	0.0915	47
58025	0.0790	40
58027	0.0770	47
58026	0.0751	38
58038	0.0716	26

Top tissues by expression

showing 100 of 285 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	94.98	gold quality
oocyte	CL:0000023	94.00	gold quality
right adrenal gland	UBERON:0001233	92.04	gold quality
right adrenal gland cortex	UBERON:0035827	90.81	gold quality
left adrenal gland	UBERON:0001234	90.74	gold quality
adrenal cortex	UBERON:0001235	90.08	gold quality
left adrenal gland cortex	UBERON:0035825	89.91	gold quality
CA1 field of hippocampus	UBERON:0003881	89.55	gold quality
adrenal gland	UBERON:0002369	88.84	gold quality
Brodmann (1909) area 23	UBERON:0013554	88.39	gold quality
middle temporal gyrus	UBERON:0002771	88.06	gold quality
cortical plate	UBERON:0005343	87.05	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.72	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	84.26	gold quality
right lobe of liver	UBERON:0001114	83.53	gold quality
Ammon’s horn	UBERON:0001954	83.28	gold quality
liver	UBERON:0002107	82.20	gold quality
cerebellar vermis	UBERON:0004720	81.89	silver quality
heart right ventricle	UBERON:0002080	81.39	gold quality
choroid plexus epithelium	UBERON:0003911	81.24	gold quality
right hemisphere of cerebellum	UBERON:0014890	81.13	gold quality
spinal cord	UBERON:0002240	80.65	gold quality
cerebral cortex	UBERON:0000956	80.35	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	80.35	gold quality
Brodmann (1909) area 9	UBERON:0013540	80.33	gold quality
prefrontal cortex	UBERON:0000451	80.09	gold quality
cerebellar cortex	UBERON:0002129	80.08	gold quality
cerebellar hemisphere	UBERON:0002245	80.01	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	80.01	gold quality
cerebellum	UBERON:0002037	79.98	gold quality
right frontal lobe	UBERON:0002810	79.89	gold quality
entorhinal cortex	UBERON:0002728	79.88	gold quality
anterior cingulate cortex	UBERON:0009835	79.83	gold quality
cingulate cortex	UBERON:0003027	79.71	gold quality
cranial nerve II	UBERON:0000941	79.66	gold quality
neocortex	UBERON:0001950	79.66	gold quality
frontal cortex	UBERON:0001870	79.65	gold quality
primary visual cortex	UBERON:0002436	79.36	gold quality
superior frontal gyrus	UBERON:0002661	79.14	gold quality
corpus callosum	UBERON:0002336	78.54	gold quality
Brodmann (1909) area 46	UBERON:0006483	78.13	gold quality
lateral globus pallidus	UBERON:0002476	78.01	gold quality
adrenal tissue	UBERON:0018303	77.63	gold quality
pituitary gland	UBERON:0000007	77.62	gold quality
medulla oblongata	UBERON:0001896	77.59	gold quality
inferior olivary complex	UBERON:0002127	77.30	gold quality
telencephalon	UBERON:0001893	76.79	gold quality
right atrium auricular region	UBERON:0006631	76.70	gold quality
temporal lobe	UBERON:0001871	76.62	gold quality
cardiac atrium	UBERON:0002081	76.58	gold quality
brain	UBERON:0000955	76.54	gold quality
forebrain	UBERON:0001890	76.39	gold quality
heart left ventricle	UBERON:0002084	76.39	gold quality
cardiac ventricle	UBERON:0002082	76.36	gold quality
occipital lobe	UBERON:0002021	76.28	gold quality
left ventricle myocardium	UBERON:0006566	75.96	silver quality
postcentral gyrus	UBERON:0002581	75.89	gold quality
parietal lobe	UBERON:0001872	75.79	gold quality
body of pancreas	UBERON:0001150	75.72	gold quality
myocardium	UBERON:0002349	75.60	gold quality
prostate gland	UBERON:0002367	74.93	gold quality
adenohypophysis	UBERON:0002196	74.76	gold quality
amygdala	UBERON:0001876	74.75	gold quality
superior vestibular nucleus	UBERON:0007227	74.66	gold quality
pons	UBERON:0000988	74.64	gold quality
apex of heart	UBERON:0002098	74.59	gold quality
cardiac muscle of right atrium	UBERON:0003379	74.55	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	74.47	silver quality
orbitofrontal cortex	UBERON:0004167	74.14	gold quality
vastus lateralis	UBERON:0001379	74.12	silver quality
heart	UBERON:0000948	73.56	gold quality
ventricular zone	UBERON:0003053	73.54	gold quality
substantia nigra	UBERON:0002038	72.87	gold quality
midbrain	UBERON:0001891	72.70	gold quality
endothelial cell	CL:0000115	72.49	silver quality
hindlimb stylopod muscle	UBERON:0004252	72.30	gold quality
quadriceps femoris	UBERON:0001377	72.06	silver quality
seminal vesicle	UBERON:0000998	71.35	gold quality
hypothalamus	UBERON:0001898	71.17	gold quality
caudate nucleus	UBERON:0001873	70.97	gold quality
dorsal root ganglion	UBERON:0000044	70.48	gold quality
pancreas	UBERON:0001264	70.12	gold quality
ganglionic eminence	UBERON:0004023	69.75	gold quality
cartilage tissue	UBERON:0002418	69.42	gold quality
lateral nuclear group of thalamus	UBERON:0002736	69.07	gold quality
nephron tubule	UBERON:0001231	69.04	gold quality
diaphragm	UBERON:0001103	68.72	gold quality
ventral tegmental area	UBERON:0002691	68.30	gold quality
nucleus accumbens	UBERON:0001882	68.29	gold quality
lower esophagus muscularis layer	UBERON:0035833	68.07	gold quality
trigeminal ganglion	UBERON:0001675	67.99	gold quality
lower esophagus	UBERON:0013473	67.94	gold quality
substantia nigra pars compacta	UBERON:0001965	67.91	gold quality
muscle organ	UBERON:0001630	67.79	gold quality
muscle of leg	UBERON:0001383	67.35	gold quality
subthalamic nucleus	UBERON:0001906	67.28	gold quality
muscle tissue	UBERON:0002385	67.18	gold quality
inferior vagus X ganglion	UBERON:0005363	67.07	gold quality
globus pallidus	UBERON:0001875	66.97	gold quality
putamen	UBERON:0001874	66.90	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.76

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 74 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Hippocampus	tissue	52.0
Hippocampal formation	tissue	33.1
Cerebellum	tissue	30.4
Frontal cortex	tissue	30.3
Liver	tissue	30.0
Postcentral gyrus	tissue	25.9
Cerebral cortex	tissue	20.9
Retrosplenial cortex	tissue	20.9
Motor cortex	tissue	20.7
Caudate putamen	tissue	20.2
Adrenal gland	tissue	19.6
Retrosplenial and cingulate cortex	tissue	19.1
Prefrontal cortex	tissue	18.2
Insular cortex	tissue	18.0
Locus coeruleus	tissue	17.5
Entorhinal cortex	tissue	16.7
Nucleus accumbens	tissue	16.3
Amygdala	tissue	16.0
Occipital cortex	tissue	15.3
Temporal cortex	tissue	14.4
Choroid plexus	tissue	14.3
Somatosensory cortex	tissue	14.1
Superior colliculi	tissue	13.9
Olfactory bulb	tissue	11.3
Thalamus	tissue	10.8
Pons	tissue	10.7
Basal ganglia	tissue	10.1
Prostate	tissue	9.6
Midbrain	tissue	9.4
Putamen	tissue	9.3
Skeletal muscle	tissue	9.0
Ventral forebrain	tissue	8.7
Spinal cord	tissue	8.5
Septum	tissue	8.1
Medulla oblongata	tissue	8.0
Substantia nigra	tissue	7.7
Hypothalamus	tissue	6.6
Heart muscle	tissue	6.3
Periaqueductal gray	tissue	6.3
Tongue	tissue	6.0
Corpus callosum	tissue	5.1
Pituitary gland	tissue	5.0
Seminal vesicle	tissue	4.1
Kidney	tissue	3.8
Testis	tissue	2.8
Endometrium 1	tissue	2.8
Pancreas	tissue	2.7
Retina	tissue	2.3
Smooth muscle	tissue	1.9
Lung	tissue	1.7
Skin 1	tissue	1.3
Urinary bladder	tissue	0.9
Cervix	tissue	0.8
Ovary	tissue	0.6
Vagina	tissue	0.6
Rectum	tissue	0.6
Breast	tissue	0.4
Stomach 1	tissue	0.4
Salivary gland	tissue	0.4
Parathyroid gland	tissue	0.4

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Hippocampus, CA1 (54.9), Hippocampus, CA3 (52.4), Hippocampus, CA2 (49.5), Dentate gyrus (41.0), Posterior cingulate cortex (39.3).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): ERG, NR3C1, NR3C2

miRNA regulators (miRDB)

Targeting KCNN2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

26 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-5582-3P	99.86	72.48	4221
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-4255	99.72	67.70	1541
HSA-MIR-519A-3P	99.67	71.67	1868
HSA-MIR-519B-3P	99.67	71.67	1868
HSA-MIR-519C-3P	99.67	71.67	1870
HSA-MIR-561-3P	99.64	70.90	3647
HSA-MIR-3616-5P	99.55	67.02	989
HSA-MIR-573	99.55	67.44	955
HSA-MIR-1244	99.33	68.38	832
HSA-MIR-3606-5P	99.31	69.67	1168
HSA-MIR-1264	99.25	66.81	1317
HSA-MIR-4795-5P	99.11	66.90	876
HSA-MIR-3908	98.75	67.31	1160
HSA-MIR-6840-3P	98.68	65.95	1923
HSA-MIR-4703-5P	98.53	70.13	1645
HSA-MIR-3942-5P	98.52	69.51	1517
HSA-MIR-4766-3P	98.48	67.94	1347
HSA-MIR-7852-3P	98.37	67.98	823
HSA-MIR-3074-3P	97.83	67.26	922
HSA-MIR-6085	96.57	64.11	621
HSA-MIR-6813-5P	94.68	64.20	588

Functional genomics

gnomAD constraint: pLI 0.0672, LOEUF 0.661, missense Z 1.57 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000673685 splits into 4 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
5:114,362,140–114,363,107	381 / 259.1	1.47	no
5:114,363,108–114,404,639	123 / 204.9	0.60	no
5:114,404,640–114,487,156	86 / 233.0	0.37	no
5:114,487,157–114,496,179	164 / 156.6	1.05	no

Literature-anchored findings (GeneRIF, showing 26)

• RT-PCR analysis showed strong expression of SK2 mRNA in the normal human colon. (PMID:12778407)
• Because of the marked differential expression of SK2 channels in the heart, specific ligands for Ca2+-activated K+ currents may offer a unique therapeutic opportunity to modify atrial cells without interfering with ventricular myocytes (PMID:13679367)
• SK2 plays an important role in mediating the increase in transepithelial secretion due to increases in intracellular Ca 2+. SK2 channels, therefore, may represent a target for pharmacologic modulation of bile flow. (PMID:15362045)
• The subtype SK2 channels were up-regulated under hypoxia, shown with pharmacological tools and with mRNA analysis. (PMID:16396931)
• Functions of SK2 channels in atrial myocytes are critically dependent on the normal expression of Ca(v)1.3 Ca(2+) channels. (PMID:17110593)
• Results suggest that SK2-channel activation may largely contribute to the sustained Ca2+ influx in the G0/G1 phase in comparison of that in the G2/M phase in Jurkat T-lymphocytes. (PMID:17452806)
• Present study directly defines the functional roles of SK2 channels in transgenic mice using a genetically engineered model, and provides a possible link between abnormalities in cardiac SK2 channels and cardiac arrhythmias. (PMID:19139040)
• demonstrate that proper membrane localization of a small-conductance Ca(2+)-activated K(+) channel (SK2 or K(Ca)2.2) is dependent on its interacting protein, alpha-actinin2, a major F-actin crosslinking protein. (PMID:19815520)
• Decreased expression of small-conductance Ca2+-activated K+ channels SK1 and SK2 in human chronic atrial fibrillation (PMID:22154908)
• Increase in both Ca(2+) sensitivity and SK2 protein expression contributes to the IKAS upregulation in failing human ventricles. (PMID:23525437)
• KCNN2 gene can have an important role in the development of coronary artery aneurysms in Kawasaki disease. (PMID:23677057)
• Differentiated dopaminergic neurons expressed low levels of SK2 channels and high levels of SK1 and SK3 channels. (PMID:24434522)
• The ER SK2 channel activation preserves ER Ca(2+) uptake and retention which determines cell survival in conditions where sustained ER stress contributes to progressive neuronal death. (PMID:26586570)
• Study establishes the distribution profile of SK2 channel protein in human brain.The expression of SK2 human isoform b in brain could explain the variability of electrophysiological findings observed with SK2 channels. (PMID:27357310)
• There was a significant association between the KCNN2 variants and clinically significant VTa. These findings suggest an association between KCNN2 and VTa; it also appears that KCNN2 variants may be adjunctive markers for risk stratification in patients susceptible to SCD. (PMID:27442679)
• These results provide new insights into the regulation of SK2 channel trafficking by the cytoskeletal proteins FLNA and alpha-actinin2, involving distinct recycling pathways (PMID:27779751)
• Junctophilin 2, as junctional membrane complex (JMC) protein, is an important regulator of the cardiac SK channels (PMID:29055091)
• SK current is increased via the enhanced activation of CaMKII in patients with atrial fibrillation. (PMID:29737974)
• Immuno-visualization of the subcellular localization of SK2 and SK3 subunits showed a high degree of colocalization, consistent with the formation of heteromeric SK2/SK3 channels. (PMID:30922569)
• KCNN2 mutation in autosomal-dominant tremulous myoclonus-dystonia. (PMID:32212350)
• SK2 channel regulation of neuronal excitability, synaptic transmission, and brain rhythmic activity in health and diseases. (PMID:32860835)
• Variants in the SK2 channel gene (KCNN2) lead to dominant neurodevelopmental movement disorders. (PMID:33242881)
• HDAC2-dependent remodeling of KCa2.2 (KCNN2) and KCa2.3 (KCNN3) K(+) channels in atrial fibrillation with concomitant heart failure. (PMID:33310041)
• Preferential formation of human heteromeric SK2:SK3 channels limits homomeric SK channel assembly and function. (PMID:36502918)
• Loss-of-function KCa2.2 mutations abolish channel activity. (PMID:36717104)
• A Novel KCNN2 Variant in a Family with Essential Tremor Plus: Clinical Characteristics and In Silico Analysis. (PMID:37510285)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	kcnn2	ENSDARG00000014939
mus_musculus	Kcnn2	ENSMUSG00000054477
rattus_norvegicus	Kcnn2	ENSRNOG00000016675
drosophila_melanogaster	SK	FBGN0029761
caenorhabditis_elegans		WBGENE00007176
caenorhabditis_elegans		WBGENE00008265
caenorhabditis_elegans	kcnl-2	WBGENE00008570
caenorhabditis_elegans		WBGENE00015387

Paralogs (3): KCNN4 (ENSG00000104783), KCNN1 (ENSG00000105642), KCNN3 (ENSG00000143603)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:2153182) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 26 distinct phenotype terms.

Mouse phenotype (MP)	Records
tremors	12
decreased body size	7
abnormal gait	7
impaired limb coordination	5
ataxia	3
male infertility	3
abnormal locomotor coordination	3
abnormal locomotor behavior	2
abnormal afterhyperpolarization	2
postnatal lethality, incomplete penetrance	2
short stride length	1
hunched posture	1
abnormal coat appearance	1
abnormal motor coordination/balance	1
reduced male fertility	1
abnormal sexual interaction	1
decreased vertical activity	1
abnormal short-term object recognition memory	1
abnormal single cell response	1
abnormal involuntary movement	1
abnormal action potential	1
abnormal brain white matter morphology	1
abnormal spinal cord white matter morphology	1
decreased physiological sensitivity to xenobiotic	1
prenatal lethality, incomplete penetrance	1

+1 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Sus scrofa	P58392	97.0%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
KCNN2-AS1	ncRNA	101927078
PGGT1B	protein-coding	5229
TRIM36	protein-coding	55521
LINC01957	ncRNA	101927059
YTHDC2	protein-coding	64848

Protein

Protein identifiers

Small conductance calcium-activated potassium channel protein 2 — Q9H2S1 (reviewed: Q9H2S1)

Alternative names: KCa2.2

All UniProt accessions (6): A0A0J9YW81, A0A3F2YNY5, A0A669KBH3, A0A9L9PY74, D6RGY7, Q9H2S1

UniProt curated annotations — full annotation on UniProt →

Function. Small conductance calcium-activated potassium channel that mediates the voltage-independent transmembrane transfer of potassium across the cell membrane through a constitutive interaction with calmodulin which binds the intracellular calcium allowing its opening. The current is characterized by a voltage-independent activation, an intracellular calcium concentration increase-dependent activation and a single-channel conductance of about 3 picosiemens. Also presents an inwardly rectifying current, thus reducing its already small outward conductance of potassium ions, which is particularly the case when the membrane potential displays positive values, above + 20 mV. The inward rectification could be due to a blockade of the outward current by intracellular divalent cations such as calcium and magnesium and could also be due to an intrinsic property of the channel pore, independent of intracellular divalent ions. There are three positively charged amino acids in the S6 transmembrane domain, close to the pore, that collectively control the conductance and rectification through an electrostatic mechanism. Additionally, electrostatic contributions from these residues also play an important role in determining the intrinsic open probability of the channel in the absence of calcium, affecting the apparent calcium affinity for activation. Forms an heteromeric complex with calmodulin, which is constitutively associated in a calcium-independent manner. Channel opening is triggered when calcium binds the calmodulin resulting in a rotary movement leading to the formation of the dimeric complex to open the gate. Plays a role in the repolarization phase of cardiac action potential.

Subunit / interactions. Homodimer. Heteromultimer with KCNN1 and KCNN3. The complex is composed of 4 channel subunits each of which binds to a calmodulin subunit which regulates the channel activity through calcium-binding. Interacts (via N-terminal domain) with MPP2.

Subcellular location. Membrane. Cytoplasm. Myofibril. Sarcomere. Z line.

Tissue specificity. Expressed in atrial myocytes (at protein level). Widely expressed.

Disease relevance. Dystonia 34, myoclonic (DYT34) [MIM:619724] A form of dystonia, a disorder defined by the presence of sustained involuntary muscle contraction, often leading to abnormal postures. DYT34 is an autosomal dominant form characterized by childhood-onset dystonia predominantly affecting hands and neck, with a fast tremor with superimposed myoclonus and, in some individuals, subtle cerebellar signs. The disease may be caused by variants affecting the gene represented in this entry. Neurodevelopmental disorder with or without variable movement or behavioral abnormalities (NEDMAB) [MIM:619725] An autosomal dominant disorder characterized by motor and language developmental delay, intellectual disability often associated with early-onset movement disorders comprising cerebellar ataxia and/or extrapyramidal symptoms. Other variable features include autism spectrum disorder or autistic features and epilepsy. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Inhibited by bee venom neurotoxin apamin. Inhibited by UCL 1684 and tetraethylammonium (TEA).

Domain organisation. The coiled-coil domaim mediates heteromeic assembly. The calmodulin-binding domain (CaMBD) forms an elongated dimer with a calmodulin molecule bound at each end; each calmodulin wraps around three alpha-helices, two from one CaMBD subunit and one from the other.

Similarity. Belongs to the potassium channel KCNN family. KCa2.2/KCNN2 subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9H2S1-1	1	yes
Q9H2S1-2	2

RefSeq proteins (3): NP_001359162, NP_067627, NP_740721 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004178	CaM-bd_dom	Domain
IPR013099	K_chnl_dom	Domain
IPR015449	K_chnl_Ca-activ_SK	Family
IPR036122	CaM-bd_dom_sf	Homologous_superfamily

Pfam: PF02888, PF03530, PF07885

Catalyzed reactions (Rhea)

• K(+)(in) = K(+)(out) (RHEA:29463)

UniProt features (37 total): sequence variant 10, transmembrane region 6, sequence conflict 5, region of interest 4, helix 4, compositionally biased region 2, strand 2, chain 1, modified residue 1, splice variant 1, intramembrane region 1

Structure

Experimental structures (PDB)

16 structures by resolution:

PDB	Title	Method	Resolution (Å)
5V03	A positive allosteric modulator binding pocket in SK2 ion channels is shared by Riluzole …	X-RAY DIFFRACTION	1.58
5V02	A positive allosteric modulator binding pocket in SK2 ion channels is shared by Riluzole …	X-RAY DIFFRACTION	1.78
5WBX	Structural insights into the potency of SK/IK channel positive modulators	X-RAY DIFFRACTION	1.9
5WC5	Structural insights into the potency of SK/IK channel positive modulators	X-RAY DIFFRACTION	2.3
6ALE	A V-to-F substitution in SK2 channels causes Ca2+ hypersensitivity and improves …	X-RAY DIFFRACTION	2.5
9ZRQ	Cryo-EM structure of KCa2.2/calmodulin channel in complex with SKA31.	ELECTRON MICROSCOPY	2.77
9VUC	channel B complex with 2	ELECTRON MICROSCOPY	2.96
9O48	Cryo-EM structure of the human SK2-4 chimera/calmodulin channel complex in the Ca2+ bound …	ELECTRON MICROSCOPY	3.1
9O5O	Cryo-EM structure of the human SK2-4 chimera/calmodulin channel complex bound to a small …	ELECTRON MICROSCOPY	3.1
9O52	Cryo-EM structure of the human SK2-4 chimera/calmodulin channel complex bound to the bee …	ELECTRON MICROSCOPY	3.18
9VUA	channel A complex with 1	ELECTRON MICROSCOPY	3.23
9O53	Cryo-EM structure of the human SK2-4 chimera/calmodulin channel complex bound to a small …	ELECTRON MICROSCOPY	3.3
9ZRR	Cryo-EM structure of KCa2.2/calmodulin channel in complex with SKA111.	ELECTRON MICROSCOPY	3.31
9VU9	channel D complex with 4	ELECTRON MICROSCOPY	3.34
9VUB	channel C complex with 3	ELECTRON MICROSCOPY	3.35
9O51	Cryo-EM structure of the human SK2-4 chimera/calmodulin channel complex in the Ca2+ free …	ELECTRON MICROSCOPY	3.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H2S1-F1	77.98	0.44

Human Protein Atlas

Protein class: Transporters, Transporter channels and pores, Voltage-gated ion channels, Calcium-Activated Potassium Channels, Predicted membrane proteins, Plasma proteins, Disease related genes, FDA approved drug targets, Small molecule drugs, Human disease related genes

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm; plasma membrane

Antibody reliability (HPA): IH uncertain · IF uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1)

Type	Positions
Phosphotyrosine	160

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 7; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

7 pathways:

ID	Pathway	Evidence
R-HSA-1296052	Ca2+ activated K+ channels	curated
R-HSA-9667769	Acetylcholine inhibits contraction of outer hair cells	electronic
R-HSA-112316	Neuronal System	—
R-HSA-1296071	Potassium Channels	—
R-HSA-9709957	Sensory Perception	—
R-HSA-9659379	Sensory processing of sound	—
R-HSA-9662361	Sensory processing of sound by outer hair cells of the cochlea	—

MSigDB gene sets: 261 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_TUMORAL_MACROPHAGE_UP, GSE45365_NK_CELL_VS_CD8A_DC_DN, GOBP_POTASSIUM_ION_TRANSPORT, CREL_01, TGCGCANK_UNKNOWN, GOBP_CIRCULATORY_SYSTEM_PROCESS, TGCACTT_MIR519C_MIR519B_MIR519A, REACTOME_POTASSIUM_CHANNELS, GCANCTGNY_MYOD_Q6, GOCC_CELL_SURFACE, AP4_Q6, AP2_Q3, CAGCTG_AP4_Q5, SP1_Q2_01, GOBP_MONOATOMIC_CATION_TRANSPORT

GO Biological Process (7): potassium ion transport (GO:0006813), potassium ion transmembrane transport (GO:0071805), membrane repolarization during atrial cardiac muscle cell action potential (GO:0098914), regulation of potassium ion transmembrane transport (GO:1901379), monoatomic ion transport (GO:0006811), monoatomic ion transmembrane transport (GO:0034220), monoatomic cation transmembrane transport (GO:0098655)

GO Molecular Function (9): inward rectifier potassium channel activity (GO:0005242), calmodulin binding (GO:0005516), calcium-activated potassium channel activity (GO:0015269), small conductance calcium-activated potassium channel activity (GO:0016286), protein domain specific binding (GO:0019904), protein homodimerization activity (GO:0042803), alpha-actinin binding (GO:0051393), potassium channel activity (GO:0005267), protein binding (GO:0005515)

GO Cellular Component (6): plasma membrane (GO:0005886), cell surface (GO:0009986), membrane (GO:0016020), Z disc (GO:0030018), neuronal cell body (GO:0043025), dendritic spine (GO:0043197)

Reactome top-level categories

5 top-level categories:

Category	Pathways
Potassium Channels	1
Sensory processing of sound by outer hair cells of the cochlea	1
Neuronal System	1
Sensory Perception	1
Sensory processing of sound	1

GO top-level categories

35 GO namespaces:

Category	Terms
cellular anatomical structure	3
protein binding	2
metal ion transport	1
potassium ion transport	1
monoatomic cation transmembrane transport	1
membrane repolarization during cardiac muscle cell action potential	1
atrial cardiac muscle cell action potential	1
atrial cardiac muscle cell membrane repolarization	1
regulation of potassium ion transport	1
potassium ion transmembrane transport	1
regulation of monoatomic cation transmembrane transport	1
transport	1
monoatomic ion transport	1
transmembrane transport	1
monoatomic cation transport	1
monoatomic ion transmembrane transport	1
voltage-gated potassium channel activity	1
ligand-gated monoatomic cation channel activity	1
calcium-activated cation channel activity	1
potassium channel activity	1
calcium-activated potassium channel activity	1
identical protein binding	1
protein dimerization activity	1
actinin binding	1
monoatomic cation channel activity	1
potassium ion transmembrane transporter activity	1
binding	1
membrane	1
cell periphery	1
I band	1
somatodendritic compartment	1
cell body	1
dendrite	1
neuron spine	1
postsynapse	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 10 of 22 annotations. The rest are phylogenetic / computational / electronic (IEA).

10 experimentally-supported GO terms:

GO term	NS	Evidence
potassium ion transmembrane transport	BP	direct assay
regulation of potassium ion transmembrane transport	BP	direct assay
cell surface	CC	direct assay
plasma membrane	CC	direct assay
alpha-actinin binding	MF	physical interaction
calcium-activated potassium channel activity	MF	direct assay
inward rectifier potassium channel activity	MF	direct assay
protein domain specific binding	MF	physical interaction
protein homodimerization activity	MF	physical interaction
small conductance calcium-activated potassium channel activity	MF	direct assay

Protein interactions and networks

STRING

showing 16 of 776 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
KCNN2	CAMK1G	Q96NX5	759
KCNN2	CALM1	P02593	728
KCNN2	KCNMA1	Q12791	724
KCNN2	CSN3	P07498	700
KCNN2	KCNMB4	Q86W47	697
KCNN2	CALML6	Q8TD86	628
KCNN2	CALML4	Q96GE6	628
KCNN2	CALML3	P27482	627
KCNN2	CALML5	Q9NZT1	627
KCNN2	CACNA1D	Q01668	561
KCNN2	CAMK1	Q14012	553
KCNN2	CAMK1D	Q8IU85	553
KCNN2	KCNJ5	P48544	547
KCNN2	KCNA3	P22001	539
KCNN2	KCNU1	A8MYU2	526
KCNN2	KCND3	Q9UK17	526

IntAct

Human interaction partners of KCNN2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

4 partners by confidence:

Partner	Interaction type	MIscore	Records
ACTN2	direct interaction	0.530	3
SRPK1	phosphorylation reaction	0.440	1
SRPK2	phosphorylation reaction	0.440	1
CALM1	direct interaction	0.410	1

BioGRID (8 interactions; top human partners by supporting records): ACTN2 (Reconstituted Complex), CALM1 (Co-crystal Structure), DCAF6 (Affinity Capture-MS), HNRNPL (Affinity Capture-RNA), PARP6 (Proximity Label-MS), SRPK1 (Biochemical Activity), SRPK2 (Biochemical Activity)

SIGNOR signaling

showing 4 of 7 signaling interactions:

A	Effect	B	Mechanism
PRKACA	down-regulates	KCNN2	phosphorylation
Riluzole	“up-regulates activity”	KCNN2	“chemical activation”
Naphtho[1,2-d]thiazol-2-amine	“up-regulates activity”	KCNN2	“chemical activation”
UBE3A	“up-regulates activity”	KCNN2	ubiquitination

Disease & clinical

Genetic variants

Variant evidence for KCNN2: 229 ClinVar records (18 pathogenic / likely pathogenic); 19 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

229 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	9
Likely pathogenic	9
Uncertain significance	164
Likely benign	32
Benign	3

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 18 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
933146	NM_021614.4(KCNN2):c.1720G>A (p.Gly574Ser)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
933142	NM_021614.4(KCNN2):c.1116C>A (p.Tyr372Ter)	Pathogenic	criteria provided, single submitter	3
933149	NM_021614.4(KCNN2):c.1931T>C (p.Leu644Pro)	Pathogenic	criteria provided, single submitter	2
933141	NM_021614.4(KCNN2):c.1436_1439del (p.Leu478_Tyr479insTer)	Pathogenic	criteria provided, single submitter	1
933147	NM_021614.4(KCNN2):c.1798C>G (p.Leu600Val)	Pathogenic	criteria provided, single submitter	1
3069186	NM_021614.4(KCNN2):c.1384dup (p.Thr462fs)	Pathogenic	criteria provided, single submitter	1
3363942	NM_021614.4(KCNN2):c.1721G>A (p.Gly574Asp)	Pathogenic	criteria provided, single submitter	1
3573579	NM_021614.4(KCNN2):c.1960_1961dup (p.Ile655fs)	Pathogenic	criteria provided, single submitter	1
933143	NM_021614.4(KCNN2):c.1498_1499delinsTC (p.Ile500Ser)	Likely pathogenic	criteria provided, single submitter	2
1699369	NM_021614.4(KCNN2):c.1771G>C (p.Gly591Arg)	Likely pathogenic	criteria provided, single submitter	1
2499578	NM_021614.4(KCNN2):c.1977dup (p.Val660fs)	Likely pathogenic	criteria provided, single submitter	1
3365762	NM_021614.4(KCNN2):c.1698_1700dup (p.Thr567_Phe568insThr)	Likely pathogenic	criteria provided, single submitter	1
3767210	NM_021614.4(KCNN2):c.1685G>T (p.Trp562Leu)	Likely pathogenic	criteria provided, single submitter	1
3775904	NM_021614.4(KCNN2):c.548C>A (p.Ser183Ter)	Likely pathogenic	criteria provided, single submitter	1
4534846	NM_021614.4(KCNN2):c.1267dup (p.Tyr423fs)	Likely pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore KCNN2’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 34 predictions of 876):

Position(s)	Effect	Δscore	Sites
5:114404437	acceptor_loss	1.0000
5:114463047–114463048	acceptor_loss	1.0000	5
5:114463191–114463192	donor_loss	1.0000	4
5:114473165–114473166	donor_loss	1.0000	4
5:114487178	donor_loss	1.0000	2
5:114495893–114495894	acceptor_loss	1.0000	6
5:114363262–114363263	donor_loss	0.9900	5
5:114367046–114367047	acceptor_gain	0.9900	2
5:114404436–114404437	acceptor_loss	0.9900	4
5:114463048	acceptor_loss	0.9900

AlphaMissense

2,306 missense substitutions predicted likely pathogenic (of 5,191 scored), across 451 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M410	9	0.989	1.000
M149	9	0.985	1.000
M306	9	0.979	1.000
M262	9	0.975	0.999
M273	9	0.948	0.999
M411	9	0.926	0.993
M381	9	0.924	0.998
M143	9	0.907	0.999
M349	9	0.902	0.998
M364	9	0.859	0.983
D136	8	0.999	1.000
H276	8	0.999	1.000
D282	8	0.999	1.000
F300	8	0.999	1.000
D363	8	0.999	1.000
F296	8	0.998	1.000
D199	8	0.997	1.000
F280	8	0.997	1.000
N292	8	0.997	1.000
F409	8	0.997	1.000

HPA cancer prognostics

RNA cancer specificity: Group enriched (Glioblastoma Multiforme, Prostate Adenocarcinoma, Skin Cutaneous Melanoma)

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	0.000111

Disease associations

OMIM: gene MIM:605879 | disease phenotypes: MIM:619725, MIM:619724

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
neurodevelopmental disorder with or without variable movement or behavioral abnormalities	Strong	Autosomal dominant	3

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (7 panels, 7 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

7 panels:

Panel	Rating
Ataxia and cerebellar anomalies - childhood onset	green
DDG2P	green
Hereditary ataxia and cerebellar anomalies, childhood onset	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Paediatric disorders	green

Mondo (5): neurodevelopmental disorder (MONDO:0700092), neurodevelopmental disorder with or without variable movement or behavioral abnormalities (MONDO:0859225), dystonia 34, myoclonic (MONDO:0030538), cerebellar ataxia (MONDO:0000437), intellectual disability (MONDO:0001071)

Orphanet (2): Rare ataxia (Orphanet:102002), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

42 phenotypes (HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000252	Microcephaly
HP:0000473	Torticollis
HP:0000508	Ptosis
HP:0000646	Amblyopia
HP:0000709	Psychosis
HP:0000729	Autistic behavior
HP:0000733	Motor stereotypy
HP:0000739	Anxiety
HP:0000750	Delayed speech and language development
HP:0001249	Intellectual disability
HP:0001251	Ataxia
HP:0001263	Global developmental delay
HP:0001270	Motor delay
HP:0001300	Parkinsonism
HP:0001332	Dystonia
HP:0001336	Myoclonus
HP:0001583	Rotary nystagmus
HP:0002067	Bradykinesia
HP:0002069	Bilateral tonic-clonic seizure
HP:0002072	Chorea
HP:0002080	Intention tremor
HP:0002188	Delayed CNS myelination
HP:0002322	Resting tremor
HP:0002346	Head tremor
HP:0002356	Writer’s cramp
HP:0002378	Hand tremor
HP:0002396	Cogwheel rigidity
HP:0002518	Abnormal periventricular white matter morphology
HP:0003593	Infantile onset
HP:0003621	Juvenile onset
HP:0007018	Attention deficit hyperactivity disorder
HP:0007082	Dilated third ventricle
HP:0007338	Hypermetric saccades
HP:0007772	Impaired smooth pursuit
HP:0009921	Duane anomaly
HP:0011463	Childhood onset
HP:0025269	Panic attack
HP:0031629	Impaired tandem gait
HP:0031951	Nocturnal seizures
HP:0100034	Motor tics
HP:0100660	Dyskinesia

GWAS associations

19 associations:

Study	Trait	p-value
GCST006414_122	Atrial fibrillation	2e-16
GCST006061_171	Atrial fibrillation	1e-13
GCST006061_172	Atrial fibrillation	1e-10
GCST012460_6	Atrial fibrillation	1e-10
GCST007099_167	Systolic blood pressure	2e-10
GCST007353_7	Generalized epilepsy	7e-10
GCST007094_125	Diastolic blood pressure	7e-9
GCST011517_1	joint destruction in rheumatoid arthritis (rapid vs slow)	9e-9
GCST002026_1	Coronary arterial lesions in patients with Kawasaki disease	2e-8
GCST007095_116	Systolic blood pressure	2e-8
GCST004295_2	Atrial fibrillation	3e-8
GCST007098_57	Diastolic blood pressure	4e-8
GCST011516_2	joint destruction in rheumatoid arthritis (rapid vs slow)	2e-7
GCST007095_117	Systolic blood pressure	3e-7
GCST003427_12	Alzheimer disease and age of onset	9e-7
GCST004032_4	JT interval (sulfonylurea treatment interaction)	9e-7
GCST007098_58	Diastolic blood pressure	2e-6
GCST001762_211	Obesity-related traits	5e-6
GCST003542_75	Night sleep phenotypes	7e-6

EFO canonical traits (from GWAS)

7 canonical traits:

EFO ID	Trait name
EFO:0004502	adiponectin measurement
EFO:0004847	age at onset
EFO:0007885	JT interval
EFO:0007922	response to sulfonylurea
EFO:0006336	diastolic blood pressure
EFO:0006335	systolic blood pressure
EFO:0005413	joint damage measurement

MeSH disease descriptors

3 disease descriptors:

Descriptor	Name	Tree numbers
D002524	Cerebellar Ataxia	C10.228.140.252.190; C10.597.350.090.500; C23.888.592.350.090.200
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL4469 (SINGLE PROTEIN), CHEMBL4524132 (PROTEIN FAMILY)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 3,103 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

1 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL449782	CEPHARANTHINE	2	3,103

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: vgic — Calcium- and sodium-activated potassium channels (K_Ca, K_Na)

Most potent curated ligand interactions (27 total), top 25:

Ligand	Action	Affinity	Parameter
tamapin	Antagonist	10.6	pIC50
UCL1684	Inhibitor	10.06	pIC50
leiurotoxin I	Antagonist	9.7	pIC50
UCL1848	Antagonist	9.6	pIC50
apamin	Inhibitor	9.4	pKd
Lei-Dab7	Inhibitor	8.42	pIC50
P05	Antagonist	7.7	pIC50
RA-2	Antagonist	7.7	pIC50
dequalinium	Antagonist	6.8	pIC50
tetrandrine	Inhibition	6.51	pKi
Ca2+	Agonist	6.5	pEC50
NS8593	Channel blocker	6.4	pIC50
NS309	Agonist	6.2	pEC50
AP14145	Inhibitor	5.96	pIC50
NS13001	Agonist	5.74	pEC50
tubocurarine	Antagonist	5.7	pIC50
SKA-31	Agonist	5.7	pEC50
AP30663	Channel blocker	5.64	pIC50
rimtuzalcap	Activator	5.29	pIC50
CyPPA	Agonist	4.9	pEC50
riluzole	Agonist	4.89	pEC50
bicuculline	Antagonist	4.6	pIC50
DC-EBIO	Agonist	4.6	pEC50
chlorzoxazone	Activator	4.1	pEC50
EBIO	Agonist	3.3	pEC50

Binding affinities (BindingDB)

16 measured of 20 human assays (21 total across all organisms); most potent 16 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
N-(4-methylpyridin-2-yl)-4-(pyridin-2-yl)thiazol-2-amine	IC50	4 nM
(1H-Benzoimidazol-2-yl)-(6,7-dichloro-1,2,3,4-tetrahydronaphthalen-1-yl)amine	KD	54 nM
CHEMBL1909931	KI	90 nM
CHEMBL1909929	KI	194 nM
5-chloro-N-(thiophen-2-ylmethyl)pyrazolo[1,5-a]pyrimidin-7-amine	IC50	300 nM
CEPHARANTHINE	EC50	350 nM
CHEMBL1909932	KI	397 nM
CHEMBL1909928	KI	593 nM
6,7-dichloro-3-(hydroxyimino)indolin-2-one	EC50	600 nM
CHEMBL1909930	KI	878 nM
N-benzyl-5-chloropyrazolo[1,5-a]pyrimidin-7-amine	IC50	1190 nM
CHEMBL1182643	KI	1260 nM
TCMDC-124275	IC50	1550 nM	US-9034574: Agents for reversing epigenetic silencing of genes
CHEMBL1185254	KI	1680 nM
AG-525	IC50	3800 nM
1-ethyl-1H-benzo[d]imidazol-2(3H)-one	EC50	650000 nM

ChEMBL bioactivities

22 potent at pChembl≥5 of 23 total, top 22 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.96	IC50	11	nM	CHEMBL476339
7.33	Kd	47	nM	CHEMBL511710
7.23	IC50	59	nM	CHEMBL476339
7.05	Ki	90	nM	CHEMBL1909931
6.91	IC50	123	nM	CHEMBL489770
6.71	Ki	194	nM	CHEMBL1909929
6.56	Ki	277	nM	CHEMBL1182632
6.55	Ki	284	nM	BERBAMINE
6.51	Ki	306	nM	FANCHININ
6.40	Ki	397	nM	CHEMBL1909932
6.28	IC50	530	nM	CHEMBL472452
6.26	IC50	543	nM	CHEMBL489770
6.23	Ki	593	nM	CHEMBL1909928
6.10	EC50	800	nM	CHEMBL499968
6.06	Ki	878	nM	CHEMBL1909930
5.96	IC50	1100	nM	CHEMBL452406
5.90	Ki	1256	nM	CHEMBL1182643
5.88	Ki	1318	nM	CEPHARANTHINE
5.77	Ki	1685	nM	CHEMBL1185254
5.75	EC50	1800	nM	CHEMBL5421015
5.58	IC50	2600	nM	CHEMBL257156
5.30	EC50	5000	nM	CHEMBL444449

PubChem BioAssay actives

21 with measured affinity, of 47 total; 19 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
N-(4-methyl-2-pyridinyl)-4-pyridin-2-yl-1,3-thiazol-2-amine	387520: Inhibition of Kca2.2 channel expressed in HEK293 cells by thallium flux assay	ic50	0.0110	uM
N-(6,7-dichloro-1,2,3,4-tetrahydronaphthalen-1-yl)-1H-benzimidazol-2-amine	347105: Inhibition of human SK2 channel by inside-out patch clamp technique	kd	0.0470	uM
2-methyl-1-[[3-[(2-methyl-8-propan-2-ylisoquinolin-2-ium-1-yl)methyl]phenyl]methyl]-8-propan-2-ylisoquinolin-2-ium diiodide	626505: Displacement of [125I]-apamin from cloned SK2 channel expressed in human HEK293 cells after 1 hr by liquid scintillation counting	ki	0.0900	uM
N,4-dipyridin-2-yl-1,3-thiazol-2-amine	387520: Inhibition of Kca2.2 channel expressed in HEK293 cells by thallium flux assay	ic50	0.1230	uM
2-methyl-1-[4-(2-methyl-8-propan-2-ylisoquinolin-2-ium-1-yl)butyl]-8-propan-2-ylisoquinolin-2-ium diiodide	626505: Displacement of [125I]-apamin from cloned SK2 channel expressed in human HEK293 cells after 1 hr by liquid scintillation counting	ki	0.1940	uM
(1S)-1-[3-[(1S)-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinolin-1-yl]propyl]-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinoline	2006726: Displacement of [125I]apamin from SK2 (unknown origin) expressed in HEK293 cells assessed as inhibition constant incubated for 1 hr by liquid scintillation counting analysis	ki	0.2770	uM
(1S,14R)-20,21,25-trimethoxy-15,30-dimethyl-7,23-dioxa-15,30-diazaheptacyclo[22.6.2.23,6.18,12.114,18.027,31.022,33]hexatriaconta-3(36),4,6(35),8,10,12(34),18,20,22(33),24,26,31-dodecaen-9-ol	2006723: Displacement of [125I]apamin from human SK2 expressed in HEK293 cells assessed as inhibition constant incubated for 1 hr by liquid scintillation counting analysis	ki	0.2840	uM
(1S,14S)-9,20,21,25-tetramethoxy-15,30-dimethyl-7,23-dioxa-15,30-diazaheptacyclo[22.6.2.23,6.18,12.114,18.027,31.022,33]hexatriaconta-3(36),4,6(35),8,10,12(34),18,20,22(33),24,26,31-dodecaene	2006726: Displacement of [125I]apamin from SK2 (unknown origin) expressed in HEK293 cells assessed as inhibition constant incubated for 1 hr by liquid scintillation counting analysis	ki	0.3060	uM
2-methyl-1-[[4-[(2-methyl-8-propan-2-ylisoquinolin-2-ium-1-yl)methyl]phenyl]methyl]-8-propan-2-ylisoquinolin-2-ium diiodide	626505: Displacement of [125I]-apamin from cloned SK2 channel expressed in human HEK293 cells after 1 hr by liquid scintillation counting	ki	0.3970	uM
5-chloro-N-(thiophen-2-ylmethyl)pyrazolo[1,5-a]pyrimidin-7-amine	349492: Inhibition of Kca2.2 channel expressed in HEK293 cells by thallium flux assay	ic50	0.5300	uM
2-methyl-1-[3-(2-methyl-8-propan-2-ylisoquinolin-2-ium-1-yl)propyl]-8-propan-2-ylisoquinolin-2-ium diiodide	626505: Displacement of [125I]-apamin from cloned SK2 channel expressed in human HEK293 cells after 1 hr by liquid scintillation counting	ki	0.5930	uM
6,7-dichloro-3-nitroso-1H-indol-2-ol	1974165: Positive modulation of SK2 in HEK293 cells in presence of Ca2+ by patch-clamp method	ec50	0.8000	uM
2-methyl-1-[5-(2-methyl-8-propan-2-ylisoquinolin-2-ium-1-yl)pentyl]-8-propan-2-ylisoquinolin-2-ium diiodide	626505: Displacement of [125I]-apamin from cloned SK2 channel expressed in human HEK293 cells after 1 hr by liquid scintillation counting	ki	0.8780	uM
N-benzyl-5-chloropyrazolo[1,5-a]pyrimidin-7-amine	349492: Inhibition of Kca2.2 channel expressed in HEK293 cells by thallium flux assay	ic50	1.1000	uM
(1R)-1-[3-[(1R)-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinolin-1-yl]propyl]-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinoline	2006726: Displacement of [125I]apamin from SK2 (unknown origin) expressed in HEK293 cells assessed as inhibition constant incubated for 1 hr by liquid scintillation counting analysis	ki	1.2560	uM
(14S,27R)-22,33-dimethoxy-13,28-dimethyl-2,5,7,20-tetraoxa-13,28-diazaoctacyclo[25.6.2.216,19.13,10.121,25.04,8.031,35.014,39]nonatriaconta-1(33),3(39),4(8),9,16(38),17,19(37),21,23,25(36),31,34-dodecaene	2006723: Displacement of [125I]apamin from human SK2 expressed in HEK293 cells assessed as inhibition constant incubated for 1 hr by liquid scintillation counting analysis	ki	1.3180	uM
(1S)-1-[3-[(1R)-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinolin-1-yl]propyl]-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinoline	2006726: Displacement of [125I]apamin from SK2 (unknown origin) expressed in HEK293 cells assessed as inhibition constant incubated for 1 hr by liquid scintillation counting analysis	ki	1.6850	uM
N-(4-chlorophenyl)-2-(3,5-dimethylpyrazol-1-yl)-9-methylpurin-6-amine	1974165: Positive modulation of SK2 in HEK293 cells in presence of Ca2+ by patch-clamp method	ec50	1.8000	uM
(1S)-1-[3-[(1S)-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinolin-1-yl]propyl]-6,7-dimethoxy-2-methyl-3,4-dihydro-1H-isoquinoline;dihydrochloride	332057: Inhibition of SK2 expressed in CHO FlipIn cells by whole cell patch-clamp assay	ic50	2.6000	uM

CTD chemical–gene interactions

42 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, affects expression	7
Benzo(a)pyrene	decreases expression, increases methylation, increases mutagenesis	3
entinostat	increases expression, affects cotreatment	2
Apamin	decreases activity, decreases reaction, increases activity, increases import	2
Doxorubicin	decreases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Tetrachlorodibenzodioxin	affects expression, decreases expression	2
methylmercuric chloride	increases expression	1
bisphenol A	increases expression	1
arsenite	increases methylation	1
mono-(2-ethylhexyl)phthalate	decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, increases expression, decreases reaction	1
celastrol	decreases expression	1
leiurotoxin I	decreases activity	1
CGP 52608	affects binding, increases reaction	1
gedunin	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression, decreases expression	1
dorsomorphin	affects cotreatment, increases expression, decreases expression	1
(4-amino-1,4-dihydro-3-(2-pyridyl)-5-thioxo-1,2,4-triazole)copper(II)	increases expression	1
cyclohexyl-(2-(3,5-dimethylpyrazol-1-yl)-6-methylpyrimidin-4-yl)amine	decreases reaction, increases activity, increases import, increases reaction	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Arsenic Trioxide	decreases expression	1
Bupivacaine	decreases activity	1
Calcitriol	increases expression, affects cotreatment	1
Calcium	increases activity, increases reaction	1
Cytarabine	decreases expression	1
Demecolcine	increases expression	1
Etoposide	decreases expression	1
Lipopolysaccharides	decreases reaction, increases expression, affects cotreatment	1

ChEMBL screening assays

22 unique, capped per target: 22 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1008913	Binding	Inhibition of human SK2 channel by inside-out patch clamp technique	Synthesis and structure-activity relationship studies of 2-(N-substituted)-aminobenzimidazoles as potent negative gating modulators ofsmall conductance Ca2+-activated K+ channels. — *J Med Chem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 300 trials:

NCT	Phase	Status	Title
NCT04586348	Phase 4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	Phase 4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT00417066	Phase 4	COMPLETED	Flexible GnRH Antagonist vs Flare up GnRH Agonist Protocol in Poor Responders
NCT00732693	Phase 4	COMPLETED	Evaluation of Physiologic and Standard Sex Steroid Replacement Regimens in Women With Premature Ovarian Failure
NCT00837616	Phase 4	COMPLETED	Estrogen Dosing in Turner Syndrome: Pharmacology and Metabolism
NCT01853501	Phase 4	UNKNOWN	Effects of ADSC Therapy in Women With POF
NCT02783937	Phase 4	COMPLETED	Filgrastim for Premature Ovarian Insufficiency
NCT03535480	Phase 4	UNKNOWN	Autologous Bone Marrow Stem Cell Ovarian Transplantation to Restore Ovarian Function in Premature Ovarian Failure
NCT00950196	Phase 4	COMPLETED	Amantadine for Improving Neurologic Symptoms in Ataxia-Telangiectasia
NCT04107740	Phase 4	COMPLETED	C-Trelin Orally Disintegrated(OD) Tablet 5mg in Ataxia Due to Spinocerebellar Degeneration
NCT02559102	Phase 3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	Phase 3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	Phase 3	RECRUITING	Reducing Missed Appointments
NCT07377032	Phase 3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT00140998	Phase 3	COMPLETED	Estrogen Treatment (Oral vs. Patches) in Turner Syndrome
NCT01970098	Phase 3	COMPLETED	A Confirmatory Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01970111	Phase 3	COMPLETED	An Extension Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01970124	Phase 3	COMPLETED	A Long-Term Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01970137	Phase 3	COMPLETED	A 24-week Open-label Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT02889302	Phase 3	COMPLETED	An Additional Confirmatory Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT03408080	Phase 3	ACTIVE_NOT_RECRUITING	Open Pilot Trial of BHV-4157
NCT03701399	Phase 3	ACTIVE_NOT_RECRUITING	Troriluzole in Adult Participants With Spinocerebellar Ataxia
NCT03901638	Phase 3	TERMINATED	Tllsh2910 for Ataxia and Gut Microbiota Alteration in Patients of Multiple System Atrophy
NCT07040137	Phase 3	ACTIVE_NOT_RECRUITING	Confirmatory Study 3 of KPS-0373 in Patients With Spinocerebellar Degeneration
NCT02909959	Phase 2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	Phase 2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	Phase 2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT00001951	Phase 2	COMPLETED	Hormone Replacement in Young Women With Premature Ovarian Failure
NCT00370019	Phase 2	WITHDRAWN	Effects of an Estrogen Replacement Therapy Skin Patch on Ovulation in Women With Premature Ovarian Failure
NCT00429494	Phase 2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03816852	Phase 2	SUSPENDED	The Safety and Efficiency Study of Mesenchymal Stem Cell (19#iSCLife®-POI) in Premature Ovarian Insufficiency
NCT04536467	Phase 2	UNKNOWN	Prevention of Chemotherapy-Induced Ovarian Failure With Goserelin in Premenopausal Lymphoma Patients
NCT06117982	Phase 2	COMPLETED	The Impact of Granulocyte Colony Stimulating Factor on Premature Ovarian Insufficiency
NCT00034242	Phase 2	COMPLETED	High-Dose Intravenous Immunoglobulin to Treat Cerebellar Degeneration
NCT00202397	Phase 2	COMPLETED	Effect of Riluzole as a Symptomatic Approach in Patients With Chronic Cerebellar Ataxia
NCT00503191	Phase 1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	Phase 1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	Phase 1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT02912104	Phase 1	COMPLETED	A Therapeutic Trial of Human Amniotic Epithelial Cells Transplantation for Primary Ovarian Failure
NCT03178695	Phase 1	COMPLETED	Inovium Ovarian Rejuvenation Trials
NCT04815213	Phase 1	ACTIVE_NOT_RECRUITING	The Use of Expandeded Mesenchymal Stromal Cells (MSC) in Premature Ovarian Failure (POF) in Adult Humans
NCT05138367	Phase 1	COMPLETED	Effects of UCA-PSCs in Women With POF
NCT06132542	Phase 1	UNKNOWN	Autologous ADMSC Transplantation in Patients With POI
NCT01783041	Phase 2/3	COMPLETED	Effect of Early L-Carnitine Supplementation on Neurodevelopmental Outcomes in Very Preterm Infants
NCT05767385	Phase 2/3	COMPLETED	Fetal Cerebrovascular Autoregulation in Congenital Heart Disease and Association With Neonatal Neurobehavior
NCT05675098	Early Phase 1	NOT_YET_RECRUITING	Central Nervous System Stimulants and Physical Function in Children With Cerebral Palsy
NCT00783783	Not specified	COMPLETED	CYP2D6 Pharmacogenetics in Risperidone-Treated Children
NCT01778504	Not specified	RECRUITING	Studying Childhood-onset Behavioral, Psychiatric, and Developmental Disorders
NCT01850784	Not specified	UNKNOWN	High Energy Formula Feeding in Infants With Congenital Heart Disease
NCT01922791	Not specified	COMPLETED	Nutrition and Pregnancy Intervention Study
NCT01942525	Not specified	UNKNOWN	Influence of Intrauterine Growth Restriction on Amplitude-integrated EEG in Preterm Infants
NCT02003170	Not specified	COMPLETED	Etiology and Early Diagnosis of Neurodevelopmental Disorders
NCT02118649	Not specified	COMPLETED	Enhancing Behavior and Brain Response to Visual Targets Using a Computer Game
NCT02557191	Not specified	TERMINATED	Biomarkers, Neurodevelopment and Preterm Infants
NCT02690675	Not specified	COMPLETED	Iron Supplement Effect on Child Development
NCT02694003	Not specified	COMPLETED	Better Nights, Better Days for Children With Neurodevelopment Disorders
NCT02792894	Not specified	COMPLETED	Family Networks (FaNs) for Children With Developmental Disorders and Delays
NCT02871674	Not specified	UNKNOWN	Good Night Project: Behavioural Sleep Interventions for Children With ADHD: A Randomised Controlled Trial
NCT02887157	Not specified	COMPLETED	Analyzing Retinal Microanatomy in ROP
NCT02898298	Not specified	COMPLETED	Positive Emotion Regulation Training in Children, Adolescents and Young Adults With and Without Developmental Disorder

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for KCNN2 across ~30M SureChEMBL compounds — explore on Sugi Predict.